|
Plant Physiol. (1998) 116: 1461-1468
Three Drought-Responsive Members of the Nonspecific
Lipid-Transfer Protein Gene Family in Lycopersicon
pennellii
Show Different Developmental Patterns of
Expression1
Marcela B. Treviño and
Mary A. O' Connell*
Graduate Program in Molecular Biology and Department of Agronomy
and Horticulture, New Mexico State University, Las Cruces, New Mexico
88003-8003
 |
ABSTRACT |
Genomic clones of two nonspecific
lipid-transfer protein genes from a drought-tolerant wild species of
tomato (Lycopersicon pennellii Corr.) were isolated
using as a probe a drought- and abscisic acid (ABA)-induced cDNA clone
(pLE16) from cultivated tomato (Lycopersicon esculentum
Mill.). Both genes (LpLtp1 and LpLtp2)
were sequenced and their corresponding mRNAs were characterized; they
are both interrupted by a single intron at identical positions and
predict basic proteins of 114 amino acid residues. Genomic Southern
data indicated that these genes are members of a small gene family in
Lycopersicon spp. The 3 -untranslated regions from LpLtp1 and LpLtp2, as well as a
polymerase chain reaction-amplified 3-untranslated region from pLE16
(cross-hybridizing to a third gene in L. pennellii,
namely LpLtp3), were used as gene-specific probes to
describe expression in L. pennellii through
northern-blot analyses. All LpLtp genes were exclusively
expressed in the aerial tissues of the plant and all were drought and
ABA inducible. Each gene had a different pattern of expression in
fruit, and LpLtp1 and LpLtp2, unlike
LpLtp3, were both primarily developmentally regulated in
leaf tissue. Putative ABA-responsive elements were found in the
proximal promoter regions of LpLtp1 and
LpLtp2.
| |
INTRODUCTION |
Among several responses at the cellular level, drought stress is
known to cause specific alterations in the gene expression patterns of
plants, commonly mediated by the hormone ABA (Chandler and Robertson,
1994 ). These changes have been described in cultivated tomato
(Lycopersicon esculentum Mill.) and other members of the genus, including drought-tolerant wild species such as
Lycopersicon pennellii Corr. and Lycopersicon
chilense Dun. (Bray, 1988; Cohen and Bray, 1990; Plant et al.,
1991; Chen and Tabaeizadeh, 1992a, 1992b; Kahn et al., 1993). However,
the significance of drought-induced genes in the performance of the
plant during stress cannot be understood without knowledge of their
function. Transcript accumulation of four ABA- and drought-induced
cDNAs has been compared between L. esculentum and L. pennellii, demonstrating similar but not identical patterns of
expression in the two species and their interspecific hybrid (Kahn et
al., 1993). These studies showed that expression of one of these genes
was also spatially regulated. In the present study, DNA sequence
evidence demonstrates this gene to be a member of a small gene family
encoding nsLTPs.
In general, LTPs have the ability to transfer lipids between membrane
vesicles in vitro (Yamada, 1992; Bourgis and Kader, 1997). Unlike
specific LTPs, nsLTPs exhibit a broad range of substrate specificity
capable of transferring several classes of phospholipids and/or
glycolipids (for review, see Helmkamp, 1986; Wirtz and Gadella, 1990).
nsLTPs have been described in a variety of plant species, including
monocots, dicots, and at least one gymnosperm (for review, see Kader,
1996). A number of possible functions have been proposed for
plant nsLTPs, including involvement in epicuticular wax or cuticle
biosynthesis (Sterk et al., 1991; Pyee et al., 1994), as well as a
pathogen-defense role (Svensson et al., 1986; Molina et al., 1993;
Segura et al., 1993; Cammue et al., 1995). Moreover, nsLTP expression
can be induced by different forms of abiotic stress: Dunn et al. (1991)
demonstrated cold- and drought-stress induction in barley,
Torres-Schumann et al. (1992) reported salt-induced expression in
tomato, and Ouvard et al. (1996) observed drought-stress induction in
sunflower leaves.
nsLTP tissue-specific and developmentally regulated
expression has been documented for different organs in a variety of
plant species, and the existence of a small family of related genes has
also been reported for most of the plant species thus far analyzed
(Sterk et al., 1991; Fleming et al., 1992; Pelèse-Siebenbourg et
al., 1994; Thoma et al., 1994; Pyee and Kolattukudy, 1995; Molina et
al., 1996; Soufleri et al., 1996). However, very rarely have
gene-specific probes been used to monitor differential patterns of
expression of nsLTPs (Molina et al., 1996). It is therefore possible
that different gene family members account for the observed diversity
in patterns of expression, each one perhaps performing a different
function. In the present study, the characterization of the spatial,
developmental, drought-, and ABA-induced expression of three nsLTP gene
family members are presented.
| |
MATERIALS AND METHODS |
Plant Material and Drought-Stress and ABA Treatments
Lycopersicon pennellii Corr. LA716 and
Lycopersicon esculentum Mill. cv UC82 were grown from seed
in the greenhouse and fertilized with Osmocote (Scotts-Sierra,
Maysville, OH). Plants were well watered except during drought-stress
treatments, when water was withheld until the plants were visibly
wilted. The time to wilt varied slightly from experiment to experiment
but usually fell within the range of 5 to 7 d, depending on air
temperature and size of the plant. Collection of tissue throughout
leaf-blade expansion was based on leaf growth stage, from the smallest
leaf readily identifiable (L1) to a fully expanded leaf (L5), and three intermediate sizes (L2, L3, and L4). For ABA treatments, the petioles of fully expanded, detached leaves were immersed for 6 h (on the laboratory bench) in either 10 3,
104, or 105
m ABA solutions in 10 mm Mes buffer, pH 5.8;
these solutions were prepared from a 0.1 m ABA stock
solution in ethanol. Petioles of control leaves were immersed in water
or in 10 mm Mes buffer.
