| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
Plant Physiol. (1998) 116: 1469-1478
Structure and Expression of a Dhurrinase
(
|
 |
ABSTRACT |
|---|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
Sorghum (Sorghum
bicolor L. Moench) has two isozymes of the cyanogenic
-glucosidase dhurrinase: dhurrinase-1 (Dhr1) and
dhurrinase-2 (Dhr2). A nearly full-length cDNA encoding
dhurrinase was isolated from 4-d-old etiolated seedlings and sequenced.
The cDNA has a 1695-nucleotide-long open reading frame, which codes for
a 565-amino acid-long precursor and a 514-amino acid-long mature
protein, respectively. Deduced amino acid sequence of the sorghum
Dhr showed 70% identity with two maize (Zea
mays) -glucosidase isozymes. Southern-blot data
suggested that -glu-cosidase is encoded by a small multigene family
in sorghum. Northern-blot data indicated that the mRNA corresponding to
the cloned Dhr cDNA is present at high levels in the
node and upper half of the mesocotyl in etiolated seedlings but at low
levels in the root
only in the zone of elongation and the tip region.
Light-grown seedling parts had lower levels of Dhr mRNA
than those of etiolated seedlings. Immunoblot analysis performed using
maize-anti--glucosidase sera detected two distinct dhurrinases (57 and 62 kD) in sorghum. The distribution of Dhr activity
in different plant parts supports the mRNA and immunoreactive protein
data, suggesting that the cloned cDNA corresponds to the
Dhr1 (57 kD) isozyme and that the dhr1
gene shows organ-specific expression.
The aglycones, the active group of glucosides, play important roles in
plant defense, development, and growth (Selmar et al., 1987
Sorghum has two cyanogenic The purpose of this study was to isolate and characterize cDNAs
encoding Sorghum (Sorghum bicolor L. Moench) seeds (P-721N) were
obtained from Dr. Richard Axtell (Purdue University, West Lafayette, IN). Seeds were germinated in vermiculite in darkness (3-4 d) and
light (6-7 d) at 25°C. Seedlings were harvested and divided into
different parts to isolate total RNA and protein for use in northern-
and western-blot analyses and enzyme assays. Etiolated seedlings were
divided into the following parts: the coleoptile (which includes the
coleoptile proper and the primordial leaves), the node, mesocotyl-2
(upper half, the part below the node), mesocotyl-1 (lower half, the
part attached to the germ), root-1 (upper half, the part attached to
the germ), and root-2 (lower half, starting with the root tip).
Light-grown seedlings were divided into coleoptile, leaves, node, and
root-2 (light-grown seedlings do not have a distinct mesocotyl). In
addition, whole seedlings were used for genomic DNA isolation.
mRNA Isolation
INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References
-Glucosidases (-d-glucoside glucohydrolase; EC
3.2.1.21) catalyze the hydrolysis of aryl and alkyl -glucosides,
releasing Glc and an aglycone (Reese, 1977
). These enzymes occur
ubiquitously in plants, fungi, bacteria, and animals (Woodward and
Wiseman, 1982). The natural substrates of -glucosidases include the
steroid -glucosides and -glucosyl ceramides of mammals,
cyanogenic and hydroxamic acid -glucosides of plant secondary
metabolism, and -linked oligosaccharides released from the digestion
of plant cell walls during germination (Conn, 1981; Niemeyer, 1988;
Beutler, 1992; Cuevas et al., 1992; Leah et al., 1995). Most
-glucosidases display broad specificity for the aglycone moiety of
their substrates but somewhat narrow specificity for the glycone
moiety. In fact, -glucosidases from every source have similar
specificity for the glycone (Glc) portion of the substrate, but some
enzymes, especially those from plants, differ dramatically in
specificity for the aglycone portion (Hösel and Conn, 1982;
Hughes and Dunn, 1982; Babcock and Esen, 1994). Babcock and Esen (1994)
proposed that a hydrophobic aglycone group is required for cleaving the -glycosidic bond between the glycone and the aglycone in maize (Zea mays) -glucosidase. The cyanogenic diglucoside
(R)-amygdalin (the gentiobioside of [R]-mandelonitrile) of black
cherry and other stone fruits has the disaccharide gentiobiose as its
glycone instead of Glc (Poulton, 1993).
; Poulton,
1990). Cyanogenic -glu-cosides have long been known to be
involved in the defense against some pathogens and herbivores,
releasing the respiratory poison HCN upon hydrolysis by
-glucosidase (Hruska, 1988; Poulton, 1993). In fact, many important
crops, including sorghum (Sorghum bicolor), cassava, lima
beans, flax, white clover, rubber tree, and stone fruits, contain
cyanogenic -glucosides and corresponding -glucosidases (Poulton,
1989). Upon damage to tissues, the enzyme and its substrate, which are
compartmentalized in intact tissues, come into contact and release a
toxic aglycone or a derivative (e.g. HCN) (Kakes, 1985; Hösel et
al., 1987; Selmar, 1993). Under these conditions, dhurrin is hydrolyzed
by an endogenous -glucosidase (dhurrinase) to produce
p-hydroxymandelonitrile, which subsequently disassociates to
free HCN and p-hydroxybenzaldehyde (Fig.
1).
View larger version (10K):
[in a new window]
Figure 1.
Hydrolysis of dhurrin by
-glucosidase (dhurrinase) and the production of HCN.
-glucosidases, Dhr1 and
Dhr2, which were purified by Hösel et al. (1987) and
shown to be made up of 57- and 62-kD monomers, respectively. Both
enzymes exhibit high specificity for the physiological substrate
dhurrin, as well as its structural analog sambunigrin, with
Km values of 0.15 and 0.3 mm,
respectively (Hösel et al., 1987). However, neither enzyme shows
any detectable activity toward any of the other natural or artificial
substrates tested, except that Dhr2 shows substantial reactivity toward the synthetic substrates 4MUG and
pNPG.
