Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Plant Physiology 133:783-793 (2003)
© 2003 American Society of Plant Biologists

This Article
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kucho, K.-i.
Right arrow Articles by Fukuzawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kucho, K.-i.
Right arrow Articles by Fukuzawa, H.
Agricola
Right arrow Articles by Kucho, K.-i.
Right arrow Articles by Fukuzawa, H.
ENVIRONMENTAL STRESS AND ADAPTATION

Cis-acting Elements and DNA-Binding Proteins Involved in CO2-Responsive Transcriptional Activation of Cah1 Encoding a Periplasmic Carbonic Anhydrase in Chlamydomonas reinhardtii1

Ken-ichi Kucho, Satoshi Yoshioka, Fumiya Taniguchi, Kanji Ohyama and Hideya Fukuzawa*

Division of Integrated Life Science, Graduate School of Biostudies, Kyoto University, Kyoto, 606–8502, Japan

Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between –293 and –231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5'-upstream region from –651 to –231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5'-upstream region of Cah1 is discussed.


Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.026492.

1 This work was supported by Grants-in-Aid from the Japanese Ministry of Education, Science and Culture and by the Japan Society for the Promotion of Science (grant no. JSPS–RFTF97R16001 to H.F.).

* Corresponding author; e-mail fukuzawa{at}lif.kyoto-u.ac.jp; fax 81–75–753–6127.

Received May 6, 2003; returned for revision June 5, 2003; accepted June 24, 2003.




This article has been cited by other articles:


Home page
J BiochemHome page
X. Fei, M. Eriksson, J. Yang, and X. Deng
An Fe Deficiency Responsive Element with a Core Sequence of TGGCA Regulates the Expression of FEA1 in Chlamydomonas reinharditii
J. Biochem., August 1, 2009; 146(2): 157 - 166.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
S. Lu, L. Li, X. Yi, C. P. Joshi, and V. L. Chiang
Differential expression of three eucalyptus secondary cell wall-related cellulose synthase genes in response to tension stress
J. Exp. Bot., February 16, 2008; (2008) erm350v1.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
T. Kohinata, H. Nishino, and H. Fukuzawa
Significance of Zinc in a Regulatory Protein, CCM1, Which Regulates the Carbon-Concentrating Mechanism in Chlamydomonas reinhardtii
Plant Cell Physiol., February 1, 2008; 49(2): 273 - 283.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
X. Fei and X. Deng
A Novel Fe Deficiency-Responsive Element (FeRE) Regulates the Expression of atx1 in Chlamydomonas reinharditii
Plant Cell Physiol., October 1, 2007; 48(10): 1496 - 1503.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
J. V. Moroney and R. A. Ynalvez
Proposed Carbon Dioxide Concentrating Mechanism in Chlamydomonas reinhardtii
Eukaryot. Cell, August 1, 2007; 6(8): 1251 - 1259.
[Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Glanz, A. Bunse, A. Wimbert, C. Balczun, and U. Kuck
A nucleosome assembly protein-like polypeptide binds to chloroplast group II intron RNA in Chlamydomonas reinhardtii
Nucleic Acids Res., October 6, 2006; 34(18): 5337 - 5351.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
R. van Lis, A. Atteia, L. A. Nogaj, and S. I. Beale
Subcellular Localization and Light-Regulated Expression of Protoporphyrinogen IX Oxidase and Ferrochelatase in Chlamydomonas reinhardtii
Plant Physiology, December 1, 2005; 139(4): 1946 - 1958.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
H. Harada, D. Nakatsuma, M. Ishida, and Y. Matsuda
Regulation of the Expression of Intracellular {beta}-Carbonic Anhydrase in Response to CO2 and Light in the Marine Diatom Phaeodactylum tricornutum
Plant Physiology, October 1, 2005; 139(2): 1041 - 1050.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
K. Miura, T. Yamano, S. Yoshioka, T. Kohinata, Y. Inoue, F. Taniguchi, E. Asamizu, Y. Nakamura, S. Tabata, K. T. Yamato, et al.
Expression Profiling-Based Identification of CO2-Responsive Genes Regulated by CCM1 Controlling a Carbon-Concentrating Mechanism in Chlamydomonas reinhardtii
Plant Physiology, July 1, 2004; 135(3): 1595 - 1607.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
S. Yoshioka, F. Taniguchi, K. Miura, T. Inoue, T. Yamano, and H. Fukuzawa
The Novel Myb Transcription Factor LCR1 Regulates the CO2-Responsive Gene Cah1, Encoding a Periplasmic Carbonic Anhydrase in Chlamydomonas reinhardtii
PLANT CELL, June 1, 2004; 16(6): 1466 - 1477.
[Abstract] [Full Text] [PDF]




HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2003 by the American Society of Plant Biologists