Nucleic Acid Isolation and Blot Hybridization
A genomic library of L. pennellii in
bacteriophage EMBL3 was screened with the cDNA pLE16 using standard
methods. Plant tissues were collected directly into liquid
N2 for RNA or DNA extractions. Genomic DNA
and total RNA isolations, as well as Southern-blot and northern-blot
transfers and hybridizations were performed as previously described
(Kahn et al., 1993); poly(A+) mRNA was purified
from total RNA preparations using oligo(dT)-cellulose (Promega). Four
identical sets of RNA blots were prepared for every treatment, and each
one was hybridized to one of four different probes. Probes consisted of
gel-purified DNA fragments oligolabeled with
[32P]dCTP. The relative amount of hybridization
to the probes was determined using a scanning densitometer. All
northern displays were replicated using a second set of independently
isolated RNA samples.
DNA Sequencing and Analysis
The genomic insert was subcloned into the plasmid vector
pBluescript KS (Stratagene) and overlapping deletions were generated using the ExoIII mung bean nuclease system (Stratagene). Both strands
of each insert were sequenced using the Sequenase 2.0 kit (United
States Biochemical). RT-PCR and PCR products were cloned into the
plasmid vector pGEM-T (Promega) before sequencing. Sequence data
were manipulated using the programs SeqAid, DNA Inspector II,
DNAnalysis88, and M-fold (http://ibc.wustl.edu/~zuker/rna/.cgi). DNA
sequences were searched against DNA
databases using the Blast algorithm (Altschul et al.,
1990), and amino acid sequence alignments were performed with ClustalW
(1.60) (http://alfredo.wustl.edu/msa/clustal.cgi).
Anchored RT-PCR
One-sided (anchored) RT-PCR assays for cDNA amplification were
carried out essentially as described by Ausubel et al. (1996), except
for two modifications. First, aside from
poly(A+) RNA, total RNA was used in parallel as a
template for cDNA synthesis. Second, a primer consisting of a random
20-mer sequence (GTGAACTTAGGTGACTGACG) followed by a
(dT)12 tail was used for the RT reaction instead of an oligo(dT)20 primer, and the 20-mer sequence
alone was used for the PCR reactions. Either normal or wilted L. pennellii leaves were used as a source for RNA; L. esculentum leaf RNA and L. pennellii root RNA were used
as negative controls. All nucleotide locations refer to DNA sequences
deposited in GenBank with the following accession numbers:
LpLtp1, U66465; LpLtp2, U66466; and pLE16, U81996. Upstream anchored RT-PCR was used to map the transcription initiation points; the primer used for cDNA synthesis and for the first
PCR round was complementary to nucleotides 385 to 402 in
LpLtp1, which are identical to positions 373 to 390 in
LpLtp2; gene-specific primers were used for the second PCR
round (a 20-mer complementary to positions 319-338 in
LpLtp1 and a 19-mer complementary to positions 307-325 in
LpLtp2). The intron splice sites and the transcription
termination points were mapped simultaneously using downstream anchored
RT-PCR. A sequence common to both genes was used to prime the first PCR
round (nucleotides 231-249 in LpLtp1 or 219-237 in
LpLtp2); gene-specific primers for the second PCR round
corresponded to positions 315 to 334 in LpLtp1 and 303 to 321 in LpLtp2.
Conserved-Region and Gene-Specific Probe Preparation
DNA fragments partially encompassing the 3 UTRs were used as
gene-specific probes: a 336-bp BamHI/DraI
fragment for LpLtp1 and a 268-bp
BamHI/SspI fragment for LpLtp2 (Figs.
2 and 3, respectively), both of which were cloned into pBluescript. The
gene-specific probe for LpLtp3 consisted of a 193-bp
PCR-amplified fragment from the tomato cDNA clone pLE16 (nucleotides
576-768). A 251-bp NlaIV/SspI fragment from the
coding region in LpLtp1 was cloned into pBluescript and used
as a conserved-region probe to detect all members of the
nsLtp gene family.
View larger version (20K):
[in this window]
[in a new window]
| Figure 2.
Deduced amino acid sequence alignment of nsLTPs
from wild tomato (L. pennellii), cultivated tomato
(L. esculentum), and tobacco (Nicotiana
tabacum). Tomato sequences are from genes le16
(accession no. U81996) and TSW12 (accession no. X56040); tobacco
sequences are from genes TobLTP1 (accession no. D13952)
and NTLTP1 (accession no. X62395). The alignment was
performed using ClustalW (1.60). Positions of identity with respect to
LpLTP1 are indicated by dots. The asterisks mark
identical residues; the arrowheads indicate conservative substitutions
in all six genes. Eight Cys and four Pro residues at highly conserved
positions in all plant nsLTPs are underlined. The number of amino acid
residues is indicated to the right of each sequence.
|
|
View larger version (53K):
[in this window]
[in a new window]
| Figure 3.
Genomic Southern blot of L. pennellii (P) and L. esculentum (E). Genomic DNA
(8 µg) was digested with HindIII. Blots were probed
with either an Ltp conserved-region probe (Cod250), or gene-specific probes for LpLtp1, LpLtp2,
and LpLtp3. The sizes of
LpLtp-hybridizing fragments are indicated in kb.
|
|
| |
RESULTS |
Structure of Two Members from the nsLtp Gene
Family in L. pennellii
The cDNA clone pLE16 was isolated from L. esculentum
based on differential screening for ABA- and drought-induced leaf
transcripts (Plant et al., 1991), and was used to screen an L. pennellii genomic library. A restriction endonuclease map was
obtained for the 15-kb genomic insert in a hybridizing recombinant
plaque. Two regions of hybridization to pLE16 were identified within a
9.1-kb HindIII/SalI fragment (Fig.