-glucosidase from sorghum to study their expression and
compare them with those of maize as part of our research focusing on
-glucosidase structure and function in grasses. To this end, we
cloned and sequenced a -glucosidase (dhurrinase) cDNA (accession no. U33817) and investigated its multiplicity by
Southern-blot analysis and its spatial expression by northern- and
western-blot analyses and dhurrinase-activity assays. In addition, the
Dhr1 and Dhr2 isozymes were isolated and
characterized with respect to substrate specificity and spatial
distribution. Our results suggest that the isolated cDNA corresponds to
dhurrinase-1.
MATERIALS AND METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References
).
Reverse Transcription and cDNA Cloning
Ten microliters of eluted poly(A+) RNA was used as a template for reverse transcription to synthesize cDNA using the components of a first-strand cDNA synthesis kit (GIBCO-BRL). The reaction mixture included 10 µL of mRNA (approximately 2 µg), 1 µL of 20 µm anchor-linked oligo(dT), 4 µL of 5× first-strand buffer, 1 µL of 0.1 m DTT, 2 µL of 10 mm deoxyribonucleotide triphosphate, 1 µL of RNasin, and 1 µL (200 units) of Superscript RT II (GIBCO-BRL). The reaction was at 48°C for 2 h. The resulting cDNA was purified by binding to a silica matrix in the presence of 6 n NaI according to the manufacturer's instructions (Clontech, Palo Alto, CA). Purified cDNA was dissolved in 10 µL of DEPC-treated water and used in the 5
and
3 rapid amplification of cDNA ends experiments.
-glucosidases from
monocot and dicot sources were compared using the Megalign program
(DNASTAR, Genetics Computer Group, Madison, WI) to locate invariant
regions. The oligonucleotide (antisense) primer -glu27 (CCGATTCCGTTCTCGGTGAT) was derived from the peptide sequence V/YITENG, which makes up part of the catalytic domain and is universally conserved in all of the known -glucosidases from monocots and other
sources. The 3 end of the first-strand cDNA was ligated to the
AmpliFINDER anchor (Clontech) by T4 RNA ligase (Boehringer Mannheim)
for the 5 rapid amplification of cDNA ends. The 5 three-fourths of
the -glucosidase cDNA was amplified by PCR using the -glu27
(antisense) and the second-strand AmpliFINDER anchor (sense) primer
pair. An aliquot of the PCR reaction was analyzed on a 1% agarose gel.
). A large-scale plasmid preparation was made from one of the positive clones and used to sequence the insert. Based on the
sequence data from the insert, a gene-specific sense primer (-glu69,
TATGTACCCTAAAGGCCTACAC) was synthesized and used with a second-strand
anchor primer, A76 (GGCCACGCGTCGACTAGTA), to amplify the 3 end of the
-glucosidase cDNA. The resulting 3 end PCR product was sequenced
directly, without cloning, using cycle sequencing (Epicenter
Technologies, Madison, WI).
-glu107, sense, TGAATTCGTGGGCAACTCA and
-glu108, antisense, ATTGCAAATCGATCACTTCGT) derived from the extreme
5 and 3 ends of the cDNA was used to amplify the full-length cDNA
(1983 bp) and cloned into pCR-Script SK(+). The sequences of the cDNA
and its putative protein product were compared with sequences in the
GenBank database to confirm their identity and evaluate their
similarity to other -glucosidases.
Probe Synthesis
The second-strand AmpliFINDER anchor primer and-glu27 were
used to amplify the 5 three-fourths (1446 bp) of the cDNA by PCR to
serve as a 5 probe. This probe spans the first 10 of the 12 exons that
are expected to occur in dhurrinase genes based on the structure and
organization of the maize (Zea mays) glu1 gene
(Bandaranayake and Esen, 1996, direct submission, GenBank accession no.
U44773) and other plant -glucosidase genes (Xue et al., 1995; Liddle
et al., 1996, direct submission, GenBank accession no. X94986).
Similarly, primers -glu69 and A76 were used to amplify the 3
one-third (627 bp) of the cDNA to serve as the 3 probe. The 3 end of
the 5 probe and the 5 end of the 3 probe had an overlap of 90 nucleotides. In addition, the 627-bp 3 probe spans the last three
exonic regions interrupted by two introns and the 215-bp-long
untranslated region beyond the stop codon.
-32P]ATP using random hexamers and the
Klenow fragment of DNA polymerase (Ambion, Austin, TX) at 37°C for
1 h. The labeled fragments were used as a probe in northern- and
Southern-blot analyses.
Southern-Blot Analysis
Genomic DNA was isolated from 3- to 4-d-old seedlings as described by Dellaporta (1994). Approximately 10 µg of DNA was digested with
SalI, PvuII, ApaI, XhoI,
BamHI, and XbaI for 24 h, loaded onto a
0.8% agarose gel, and fractionated using the Tris-acetate-EDTA buffer
system at 1.5 V/cm for 18 h. After electrophoresis, the DNA was
transferred overnight to a Nytran membrane (Schleicher & Schuell;
Sambrook et al., 1989). DNA was attached to the membrane by
UV-cross-linking, and the blots were probed separately with 32P-labeled 5 (1446 bp)- and 3 (627 bp)-specific PCR products. The G-C content of both probes was about
49%. The blots were prehybridized in Church buffer (1 mm
EDTA, 0.5 m
Na2HPO4, pH 7.2, and 7%
SDS) at 65°C for 2 h (Church and Gilbert, 1984) and then
hybridized with 32P-labeled 5 probe in 10 mL of
Church buffer at 65°C overnight. The blots were washed once in
1× SSC/0.1% SDS at room temperature for 5 min, twice in 1× SSC/0.1%
SDS at 65°C for 20 min, and then once in 0.1× SSC/0.1% SDS at
65°C. The washed blots were dried and exposed to radiographic film
(X-Omat, Kodak) with intensifying screens at 
80°C for 24 h.
After autoradiography, the 5 probe was removed from the blot, and the
same blot was hybridized with the 3 probe according to the procedure
used for the 5 probe.
Northern-Blot Analysis
One-half gram of each frozen light- and dark-grown sorghum seedling part was ground in a chilled mortar, and total RNA was extracted as described previously (Chomczynski, 1993). Five
micrograms of total RNA from each plant part was heated at 65°C for
15 min, loaded onto a 1% formaldehyde agarose gel, and subjected to
electrophoresis at 8 V/cm for 3 h. A Nytran membrane and the gel
were soaked in 10× SSC for 10 min. RNA was transferred to the membrane
in 10× SSC overnight (Sambrook et al., 1989) and UV-cross-linked to
the membrane. RNA was then prehybridized in Church buffer at 65°C for
2 h (Church and Gilbert, 1984) and hybridized with a
32P-labeled, 627-bp 3 probe according to the
procedure described above for Southern blots, except that Church buffer
used for hybridizations and washes contained 1% BSA. In addition, a
separate northern blot of light-grown seedling parts was hybridized
with the 5 probe and washed at low (1× SSC) and high (0.1× SSC)
stringency before autoradiography. This was to investigate whether the
dhr2 mRNA could be detected in the leaf and coleoptile in
which the 62-kD Dhr2 monomer was detected exclusively on
immunoblots.
Extraction of Proteins and Assay of Enzyme Activity
Protein extracts were prepared by grinding the isolated plant parts (coleoptile, node, mesocotyl-2, mesocotyl-1, root-1, and root-2 of dark-grown seedlings and node, coleoptile, leaf, and root of light-grown seedlings) in the extraction buffer as described by Hösel et al. (1987). The homogenate was centrifuged at
18,000g for 20 min, and ice-cold acetone was added to the
supernatant to obtain a 35% final concentration. The precipitated
material was separated by centrifugation at 18,000g and more
ice-cold acetone was added to the resulting supernatants to obtain a
55% final concentration. Following centrifugation at
18,000g for 20 min, the pellet was drained and dissolved in
0.1 volume of water. The purpose of the acetone precipitation was to
remove Glc, dhurrin, and its aglycone from protein preparations because
they interfered with the PGO assay (see below). The protein content of
each extract was determined using a protein assay kit (Bio-Rad).
).
Twenty-five-microliter aliquots containing 125 nmol dhurrin in 70%
methanol were placed in quadruplicate in the wells of a microtiter
plate, evaporated, and tested for hydrolysis by adding 50 µL of an
enzyme solution containing 1 µg of protein (35-55% acetone cut)
from seedling parts, 50 µL of PGO, and 50 µL of
2,2-azinobis-3-ethylbenzthiazolinesulfonic acid. The reaction mixture
was incubated at 37°C for 30 min, and the
A410 was read in a microplate reader. Under
these conditions, the final concentration of dhurrin in the reaction
mixture was 0.83 mm, and the rate was linear throughout the
30-min reaction period.
Dhurrin Isolation and Purification
Thirty grams of frozen seedlings was ground in liquid N2, extracted in 70 mL of 100% methanol, and centrifuged at 16,000g for 20 min at 4°C. The resulting supernatant was freeze-dried and the powder was dissolved in 70% methanol and fractionated on a Sephadex LH-20 gel-filtration column (2.6 × 56 cm) at room temperature (approximately 23-25°C). The fractions were tested for Glc by PGO assay and for dhurrin by the maize-glucosidase inhibition assay (dhurrin is a potent inhibitor of
maize -glucosidase). The fractions inhibiting maize -glucosidase
were combined, freeze-dried, and rechromatographed on a Sephadex LH-20
column. Each fraction was tested again by PGO and maize
-glucosidase-inhibition assays. The fractions containing dhurrin
were combined and used as a substrate in dhurrinase assays as described
above.
PAGE and Western-Blot Analysis
The protein extracts of each of the different plant parts were mixed with one-fourth volume of the 4× SDS-gel sample buffer (Laemmli, 1970) and heated at 100°C for 5 min. Volumes containing 10 µg of
protein from each plant part were loaded onto 12% SDS gels and
electrophoresed. After electrophoresis, the gels were soaked in 1×
blotting buffer (25 mm Tris/125 mm Gly/0.25%
SDS/20% methanol) and the proteins were transferred onto a PVDF
membrane (Millipore; Pluskal et al., 1986). Immunodetection was carried out using an anti-maize -glucosidase serum (R681) as described by
Mohammed and Esen (1989).
-glucosidase antisera.
TLC
TLC was performed using 0.25-mm silica-coated plates (PE SIL G/UV, Whatman). Dhr1 and Dhr2 eluates (0.1 unit) from preparative PAGE sections were incubated with a 5 mm final concentration of dhurrin, 4MUG, and pNPG in 20 mm phosphate-10 mm citrate buffer, pH 5.8, for 1 h. Ten microliters of the reaction mixture was spotted on a TLC plate and chromatographed vertically at room temperature for 45 min using an acetonitrile:distilled water (85:15, v/v) mixture as the mobile phase (Robyt and White, 1990). The plate was sprayed with
methanol:H2SO4 (4:1, v/v),
and then baked at 110°C for 10 min to visualize the hydrolysis
products. For each substrate, a no-enzyme control was included in the
assay.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
Primary Structure of Sorghum -Glucosidase
-glu27 (antisense) and the AmpliFINDER anchor
(sense) amplified a fragment of 1446 bp corresponding to the 5
three-fourths of the dhurrinase cDNA. A fragment of this size was
expected based on sequences of -glucosidase cDNAs from maize and
other plants. Based on the 5 end sequence, a 627-bp PCR product
corresponding to the 3 end of the dhurrinase cDNA was amplified as
described in ``Materials and Methods''. The sequences of the two PCR
products (1446 and 627 bp) contained a 90-bp overlap that showed
perfect sequence identity. The dhurrinase cDNA was reconstructed by PCR
amplification using the extreme 5 and 3 end primers (-glu107 and
-glu108, respectively), and cloning the resulting product into
pCR-Script SK(+).