1). A comparison of these sequences with
DNA databases revealed that each hybridizing region contained a
full-length gene with a high degree of sequence similarity to plant
nsLTP genes. The genes are referred to as LpLtp1
(accession no. U66465) and LpLtp2 (accession no. U66466).
They are oriented in tandem in the L. pennellii genome; the
distance between the 3 end of LpLtp1 transcript and the 5
end of LpLtp2 transcript is 3.4 kb (Fig. 1).
View larger version (7K):
[in this window]
[in a new window]
| Figure 1.
Restriction endonuclease map of a 9.1-kb DNA
fragment from the L. pennellii genomic clone Pen16. The
indicated restriction fragments were subcloned into pBluescript for
sequence analysis. The SalI site is provided by the
EMBL3 phage vector. The exons (open bars) and introns (filled bars) of
LpLtp1 and LpLtp2 are shown, with the
direction of transcription indicated by the arrows.
|
|
Upstream, anchored RT-PCR was used to map transcript initiation sites.
After cloning into pGEM-T, the PCR fragments were sequenced to
determine the position of transcript initiation for each gene. The
lengths of the 5 UTRs in LpLtp1 and LpLtp2 are
84 and 72 nucleotides, respectively. CAAT and TATA boxes were
identified upstream from the transcription initiation site at positions
 49 and 35 in LpLtp1 and positions 47 and 34 in
LpLtp2, respectively.
Based on the Blast sequence comparisons, an intron was predicted
to be present in both genes. Using primers located upstream from the
predicted intron position, the intron splice sites and transcription
termination points were simultaneously mapped with downstream-anchored
RT-PCR. Two bands (350 and 450 bp) were obtained with the
LpLtp2-specific primer, suggesting that two alternative transcript sizes are produced for this gene. Sequencing of the cloned
PCR fragments confirmed the predicted intron positions and identified
the transcript termination sites: LpLtp1, 3 UTR is 212 nucleotides; and LpLtp2, 3 UTRs are 201 and 313 nucleotides. Examination of the nucleotide sequence at the intron/exon
boundaries revealed the presence in both genes of consensus nucleotides
found in the boundaries of class III introns from plants. The exon
length (335 and 10 nucleotides) and the intron position are identical in both genes, but the intron in LpLtp1 is shorter than the
one in LpLtp2 (269 versus 315 nucleotides, respectively). A
putative polyadenylation signal was found in the 3 UTR of each gene.
Possible Regulatory Elements in the 5-Flanking Regions of
LpLtp1 and LpLtp2
Transcripts of nsLTP genes accumulate in L. pennellii and L. esculentum leaves in response to ABA
(Kahn et al., 1993). It is not known, however, whether transcript
induction by ABA occurs with all or only specific members of the
nsLTP family. Inspection of the 5-flanking region of
LpLtp1 and LpLtp2 revealed the presence of
consensus regulatory elements associated with ABA responsiveness (Marcotte et al., 1989; Shen and Ho, 1995). A putative ABRE of this
type is found at position 329 (sequence CACGTTTC) in
LpLtp1 and at position 176 (sequence CACGTAAG) in
LpLtp2. An additional G-box, GAACGTCAG, is found at position
621 in LpLtp2. A G-box-type ABRE is required but not
sufficient for ABA-induced gene expression, for the ABA-responsive
barley gene HVA22, a novel coupling element (CE1), in
combination with the G-box, is required for ABA responsiveness (Shen
and Ho, 1995). Five CE1-like sequences (core consensus CACC) were found
in LpLtp1 at positions 114, 86, 74, 4, and +25, whereas in LpLtp2 a single CE1-like sequence is present at
position 119.
Comparison of LpLTP1 and LpLTP2 with Other Plant nsLTPs
LpLtp1 and LpLtp2 encode basic proteins of
114 amino acid residues, with calculated molecular masses of 11,545 D
for LpLTP1 and 11,718 D for LpLTP2. The predicted polypeptides contain
a hydrophobic region at the amino terminus with the characteristics of a signal peptide; according to the rules outlined by von Heijne (1986), cleavage of this putative signal peptide is predicted to occur
between positions 24 (Ala) and 25 (Leu) in both gene products. The
calculated pIs and molecular masses of the putative mature polypeptides
are 8.94 and 8,970 D for LpLTP1, and 8.48 and 9,116 D for LpLTP2,
respectively. Further, LpLTP1 and LpLTP2 have eight Cys and four Pro
residues at highly conserved positions found in all other nsLTPs
(Yamada, 1992; Shin et al., 1995) (Fig. 2).
A ClustalW alignment of LpLTP1 and LpLTP2 with nsLTPs from L. esculentum and tobacco is presented in Figure 2. The
nsLTP sequences from L. esculentum were isolated
as cDNA clones of a NaCl-induced gene, TSW12
(Torres-Schumann et al., 1992), and an ABA- and drought-induced gene,
le16 (Plant et al., 1991). In the case of tobacco,
TobLTP was isolated as a cDNA clone (Masuta et al., 1992)
and NTLTP1 was isolated as a genomic clone (Fleming et al.,
1992). All gene products have the same length and are highly
homologous: 62% of the residues are identical in all six LTPs, whereas
an additional 15% are conservative substitutions. Percent amino acid
residue identities among the six LTPs are shown in Table
I. LpLTP1 exhibits 99% amino acid
sequence identity to TSW12, strongly suggesting that they are alleles.
LpLTP2 and LE16 have 82 and 84% sequence identity with LpLTP1,
respectively, but only 78% with each other. These data, together with
additional evidence presented in the following section, indicate that
these two genes are not alleles. In the case of tobacco, TobLTP and
NTLTP1 exhibit 85 and 74% amino acid sequence identity, respectively,
to LpLTP1. When TobLTP and NTLTP1 are compared with LpLTP2, percent
identities are 78 and 76, respectively.