Southern-Blot Analysis
-glucosidase precursor
and mature proteins (Fig. 2). The
51-amino acid-long dhurrinase transit peptide shared 78% identity with
the 51- and 54-amino acid-long transit peptides of the maize
-glucosidase precursors Glu1 and Glu2.
View larger version (143K):
[in a new window]
Figure 2.
Deduced amino acid sequence identity between
sorghum (SorGlu) and maize (MzGlu1 and MzGlu2) -glucosidases. The
deduced amino acid sequence of sorghum -glucosidase was aligned with
those of maize -glucosidases using the Clustal multiple-alignment
program (Higgins and Sharp, 1989). Sequences boxed in gray indicate
regions of amino acid identity between sorghum and maize
-glucosidases. The arrow indicates the known transit peptide
cleavage site in maize -glucosidase precursor proteins and the
predicted cleavage site in the sorghum -glucosidase precursor.
The underlined sequences form part of the catalytic site in BGA
-glucosidases.
-glucosidases were deletion of three contiguous
amino acids (KSI in MzGlu1 and KRI in MzGlu2) in the N-terminal half
and two contiguous amino acids (TP in MzGlu1 and KP in MzGlu2) in the
C-terminal half. In the C-terminal half, the sorghum protein also had
additions of two and four adjacent amino acids (VE and GQLN,
respectively; Fig. 2). The two peptide motifs (Fig. 2, underlined
sequences) that are known to form part of the catalytic center in BGA
-glucosidases were perfectly conserved in dhurrinase and the two
maize -glucosidases.
-glucosidase genes, Southern-blot
analysis of genomic DNA, digested with six different restriction enzymes that do not cut within exons (cDNA), was performed using 32P-labeled 5 and 3 probes (1446- and 627-bp
fragments, respectively). Our hypothesis is that (a) the sorghum genome
has at least two -glucosidase genes, dhr1 and
dhr2, which are homologs of the maize glu1 and
glu2, (b) both probes hybridize with all
-glucosidase-related sequences, and (c) strongly hybridizing
fragments are derived from the gene that corresponds to the cloned
cDNA. This hypothesis is based on the fact that two distinct dhurrinase
isozymes from sorghum have been isolated and characterized at the
biochemical level and that two isozymes and their corresponding cDNAs
and genes have been found in a homologous system (i.e. maize).
Distribution of
Dhurrinase Activity in Different Plant Parts
Immunoblotting Analysis
Hösel et al. (1987) Received August 7, 1997;
accepted January 13, 1998.
Abbreviations:
BGA,
Babcock GW,
Esen A
(1994)
Substrate specificity of maize
Bandaranayake H,
Esen A
(1996)
Nucleotide sequence of a
Beguin P
(1990)
Molecular biology of cellulose degradation.
Annu Rev Microbiol
44:
219-248
[CrossRef][ISI][Medline]
Beutler E
(1992)
Gaucher disease: new molecular approaches to diagnosis and treatment.
Science
256:
794-798
Brzobohaty B,
Moore I,
Kristoffersen P,
Bako L,
Campos N,
Schell J,
Palme K
(1993)
Release of active cytokinin by a
Chomczynski P
(1993)
A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples.
Biotechniques
15:
532-537
[ISI][Medline]
Church GM,
Gilbert W
(1984)
Genomic sequencing.
Proc Natl Acad Sci USA
81:
1991-1995
Conn EE (1981) Cyanogenic glycosides. In PK Stumpf, E
Conn, eds, The Biochemistry of Plants: A Comprehensive Treatise, Vol 7: Secondary Plant Products. Academic Press, New York, pp 479-500
Cuevas L,
Niemeyer HM,
Jonsson LMV
(1992)
Partial purification and characterization of a hydroxamic acid glucoside
Dellaporta S
(1994)
Plant DNA miniprep and microprep.
In
F Freeling,
V Walbot,
eds, The Maize Hand Book.
Springer-Verlag, Inc., New York, pp 522-525
Esen A,
Stetler DA
(1993)
Subcellular localization of maize
Gussow D,
Clackson T
(1989)
Direct clone characterization from plaques and colonies by the polymerase chain reaction.
Nucleic Acids Res
17:
4000
Higgins DG,
Sharp PM
(1989)
Fast and sensitive multiple sequence alignments on a microcomputer.
Comput Appl Biosci Commun
5:
151-153
Hösel W,
Conn EE
(1982)
The aglycone specificity of plant
Hösel W,
Tober I,
Eklund SH,
Conn EE
(1987)
Characterization of
Hruska AJ
(1988)
Cyanogenic glucosides as defense compounds. A review of the evidence.
J Chem Ecol
14:
2213-2217
[CrossRef]
Hughes MA,
Dunn MA
(1982)
Biochemical characterization of the Li locus, which controls the activity of the cyanogenic
Inoue K,
Shibuya M,
Yamamoto K,
Ebizuka Y
(1996)
Molecular cloning and bacterial expression of a cDNA encoding furostanol glycoside 26-O-beta-glucosidase of Costus speciosus.