Comparison of nsLtp Gene Families in L. pennellii and L. esculentum: Generation of
Three nsLTP Gene-Specific Probes
Genomic DNA fragments partially encompassing the 3 UTR of
LpLtp1 and LpLtp2 were used as gene-specific
probes to describe their patterns of expression. In addition, a 250-bp
DNA fragment within the coding sequence of LpLtp1,
downstream from the putative signal peptide, was used as the
conserved-region probe (Cod250; nucleotides 189-439) to detect all of
the gene family members. We used the probes for Southern analysis to
confirm their specificity and to study the nsLtp gene family
organization (Fig. 3). An equal number of
restriction fragments hybridize to the probe Cod250 in L. pennellii and L. esculentum, exhibiting several
polymorphisms. When the gene-specific probes for LpLtp1 and
LpLtp2 were used, a single major band hybridized to each
probe in L. pennellii and L. esculentum: 10.2 kb
versus 4.3 kb for LpLtp1 and 7.0 kb versus 8.1 kb for
LpLtp2. In all cases, the bands for the gene-specific probes
co-migrate with a band detected by the probe Cod250.
The hybridization of the gene-specific probes to tomato DNA
demonstrates that there is sequence conservation within the 3 UTRs of
the nsLtp alleles in these two species. Based on this observation, a third gene-specific probe for LpLtp3 was
generated through PCR amplification of a fragment in the 3 UTR of the
L. esculentum cDNA pLE16. This probe hybridizes to two
Cod250-related fragments (approximately 3 and 4 kb) in the L. esculentum genome and to a single 2.5-kb fragment in L. pennellii (Fig. 3). Based on the le16 genomic sequence
in L. esculentum, there are no HindIII restriction sites within the amplified fragment of the 3 UTR. In fact,
the 3-kb HindIII fragment corresponds to the genomic fragment encompassing le16 (Plant et al., 1991). The 4-kb
HindIII fragment hybridizing to the
LpLtp3-specific probe corresponds to an additional
nsLtp gene or pseudogene in L. esculentum, which is closely related to le16. Aside from these three
nsLtp genes in L. pennellii, there are four
additional HindIII fragments (3.8, 5.5, 6.2, and 22 kb)
hybridizing to the probe Cod250.
Spatial and Drought-Induced Expression of Three
nsLTP Genes in L. pennellii
Gene-specific probes were used to separately describe the
expression of three individual members of the nsLtp family
in different organs of normal and wilted L. pennellii
plants. nsLtp transcripts accumulated differentially
throughout leaf-blade expansion in normal and wilted plants (Fig.
4). Whereas transcription of
LpLtp1 and LpLtp2 was constitutive in
well-watered plants, decreasing as the leaves matured,
LpLtp3 transcription was detectable at only very low levels
in younger leaves (L1-L3) and was not detected in leaf stages L4 and
L5. Transcript accumulation of all three genes was affected differently
during drought-stress conditions. LpLtp1 transcript levels
increased and were approximately the same for all leaf-growth stages in
wilted plants, equaling about twice the level found in the youngest
leaves from well-watered plants. In wilted plants, LpLtp2
transcription was repressed in younger leaves and induced in older
leaves relative to the levels in well-watered plants, resulting in a
similar but less pronounced developmental profile. In the case of
LpLtp3, water deficit induced transcription at comparable
levels in all leaf sizes. The probe Cod250 monitored the accumulation
of transcripts from all nsLtp genes.
View larger version (66K):
[in this window]
[in a new window]
| Figure 4.
nsLtp transcript accumulation during
late development of leaves from normal (N) or wilted (W) L. pennellii plants. RNA (7.5 µg) isolated from the smallest
leaf (L1) to a fully expanded leaf (L5) was probed with either the
nsLtp conserved-region probe (Cod250), or gene-specific
probes for LpLtp1, LpLtp2, or
LpLtp3. The relative intensity (RI) of hybridization to
each probe is graphed to the right of each autoradiogram. A photograph
of one of the ethidium-bromide-stained gels is shown at the bottom for
load comparison.
|
|
Northern analyses of individual nsLtp gene expression was
also performed in other aerial tissues of normal and drought-stressed plants (Fig. 5). As in the case of leaf
tissue, transcript distribution was unique for each gene. Transcripts
for all three genes accumulated to higher levels in stem and in both
open and closed flowers in wilted plants. LpLtp1 and
LpLtp2 were distinguished by their patterns of expression in
fruit; LpLtp1 had no detectable expression in fruit, whereas
LpLtp2 was expressed in all organs tested including fruit.
LpLtp3 was expressed in all drought-stressed organs, and in
well-watered plants, LpLtp3 appreciably accumulated only in fruit. The absence of nsLtp transcription in roots has been
previously demonstrated (Kahn et al., 1993), and thus roots were not
included in this study.
View larger version (76K):
[in this window]
[in a new window]
| Figure 5.
nsLtp transcript accumulation in stem,
flower, and fruit from normal (N) or wilted (W) L. pennellii plants. RNA (7.5 µg) isolated from stems (St),
closed (Fc), and open (Fo) flowers and immature fruits (Fr) was probed
and analyzed as in Figure 4.
|
|
ABA-Induced Expression of Three nsLtp Genes in
L. pennellii
nsLtp transcript accumulation was assessed using
gene-specific probes in detached, fully expanded leaves that had been
exposed to a range of ABA concentrations (Fig.
6). These treatments resulted in
intracellular ABA levels comparable to those that occur in the
plant as a result of drought stress (Kahn et al., 1993). Transcript levels for all three genes were increased to 10- to 20-fold over the
buffer control by exogenous ABA, in a dose-dependent manner. In the
case of LpLtp1 and LpLtp2, transcript levels
induced by exogenous ABA were higher than those resulting from drought
stress in whole plants. In contrast, LpLtp3 transcript
levels were higher in droughted than in ABA-treated leaves.
View larger version (73K):
[in this window]
[in a new window]
| Figure 6.
nsLtp transcript accumulation in
ABA-treated leaves from L. pennellii. RNA (7.5 µg)
isolated from detached, fully expanded leaf petioles that had been
immersed for 6 h in either water (H), 10 mm Mes buffer
(B), or increasing concentrations of ABA in 10 mm Mes
buffer; or from fully expanded leaves (L5) of normal (N) or wilted (W)
plants, was probed and analyzed as in Figure 4.
|
|
| |
DISCUSSION |
The gene-specific patterns of expression for three members of the
nsLtp gene family were characterized in the
drought-resistant tomato species L. pennellii. The
gene-specific probes used for this analysis were developed following
isolation and complete characterization of the genomic clone form of
LpLtp1 and LpLtp2. The third gene-specific probe
was developed from a cDNA form of a gene member from cultivated tomato.
The results of this investigation demonstrated that although members of
this gene family are inducible by drought stress, development plays the
primary role in the regulation of expression of at least two members of
this gene family.
LpLtp1 and LpLtp2 are oriented in tandem in the
L. pennellii genome, with LpLtp1 located upstream
of LpLtp2, and the transcribed regions separated by
approximately 3.4 kb. Both genes consist of two exons of conserved
lengths, interrupted by a single intron located at identical positions
but differing in length. The intron location is the same as in most
plant nsLtp genes for which a genomic sequence is available
(Kader, 1996). Genomic Southern data indicated the existence of a
nsLTP family in L. pennellii and L. esculentum, composed of at least five to seven members. In most
plant species thus far analyzed, nsLTPs are encoded by a small gene
family and linkage of some members of the gene family has been
observed, e.g. tobacco, sorghum, and barley, among others (Fleming et
al., 1992; Pelèse-Siebenbourg et al., 1994; White et al., 1994;
Kader, 1996). In the case of maize, additional nsLTP isoforms have been
reported to occur via alternative splicing of a nsLtp gene
(Arondel et al., 1991).
The deduced amino acid sequences for LpLtp1 and
LpLtp2 share a number of characteristics common to all plant
nsLTPs: they have a low Mr, a basic pI, eight
Cys and four Pro residues at conserved positions, and an amino-terminal
signal peptide for translocation into the ER.
LpLTP1 and LpLTP2 showed the highest degree of amino acid sequence
identity (72-99%) with nsLTPs from tomato and tobacco. TSW12 is a cDNA clone isolated from cultivated tomato leaves
in a screen for salt-inducible transcripts (Torres-Schumann et al., 1992). At the DNA level, LpLtp1 differs from the tomato gene
TSW12 at five nucleotide positions within the coding region,
and only one of them represents a missense substitution in the amino
acid sequence. Moreover, homology in the nucleotide sequence of these two genes extends through the 3 UTR (data not shown), suggesting that
they are alleles. le16 is a cDNA clone isolated in a screen of cultivated tomato leaves for ABA and drought-inducible transcripts (Plant et al., 1991). A lower percentage in amino acid sequence identity between LpLTP2 and LE16, as well as the lack of
cross-hybridization between their corresponding 3 UTRs, suggests that
they are not alleles. In fact, their deduced polypeptides show a higher
degree of sequence identity to LpLTP1 than to each other. Amino acid sequence comparisons with the tobacco nsLTPs suggest that TobLTP (Masuta et al., 1992) is more closely related than NTLTP1 (Fleming et
al., 1992) to all of the nsLTPs thus far described in
Lycopersicon spp.
The 3 UTRs of the nsLtp alleles in L. pennellii
and L. esculentum have a high degree of nucleotide sequence
conservation, indicating that the gene family members were generated in
a common ancestor prior to the differentiation of the two species. This high degree of sequence homology in the 3 UTRs allowed their use as
gene-specific probes in both species. In addition, the 3 UTR from the
L. esculentum gene le16 was used as a probe to detect a third member (designated LpLtp3) of the
nsLtp gene family in L. pennellii. These three
nsLtp family members are probably physically linked in the
genome. LpLtp1 and LpLtp2 were mapped within 7 kb
on a phage clone (Fig. 1). The gene-specific probes for
LpLtp2 and LpLtp3, as well as the Cod250 probe,
all hybridized to a common 12-kb fragment in the L. esculentum genome (data not shown). Altogether, these results
suggest that at least three members of the nsLtp family are
physically contiguous in Lycopersicon spp.
A variety of possible roles for nsLTPs has been proposed based on their
in vitro properties and their spatial expression patterns (Pelèse-Siebenbourg et al., 1994; Shin et al., 1995; Kader,
1996). Secretion of a nsLtp (EP2) from carrot somatic embryos has been reported by Sterk et al. (1991), who have proposed a role for nsLTPs in
cutin biosynthesis by effecting the transport of cutin monomers through
the extracellular matrix. In accordance with this notion, we
found that transcription of nsLtps in L. pennellii is restricted to the aerial tissues of the plant.
Moreover, accumulation of LpLtp1 and LpLtp2
transcripts in leaves is also developmentally regulated, with levels
being the highest in young leaves, when biosynthesis of the cuticular
membrane is required for leaf expansion, and decreasing as the leaves
mature, when the demand for epidermal components declines. A number of
studies have reported epidermal cell-specific expression of nsLTPs in
various plant tissues (Sterk et al., 1991; Fleming et al., 1992; Thoma
et al., 1994). It is interesting that Pyee et al. (1994) have reported
a nsLTP to be a major surface wax protein in broccoli leaves.
Organ- and tissue-specific expression of nsLtp genes has
been reported in several plant species (Tsuboi et al., 1991; Kotilainen et al., 1994; Thoma et al., 1994; Soufleri et al., 1996). Although none
of the three nsLtp genes studied in L. pennellii
were found to be organ specific, their transcript accumulation patterns
in leaves, stems, flowers, and fruit were different. Accumulation of
LpLtp1 and LpLtp2 transcripts in leaves was
primarily developmentally regulated and LpLtp1 and
LpLtp2 were distinguished by their patterns of expression in
fruit. In contrast, accumulation of transcripts from LpLtp3
was rarely observed in unstressed tissues. Transcripts for
nsLtps were not detected in roots of L. esculentum, L. pennellii, or the interspecific
F1, using the cDNA clone pLE16 as a probe (Kahn
et al., 1993).