FEBS Lett
389:
273-277
[CrossRef][ISI][Medline]
Jacobsen KS,
Breivold E,
Hornes E
(1990)
Purification of mRNA directly from crude plant tissues in 15 minutes using magnetic oligo dT microspheres.
Nucleic Acids Res
18:
3669
Kakes P
(1985)
Linamarase and other
Kojima M,
Poulton JE,
Thayer SS,
Conn EE
(1979)
Tissue distributions of dhurrin and of enzymes involved in its metabolism in leaves of Sorghum bicolor.
Plant Physiol
63:
1022-1028
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
277:
680-685
Leah R,
Kigel J,
Svendsen I,
Mundy J
(1995)
Biochemical and molecular characterization of a barley seed
Mohammed K,
Esen A
(1989)
A blocking agent and a blocking step are not needed in ELISA, immunostaining dot-blots and western blots.
J Immunol Method
117:
141-145
[Medline]
Niemeyer HM
(1988)
Hydroxamic acid (4-hydroxy-1,4-benzoxazin-3-ones) defense chemicals in the Gramineae.
Phytochemistry
27:
3349-3358
[CrossRef]
Nisius A
(1988)
The stromacentre in Avena plastids: an aggregation of
Pluskal MG,
Przekop MB,
Kavonian MR,
Vecoli C,
Hicks DA
(1986)
ImmobilonTM PVDF transfer membrane: a new membrane substrate for western blotting of proteins.
Biotechniques
4:
272-282
Poulton JE (1989) Toxic compounds in plant foodstuffs:
cyanogens. In JE Kinsella, WG Soucie, eds, Food Proteins.
The American Oil Chemists' Society, Champaign, IL, pp 381-401
Poulton JE
(1990)
Cyanogenesis in plants.
Plant Physiol
94:
401-405
Poulton JE
(1993)
Enzymology of cyanogenesis in rosaceous stone fruits.
In
A Esen,
eds,
Raabo E,
Terkildsen TC
(1960)
On the enzymatic determination of blood glucose.
Scand J Clin Lab Invest
12:
402
[ISI][Medline]
Reese ET
(1977)
Degradation of polymeric carbohydrates by microbial enzymes.
Rec Adv Phytochem
11:
311-364
Robyt FJ, White BJ (1990) Biochemical Techniques, Theory and
Practice, Chapter 4. Waveland Press, Inc., Lake Zurich, IL, pp 107-108
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Selmar D
(1993)
Apoplastic occurrence of cyanogenic
Selmar D
(1996)
Dhurrin-6
Selmar D,
Lieberei R,
Biehl B,
Voigh J
(1987)
Hevea linamarase, a nonspecific
Swain E,
Poulton JE
(1994)
Plant Physiol
106:
1285-1291
[Abstract]
Thayer SS,
Conn EE
(1981)
Subcellular localization of dhurrin
Woodward J,
Wiseman A
(1982)
Fungal and other
Xue J,
Jorgensen M,
Pihlgren U,
Rask L
(1995)
The myrosinase gene family in Arabidopsis thaliana: gene organization, expression and evolution.
Plant Mol Biol
27:
911-922
[CrossRef] probe. In contrast, the
BamHI and XbaI digests yielded a more complex banding pattern (six to nine bands), each with two to three strongly hybridizing bands (Fig. 3A). In addition, all digests had two to five
weak to moderately hybridizing bands the numbers of which varied with
the digest (Fig. 3A). The banding profiles produced by the 627-bp 3
probe indicated that this probe hybridized with some of the same bands
as the 1446-bp 5 probe (Fig. 3), but it also hybridized with novel
bands in ApaI and XbaI digests (Fig. 3B). The
same novel bands, but with lower signal intensity, were also evident in
the XhoI digest (Fig. 3B). As for the PvuII
digest, both probes detected two to three moderately hybridizing bands in the 9- to 12-kb region (Fig. 3). In addition, the 5 probe detected
two weakly hybridizing bands in the 2- to 3.6-kb region (Fig. 3A).
View larger version (89K):
[in a new window]
Figure 3.
Southern-blot analysis of sorghum genomic DNA
after digestion with SalI (1), PvuII (2),
ApaI (3), XhoI (4), BamHI
(5), and XbaI (6). A, Blot probed with a radiolabeled
1446-bp fragment (corresponding to the 5 three-fourths of the cDNA).
B, Blot in A stripped and then probed with a radiolabeled 627-bp
fragment (corresponding to the 3 one-third of cDNA including the 3
nontranslated region). Black asterisks indicate the bands that are
detected by both probes; white asterisks indicate the novel bands
detected by the 3 region-specific probe only.
-Glucosidase mRNAs in Different Plant Parts
probe (Fig.
4, A and B) showed that the size of the
sorghum -glucosidase mRNA is about 2 kb, similar in electrophoretic
mobility to 18S RNA. This is consistent with the size of the isolated
-glucosidase cDNA (1.983 kb) and suggests that the cDNA is nearly
full length. The highest steady-state level of mRNA was detected in the
node region (which includes the shoot apex and primordial leaves) of
the etiolated seedling, followed by the mesocotyl-2 region (Fig. 4A).
The mesocotyl-1 region had the lowest detectable -glucosidase mRNA
in the 2-kb region of the blot (Fig. 4A). Similarly, the coleoptile and
the upper half of the primary root (root-1) had little or no detectable mRNA, whereas the lower half of the root (root-2, which includes the
root tip) had low levels of mRNA (Fig. 4A). Northern analysis was also
performed in light-grown seedling parts (the node, coleoptile, leaves,
and root-2; Fig. 4B). Both the node and root-2 regions showed reduced
expression compared with that from etiolated seedlings (Fig. 4, compare
A and B).