Drought stress affected transcript accumulation of the three
nsLtp genes in a different manner, but an overall increase
in total nsLtp transcript levels was observed as a result of
the stress. This observation also seems to be in agreement with the proposed involvement of nsLTPs in cuticle biosynthesis (Sterk et al.,
1991), since the cuticle plays an important role in the water balance
of plants (Lemieux, 1996). Presumably, the induction of
nsLtp expression represents an adaptive response to drought stress, in which the plant may be able to reduce water loss by increasing the cuticle thickness. Induction of nsLtps by
several forms of dehydrative stress has been previously reported (Dunn et al., 1991; Torres-Schuman et al., 1992; White et al., 1994; Soufleri
et al., 1996). In all of these cases, ABA responsiveness was implicated
in the induction of nsLtp expression.
Although leaf transcript levels for all three nsLtps in
L. pennellii were increased in response to exogenous ABA,
each gene had a unique dose response. ABA responsiveness appears to be
the result of two distinct cis elements, a G-box class
element, ABRE, and a coupling element, CE, and the diversity of
ABA-mediated responses in planta appears to be the result of
combinations of ABREs and different relative locations of unique
coupling elements (Shen et al., 1996). Putative ABREs and CE-1-like
cis-elements were found in the upstream regulatory regions
of LpLtp1 and LpLtp2, yet LpLtp1
appears to be much less responsive to ABA. It is conceivable that in
the case of LpLtp1 an additional physiological signal is
required for ABA to affect induction of transcription. Elevated leaf
transcript levels in the water control relative to the buffer treatment
control were seen for all three genes. We are unable to explain this
anomalous response.
In summary, it appears that, although members in the nsLtp
gene family can be developmentally expressed in different plant organs,
their expression may also be mediated by ABA during dehydrative stress.
The characterization of all of the members in the nsLtp gene
family, as well as their expression patterns and subcellular localization, should help in the elucidation of their functions in the
plant.
| |
FOOTNOTES |
1
This work was supported in part by the New
Mexico Agricultural Experiment Station, U.S. Department of Agriculture
special grant no. SWCPGWR, and National Institutes of Health grant no. S06 GM08136 to M.A.O.
*
Corresponding author; e-mail moconnel{at}nmsu.edu; fax
1-505-646-6041.
Received June 30, 1997;
accepted December 31, 1997.
| |
ABBREVIATIONS |
Abbreviations:
ABRE, ABA-responsive element.
L1 through L5, five different stages in leaf expansion, L1 smallest to L5 largest.
nsLTP, nonspecific lipid-transfer protein.
RT-PCR, reversetranscriptase-PCR.
UTR, untranslated region.
| |
ACKNOWLEDGMENTS |
We thank Beth Bray for providing us with the cDNA clone pLE16,
Owen White for construction of the genomic library, and Sue Fender for
isolation of the poly(A+) RNA.
| |
LITERATURE CITED |
Altschul SF,
Warren G,
Miller W,
Myers EW,
Lipman DJ
(1990)
Basic local alignment search tool.
J Mol Biol
215:
403-410
[CrossRef][Web of Science][Medline]
Arondel V,
Tchang F,
Baillet B,
Vignols F,
Grellet F,
Delsney M,
Kader JC,
Puigdomenech P
(1991)
Multiple mRNA coding for phospholipid-transfer protein from Zea mays arise from alternative splicing.
Gene
99:
133-136
[Medline]
Ausubel FM,
Brent R,
Kingston RE,
Moore DD,
Seidman JG,
Smith JA,
Struhl K
(1996)
Current Protocols in Molecular Biology.
John Wiley & Sons, New York
Bourgis F,
Kader J-C
(1997)
Lipid-transfer proteins: tools for manipulating membrane lipids.
Physiol Plant
100:
78-84
[CrossRef]
Bray EA
(1988)
Drought- and ABA-induced changes in polypeptide and mRNA accumulation in tomato leaves.
Plant Physiol
88:
1210-1214
[Abstract/Free Full Text]
Cammue BPA,
Thevissen K,
Hendriks M,
Eggermont K,
Goderis IJ,
Proost P,
Van Damme J,
Osborn W,
Guerbette F,
Kader JC,
and others
(1995)
A potent antimicrobial protein from onion seeds showing sequence homology to plant lipid transfer proteins.
Plant Physiol
109:
445-455
[Abstract]
Chandler PM,
Robertson M
(1994)
Gene expression regulated by abscisic acid and its relation to stress tolerance.
Annu Rev Plant Physiol Plant Mol Biol
45:
113-141
[CrossRef][Web of Science]
Chen RD,
Tabaeizadeh Z
(1992a)
Alteration of gene expression in tomato plants (Lycopersicon esculentum) by drought and salt stress.
Genome
35:
385-391
Chen RD,
Tabaeizadeh Z
(1992b)
Expression and molecular cloning of drought-induced genes in the wild tomato Lycopersicon chilense.
Biochem Cell Biol
70:
199-206
[Medline]
Cohen A,
Bray EA
(1990)
Characterization of three mRNAs that accumulate in wilted tomato leaves in response to elevated levels of endogenous abscisic acid.
Planta
182:
27-33
Dunn MA,
Hughes MA,
Zhang L,
Pearce RS,
Quigley AS,
Jack PL
(1991)
Nucleotide sequence and molecular analysis of the low temperature induced cereal gene, BLT4.
Mol Gen Genet
229:
389-394
[CrossRef][Web of Science][Medline]
Fleming AJ,
Mandel T,
Hofmann S,
Sterk P,
de Vries SC,
Kuhlemeier C
(1992)
Expression pattern of a tobacco lipid transfer protein gene within the shoot apex.
Plant J
2:
855-862
[Web of Science][Medline]
Helmkamp GM
(1986)
Phospholipid transfer proteins: mechanism of action.
J Bioenerg Biomembr
18:
71-91
[CrossRef][Medline]
Kader J-C
(1996)
Lipid-transfer proteins in plants.
Annu Rev Plant Physiol Plant Mol Biol
47:
627-654
[CrossRef][Web of Science]
Kahn TL,
Fender SE,
Bray EA,
O'Connell MA
(1993)
Characterization of expression of drought- and abscisic acid-regulated tomato genes in the drought-resistant species Lycopersicon pennellii.
Plant Physiol
103:
597-605
[Abstract]
Kotilainen M,
Helariutta Y,
Elomaa P,
Paulin L,
Teeri TH
(1994)
A corolla- and carpel-abundant, non-specific lipid transfer protein gene is expressed in the epidermis and parenchyma of Gerbera hybrida var. Regina (Compositae).
Plant Mol Biol
26:
971-978
[CrossRef][Medline]
Lemieux B
(1996)
Molecular genetics of epicuticular wax biosynthesis.
Trends Plant Sci
1:
312-318
[CrossRef]
Marcotte WR,
Russell SH,
Quatrano RS
(1989)
Abscisic acid-responsive sequences from the Em gene of wheat.
Plant Cell
1:
969-976
[Abstract/Free Full Text]
Masuta C,
Furuno M,
Tanaka H,
Yamada M,
Koiwai A
(1992)
Molecular cloning of a cDNA clone for tobacco lipid transfer protein and expression of the functional protein in Escherichia coli.
FEBS Lett
311:
119-123
[Medline]
Molina A,
Diaz,
I,
Vasil IK,
Carbonero P,
Garcia-Olmeda F
(1996)
Two cold-inducible genes encoding lipid transfer protein LTP4 from barley show differential responses to bacterial pathogens.
Mol Gen Genet
252:
162-168
[Medline]
Molina A,
Segura A,
García-Olmedo F
(1993)
Lipid transfer proteins (nsLTPs) from barley and maize leaves are potent inhibitors of bacterial and fungal plant pathogens.
FEBS Lett
316:
119-122
[CrossRef][Web of Science][Medline]
Ouvrard O,
Cellier F,
Ferrare K,
Tousch D,
Lamaze T,
Dupuis JM,
Casse-Delbart F
(1996)
Identification and expression of water stress- and abscisic acid-regulated genes in a drought-tolerant sunflower genotype.
Plant Mol Biol
31:
819-829
[CrossRef][Web of Science][Medline]
Pelèse-Siebenbourg F,
Caelles C,
Kader J-C,
Delseny M,
Puigdomènech P
(1994)
A pair of genes coding for lipid-transfer proteins in Sorghum vulgare.
Gene
148:
305-308
[CrossRef][Web of Science][Medline]
Plant AL,
Cohen A,
Moses MS,
Bray EA
(1991)
Nucleotide sequence and spatial expression pattern of a drought- and abscisic acid-induced gene of tomato.
Plant Physiol
97:
900-906
[Abstract/Free Full Text]
Pyee J,
Kolattukudy PE
(1995)
The gene for the major cuticular wax-associated protein and three homologous genes from broccoli (Brassica oleracea) and their expression patterns.
Plant J
7:
49-59
[CrossRef][Web of Science][Medline]
Pyee J,
Yu H,
Kolattukudy PE
(1994)
Identification of a lipid transfer protein as the major protein in the surface wax of broccoli (Brassica oleracea) leaves.
Arch Biochem Biophys
311:
460-468
[CrossRef][Web of Science][Medline]
Segura A,
Moreno M,
García-Olmedo F
(1993)
Purification and antipathogenic activity of lipid transfer proteins (LTPs) from the leaves of Arabidopsis and spinach.
FEBS Lett
332:
243-246
[CrossRef][Web of Science][Medline]
Shen Q,
Ho THD
(1995)
Functional dissection of an abscisic acid (ABA)-inducible gene reveals two independent ABA-responsive complexes each containing a G-box and a novel cis-acting element.
Plant Cell
7:
295-307
[Abstract]
Shen Q,
Zhang P,
Ho THD
(1996)
Modular nature of abscisic acid (ABA) response complexes: composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley.
Plant Cell
8:
1107-1119
[Abstract]
Shin DH,
Lee JY,
Hwang KY,
Kim KK,
Suh SW
(1995)
High-resolution crystal structure of the non-specific lipid-transfer protein from maize seedlings.
Structure
3:
189-199
[Medline]
Soufleri IA,
Vergnolle C,
Miginiac E,
Kader JC
(1996)
Germination-specific lipid transfer protein cDNAs in Brassica napus L.
Planta
199:
229-237
[Web of Science][Medline]
Sterk P,
Booij H,
Schellekens GA,
Van Kammen A,
De Vries SC
(1991)
Cell-specific expression of the carrot EP2 lipid transfer protein gene.
Plant Cell
3:
907-921
[Abstract/Free Full Text]
Svensson B,
Asano K,
Jonassen IB,
Poulsen FM,
Mundy J,
Svendsen IB
(1986)
A 10 kD barley seed protein homologous with an a-amylase inhibitor from finger millet.
Carlsberg Res Commun
51:
493-500
Thoma S,
Hecht U,
Kippers A,
Botella J,
de Vries S,
Somerville C
(1994)
Tissue-specific expression of a gene encoding a cell wall-localized lipid transfer protein from Arabidopsis.
Plant Physiol
105:
35-45
[Abstract]
Torres-Schumann S,
Godoy JA,
Pintor-Toro JA
(1992)
A probable lipid transfer protein gene is induced by NaCl in stems of tomato plants.