View larger version (35K):
[in a new window]
Figure 4.
RNA-blot analysis of dhurrinase expression in
various sorghum seedling parts. Ethidium bromide-stained gel below
blots shows equal RNA loading before blotting. A, Etiolated seedling
parts: coleoptile (including the coleoptile proper and primordial
leaves); the node; mesocotyl-2 (adjacent to the node); mesocotyl-1
(adjacent to germ); root-1 (adjacent to germ); and root-2 (root tip).
B, Light-grown seedling parts: control, node from dark-grown seedlings; node; coleoptile; leaf; and root-2 (root tip). RNA blots in A and B
were hybridized with a 32P-labeled 3 end (627 bp) cDNA
probe. C, Light-grown seedling parts as in B but hybridized with a
32P-labeled 5 probe (1446 bp) at low (top; 1× SSC) and
high (bottom; 0.1× SSC) stringency.
probe and washed at low stringency (Fig. 4C), it was possible to
detect -glucosidase transcripts in all seedling parts, including the
coleoptile and leaf. In addition, weakly hybridizing RNA bands of >2
kb were detected in etiolated nodes, light-grown nodes, and coleoptiles
(Fig. 4C). As expected, substantial signal loss occurred after the
high-stringency wash, with loss being essentially complete in
coleoptiles and complete in leaves (Fig. 4C).
View larger version (19K):
[in a new window]
Figure 5.
Specific activity of dhurrinase (expressed as the
amount of dhurrin [dhr] hydrolyzed per milligram of protein [prot]
per hour) in dark-grown (A) and light-grown (B) sorghum
seedling parts.
-glucosidase isozymes Dhr1 and Dhr2,
isolated by preparative electrophoresis, hydrolyzed the natural
substrate dhurrin with similar catalytic efficiencies but showed subtle
differences with respect to their ability to hydrolyze the artificial
-glucosides such as pNPG and 4MUG. When the gel eluates
were analyzed for dhurrinase activity (Fig.
6A), it was found that the activity was
in two distinct zones (4-5 and 5.5-6.5 cm, respectively) in node
extracts. Of these, the slower one (Dhr2, 5.5-6.5 cm from the anode) had not only dhurrinase activity but also yielded an activity zone (Fig. 6B) in the gel upon incubation with 4MUG. Hydrolysis of dhurrin and 4MUG by Dhr2 was also confirmed by
TLC results (Fig. 7). On the other hand,
the zone with faster electrophoretic mobility (Dhr1, 4-4.5
cm from the anode) showed only dhurrinase activity (Fig. 7, lane 3); it
had no measurable activity toward 4MUG and pNPG in PGO, gel,
and TLC assays (Fig. 7), confirming the results of Hösel et al.
(1987). In addition, Dhr1 was the only dhurrinase isoform
detected in the mesocotyl portion of the seedling (Fig. 6, A and C).
View larger version (35K):
[in a new window]
Figure 6.
Purification of Dhr1 and
Dhr2 by native alkaline PAGE and their characterization.
A, Hydrolysis of dhurrin by dhurrinase activity present in 5-mm gel
slices (numbered 0.5 through 10) cut from a preparative gel starting at
the anodic end ( 
, node; 
, mesocotyl-2). Note that
Dhr1 has a faster mobility than Dhr2 in
alkaline gels, is the only dhurrinase isozyme present in the mesocotyl,
and is not detected in gels by activity staining with 4MUG, whereas
Dhr2 co-occurs with Dhr1 in the node and
is detected in gels as a fluorescent zone by staining with 4MUG as
evident in B. C, Western analysis of the gel eluates showing dhurrinase
activity after electrophoresis through 12% SDS-PAGE, blotting onto
PVDF membrane, and immunostaining with maize -glucosidase antiserum.
Lanes 1 to 4, Gel slices from a partially purified node extract; and
lanes 5 and 6, slices from a mesocotyl-2 extract.
View larger version (54K):
[in a new window]
Figure 7.
Substrate specificity of dhurrinases as assayed by
TLC. The physiological substrate dhurrin (lanes 2-4) and artificial
substrates 4MUG (lanes 5-7) and pNPG (lanes 8-10) were
incubated at a 5 mm final concentration with 0.1 unit of
Dhr1 (lanes 3, 6, and 9) and Dhr2 (lanes
4, 7, and 10) purified by preparative gel electrophoresis. Lane 1, Glc
(arrow on left); and lanes 2, 5, and 8, no-enzyme controls. Note that
both dhurrinase isozymes hydrolyze dhurrin (lanes 3 and 4), whereas
only Dhr2 hydrolyzes 4MUG (lane 7). Hydrolysis of
pNPG could not be detected after incubation with either
enzyme (lanes 9 and 10). +, Incubated with enzyme; , incubated
without enzyme.
View larger version (37K):
[in a new window]
Figure 8.
Detection of sorghum -glucosidase (dhurrinase)
isoforms by immunoblotting. Protein extracts from different parts of
dark- and light-grown seedlings were prepared and subjected to
SDS-PAGE, blotted onto a PVDF membrane, and immunostained with maize
-glucosidase antiserum. Arrows indicate the relative molecular
masses of immunoreactive bands. Note that both dhurrinase isozymes
occur in the node and coleoptile regions, whereas Dhr1
is the only isozyme detected in the mesocotyl and the root, and
Dhr2 is the only isozyme detected in the leaf. Although
the immunoreactive band corresponding to the Dhr2
isozyme was not visible in the node lane, it was present in the
original blot, albeit weakly. The presence of Dhr2 in
the node is clearly evident in Figure 6C, lanes 3 and 4.
DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References
isolated and characterized two isoforms
of the cyanogenic -glucosidase (i.e. dhurrinase) from sorghum seedlings. Of the two isozymes, dhurrinase-1 was isolated from shoots
of the etiolated seedlings and had a monomeric molecular size of 57 kD.
The other isozyme, dhurrinase-2, was isolated from the leaves of
seedlings grown in the light and had a monomeric molecular size of 62 kD. To our knowledge, no molecular data have been available about the
genes encoding either of these two dhurrinase isozymes until the
present study. We conclude that the cDNA we cloned and sequenced
corresponds to a -glucosidase and, most likely, to dhurrinase-1
(Dhr1) in sorghum. The cDNA is clearly a -glucosidase
cDNA because its size and that of the mRNA used for reverse
transcription-PCR are about 2 kb (Fig. 4), which is similar to those of
maize and other plant -glucosidases that belong to the BGA family
(Beguin, 1990).
-glucosidases
Glu1 and Glu2. We think that the cloned cDNA is
most likely a dhr1 because the level of mRNA detected with
the 3 probe (a 627-bp fragment derived from the 3 one-third of the
cDNA) in total RNA blots of various seedling parts correlates with the
level of dhurrinase activity and the presence of a 57-kD immunoreactive
protein in the same seedling parts. Moreover, mRNA was isolated from
etiolated seedlings of comparable age to those used for Dhr1
isolation by Hösel et al. (1987). The putative dhr1
cDNA codes for a precursor protein with a 51-amino acid-long N-terminal
extension for plastid targeting, again similar in length to those of
maize -glucosidase precursors.
; Thayer and Conn,
1981). Kojima et al. (1979) showed that dhurrinase activity was
localized in mesophyll (parenchyma) cells of sorghum leaves, whereas
dhurrin was localized in the vacuoles of epidermal cells in the leaf.
However, Selmar (1996) showed that dhurrin-6-glucoside (disaccharide-dhurrin) was present in the guttation fluid of sorghum seedlings and was not hydrolyzed by -glucosidase. Selmar (1996) concluded that dhurrin-6-glucoside had an apoplastic occurrence as a
transport metabolite. Subcellular location of dhurrinase was shown to
be in the plastid by Thayer and Conn (1981). The plastid localization
of -glucosidase appears to be common in grasses, because this has
been demonstrated in oats (Nisius, 1988), maize (Esen and Stetler,
1993), and rice (C. Muslim and A. Esen, unpublished data).
-glucosidase precursor from the ginger plant (Costaceae)
contains a typical transit peptide for plastid targeting (Inoue et al.,
1996), suggesting that plastid localization occurs in other monocot
orders. An endosperm-specific -glucosidase precursor from barley
seems to be an exception in that it has a 24-amino acid-long signal
peptide for ER targeting (Leah et al., 1995), representing a
different -glucosidase gene lineage. In contrast, there is no report
of plastid localization of a -glucosidase or -thioglucosidase
(i.e. myrosinase) in dicots, nor do their precursors have
plastid-targeting transit peptides. The cyanogenic -glucosidase
linamarase was localized to the cell wall in Trifolium repens (Kakes, 1985). Swain and Poulton (1994) also reported that both prunasin hydrolase and mandelonitrile lyase were localized in the
vacuoles of phloem parenchyma cells. They also have immunolocalized amygdalin-hydrolase in procambium cells.
-glucosidase is encoded by a
small multigene family in sorghum (Fig. 3); this is in agreement with
data showing the presence of two immunoreactive polypeptides (57 and 62 kD) on western blots probed with maize -glucosidase (Glu1) antisera (Figs. 6C and 8). Furthermore, enzymatically
active native proteins, one yielding the 57-kD monomer
(Dhr1) and the other yielding the 62-kD monomer
(Dhr2), were purified by preparative electrophoresis and
shown to exhibit the distinct substrate specificities (Fig. 7) reported
by Hösel et al. (1987). Thus, the presence of at least two
different loci encoding -glucosidase in the sorghum genome is
expected. It is likely that the strongly hybridizing bands detected by
the 5 and 3 probes indicate perfect complementarity between target
and probe sequences and thus correspond to the cloned cDNA (most
probably dhr1), whereas the weakly hybridizing bands
corresponded to dhr2 or other -glucosidase-related
sequences.
region specific) suggests that one of the last two introns of the
dhr1 gene has an ApaI and an XbaI site
or that one has an ApaI site and the other has an
XbaI site (or vice versa). In this case, the 3 probe, having been derived from exons flanking these introns, would detect both fragments from a cleavage within one of the two introns, whereas
the 5 probe detected only the fragment upstream of the cleavage site.
As for the multiple bands varying in size from 4 to 10 kb, which
hybridized with both 5 (1446 bp) and 3 (627 bp) region-specific
probes in blots of XbaI and BamHI digests, the
most plausible explanation is incomplete digestion of genomic DNA by
XbaI and BamHI due to cytosine methylation. Both
enzymes are inhibited when the residues in their cleavage site (marked with an asterisk) are methylated (e.g. T/C*TAGA* for XbaI
and G/GATC*C for BamHI). Likewise, the absence of any
strongly hybridizing bands in PvuII digests (Fig. 3) can be
explained by poor digestion, since this enzyme is also methylation
sensitive.
-glucosidase genes
in sorghum. In view of stringent conditions and the 3 region probe
used for hybridization, it is very likely that our northern analysis
detected the cDNA-related transcripts, which we hypothesize are from
dhr1. It was apparent that the highest level of
-glucosidase mRNA was in the node region of the etiolated seedlings,
followed by the mesocotyl-2 and the zone of elongation in the root
(Fig. 4A). The detection of -glucosidase mRNA in leaf and coleoptile blots after hybridization with the 5 probe and a low-stringency wash
(Fig. 4C) but not after a high-stringency wash, especially in the leaf
lane (Fig. 4C) could be due to the fact that the transcript corresponds
to the dhr2 gene, and thus the dhr1 and
dhr2 genes show spatial expression differences. Although
this hypothesis is supported by detection of the 62-kD Dhr2
monomer only in immunoblots of the leaf and coleoptile extracts (Fig.
8), it is also possible that at low stringency the increased signal
enables the detection of low amounts of dhr1 in these
tissues and that this probe cannot recognize dhr2.
probe after low-stringency
washes is not known. It is conceivable that they are partially spliced
-glucosidase precursor mRNAs or transcripts of other genes that
share partial similarity with -glucosidase genes.
-glucosidase gene
glu1 was shown to exhibit organ-specific expression by
northern analysis (Brzobohaty et al., 1993) in that the largest amount
of the transcript was in the root and mesocotyl sections. However,
these results could not be confirmed by recent studies in our
laboratory (H. Bandaranayake and A. Esen, unpublished data), showing
that the glu1 message was most abundant in the node and
mesocotyl-2.
-glucosidase in various organs of maize
seedlings does not seem to coincide well with that of sorghum in the
node, mesocotyl, and root, the discrepancy may be due to the
differences in the physiological and chronological age of the materials
and the way seedlings were divided into different parts. Since maize
and sorghum -glucosidase amino acid sequences show 70% sequence
identity, and both taxa are members of the same tribe (Andropogonea) in
the subfamily Panicoideae, one would not expect substantial temporal
and spatial expression differences between their homologous genes.
-Glucosidase expression in dark- and light-grown sorghum seedling
parts was also studied by western analysis using anti-maize -glucosidase sera. This was made possible because sorghum and maize
-glucosidases showed immunological cross-reactivity, which is not
surprising in view of their high sequence similarity. The antibodies
reacted specifically with two polypeptides of 57 and 62 kD (Figs. 6C
and 8), which show organ-specific expression. Particularly, the node
section of the etiolated seedling, which contains mitotically active
tissues (shoot apex and primordial leaves), also has the highest level
of dhurrinase mRNA and protein (Figs. 4 and 6). These results were
confirmed by northern analysis using RNA isolated from light-grown
seedling parts.
) and node but also in etiolated seedlings. Since the node includes the shoot apex and primordial leaves, it is likely that Dhr2 found in the node comes from primordial leaves.
However, precise localization of the two isozymes and their transcripts with respect to specific tissues and organs needs to be performed by
immunocytochemistry and in situ hybridization, which will be the
subject of future studies.
codes for a -glucosidase. Its putative protein product has both high
sequence identity and immunological cross-reactivity with maize
-glucosidases. Its abundant expression in the node and root portions
of the 3- to 4-d-old etiolated seedlings and its size (57 kD) indicate
that what we refer to here as dhurrinase-1 (Dhr1) is
identical to what was isolated and named dhurrinase-1 by Hösel et
al. (1987). Western analysis data indicate the existence of at least
one other -glucosidase enzyme in sorghum, which may be encoded by a
different gene, very likely dhr2. The expression of the two
dhurrinase proteins differs spatially and temporally (results not
shown), making them an interesting model for the study of gene
regulation.
1
This research was supported in part by grant no.
IBN-9318134 from the National Science Foundation.
FOOTNOTES
*
Corresponding author; e-mail aevatan{at}vt.edu; fax
1-540-231-9307.
ABBREVIATIONS
-glucosidase family A.
DEPC, diethylpyrocarbonate.
4MUG, 4-methylumbelliferyl--d-Glc.
PGO, peroxidase-Glc-oxidase.
pNPG, p-nitrophenyl--d-Glc.
LITERATURE CITED
Top
Abstract
Introduction
Methods
Results
Discussion
References
-glucosidase.
Plant Sci
101:
31-39
[CrossRef] -glucosidase (glu2) cDNA from maize (Zea mays L.) (accession no. U44087) (PGR 96-009).
Plant Physiol
110:
1048
-glucosidase localized to the maize root meristem.
Science
262:
1051-1054
-glucosidase from maize.
Phytochemistry
31:
2609-2619
[CrossRef] -glucosidase.
Maize Genet Coop News Lett
67:
19-20
-glycosidases.
Trends Biochem Sci
7:
219-221
[CrossRef] -glucosidase with high specificity for the cyanogenic glucoside dhurrin in Sorghum bicolor (L.) Moench seedlings.
Arch Biochem Biophys
252:
152-162
[CrossRef][Medline] -glucosidase in Trifolium repens L.
Plant Mol Biol
1:
169-181
-glucosidases are present in the cell walls of Trifolium repens L. leaves.
Planta
166:
156-160
-glucosidase.
J Biol Chem
270:
15789-15797
-glucosidase responsible for the activation of oat-leaf saponins.
Planta
173:
474-481
[CrossRef] -Glucosidases: Biochemistry and Molecular Biology, ACS symposium series 533.
American Chemical Society, Washington, DC, pp 170-190 -glucosidases and consequences for the metabolism of cyanogenic glucosides.
In
A Esen,
eds, -Glucosidases: Biochemistry and Molecular Biology, ACS symposium series 533.
American Chemical Society, Washington, DC, pp 191-204 -glucoside, a cyanogenic diglucoside from Sorghum bicolor.
Phytochemistry
43:
569-572
[Medline] -glycosidase.
Plant Physiol
83:
557-562
-glucosidases and hydroxynitrile lyase in the mesophyll cells of sorghum leaf blades.
Plant Physiol
67:
617-622
-d-glucosidases. Their properties and applications.
Enzyme Microbiol Technol
4:
73-74
-Glucosidase)
from Sorghum