Plant Mol Biol
18:
749-757
[CrossRef][Web of Science][Medline]
Tsuboi S,
Suga T,
Takishima K,
Mamiya G,
Matsui K,
Ozeki Y,
Yamada M
(1991)
Organ-specific occurrence and expression of the isoforms of nonspecific lipid transfer protein in castor bean seedlings, and molecular cloning of a full-length cDNA for a cotyledon-specific isoform.
J Biochem
110:
823-831
[Abstract/Free Full Text]
von Heijne G
(1986)
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res
14:
4683-4690
[Abstract/Free Full Text]
White AJ,
Dunn MA,
Brown K,
Hughes MA
(1994)
Comparative analysis of genomic sequence and expression of a lipid transfer protein gene family in winter barley.
J Exp Bot
45:
1885-1892
[Abstract/Free Full Text]
Wirtz KWA,
Gadella TWJ
(1990)
Properties and modes of action of specific and nonspecific phospholipid transfer proteins.
Experientia
46:
592-599
[Medline]
Yamada M
(1992)
Lipid transfer proteins in plants and microorganisms.
Plant Cell Physiol
33:
1-6
[Abstract/Free Full Text]
This article has been cited by other articles:
|
|
|
|
 
A. Shahpiri, B. Svensson, and C. Finnie
From Proteomics to Structural Studies of Cytosolic/Mitochondrial-Type Thioredoxin Systems in Barley Seeds
Mol Plant,
May 1, 2009;
2(3):
378 - 389.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Maghuly, E. G. Borroto-fernandez, M. A. Khan, A. Herndl, G. Marzban, and M. Laimer
Expression of calmodulin and lipid transfer protein genes in Prunus incisa x serrula under different stress conditions
Tree Physiol,
March 1, 2009;
29(3):
437 - 444.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Wu, Z. Zhang, H. Zhang, X.-C. Wang, and R. Huang
Transcriptional Modulation of Ethylene Response Factor Protein JERF3 in the Oxidative Stress Response Enhances Tolerance of Tobacco Seedlings to Salt, Drought, and Freezing
Plant Physiology,
December 1, 2008;
148(4):
1953 - 1963.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Agusti, P. Merelo, M. Cercos, F. R. Tadeo, and M. Talon
Ethylene-induced differential gene expression during abscission of citrus leaves
J. Exp. Bot.,
July 1, 2008;
59(10):
2717 - 2733.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Kielbowicz-Matuk, P. Rey, and T. Rorat
The organ-dependent abundance of a Solanum lipid transfer protein is up-regulated upon osmotic constraints and associated with cold acclimation ability
J. Exp. Bot.,
May 1, 2008;
59(8):
2191 - 2203.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B.-K. Ham, J. M. Park, S.-B. Lee, M. J. Kim, I.-J. Lee, K.-J. Kim, C. S. Kwon, and K.-H. Paek
Tobacco Tsip1, a DnaJ-Type Zn Finger Protein, Is Recruited to and Potentiates Tsi1-Mediated Transcriptional Activation
PLANT CELL,
August 1, 2006;
18(8):
2005 - 2020.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. D. Cameron, M. A. Teece, and L. B. Smart
Increased Accumulation of Cuticular Wax and Expression of Lipid Transfer Protein in Response to Periodic Drying Events in Leaves of Tree Tobacco
Plant Physiology,
January 1, 2006;
140(1):
176 - 183.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Luo, P. Dang, B. Z. Guo, G. He, C. C. Holbrook, M. G. Bausher, and R. D. Lee
Generation of Expressed Sequence Tags (ESTs) for Gene Discovery and Marker Development in Cultivated Peanut
Crop Sci.,
January 1, 2005;
45(1):
346 - 353.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Guo, M. A. Rupe, C. Zinselmeier, J. Habben, B. A. Bowen, and O. S. Smith
Allelic Variation of Gene Expression in Maize Hybrids
PLANT CELL,
July 1, 2004;
16(7):
1707 - 1716.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E.-M. Yubero-Serrano, E. Moyano, N. Medina-Escobar, J. Munoz-Blanco, and J.-L. Caballero
Identification of a strawberry gene encoding a non-specific lipid transfer protein that responds to ABA, wounding and cold stress
J. Exp. Bot.,
August 1, 2003;
54(389):
1865 - 1877.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Wu and J. K. Burns
Isolation and characterization of a cDNA encoding a lipid transfer protein expressed in 'Valencia' orange during abscission
J. Exp. Bot.,
April 1, 2003;
54(385):
1183 - 1191.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Samuel, Y.-J. Liu, C.-S. Cheng, and P.-C. Lyu
Solution Structure of Plant Nonspecific Lipid Transfer Protein-2 from Rice (Oryza sativa)
J. Biol. Chem.,
September 13, 2002;
277(38):
35267 - 35273.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. M. Horvath, C. W.B. Bachem, L. M. Trindade, M. E.P. Oortwijn, and R. G.F. Visser
Expression Analysis of a Family of nsLTP Genes Tissue Specifically Expressed throughout the Plant and during Potato Tuber Life Cycle
Plant Physiology,
August 1, 2002;
129(4):
1494 - 1506.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. K. Hincha, B. Neukamm, H. A.M. Sror, F. Sieg, W. Weckwarth, M. Rückels, V. Lullien-Pellerin, W. Schröder, and J. M. Schmitt
Cabbage Cryoprotectin Is a Member of the Nonspecific Plant Lipid Transfer Protein Gene Family
Plant Physiology,
February 1, 2001;
125(2):
835 - 846.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
K. Lindorff-Larsen, M. H. Lerche, F. M. Poulsen, P. Roepstorff, and J. R. Winther
Barley Lipid Transfer Protein, LTP1, Contains a New Type of Lipid-like Post-translational Modification*
J. Biol. Chem.,
August 31, 2001;
276(36):
33547 - 33553.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction