| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
Plant Physiol. (1998) 117: 417-423
A Gene Coding for Tomato Fruit
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
ABSTRACT |
|---|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
-Galactosidases (EC 3.2.1.23)
constitute a widespread family of enzymes characterized by their
ability to hydrolyze terminal, nonreducing -D-galactosyl
residues from -D-galactosides. Several -galactosidases, sometimes referred to as
exo-galactanases, have been purified from plants and
shown to possess in vitro activity against extracted cell wall material
via the release of galactose from wall polymers containing
(1
4)-D-galactan. Although -galactosidase II, a
protein present in tomato (Lycopersicon esculentum
Mill.) fruit during ripening and capable of degrading tomato fruit
galactan, has been purified, cloning of the corresponding gene has been elusive. We report here the cloning of a cDNA, pTomgal 4 (accession no. AF020390), corresponding to -galactosidase II, and show that its
corresponding gene is expressed during fruit ripening. Northern-blot
analysis revealed that the -galactosidase II gene transcript was
detectable at the breaker stage of ripeness, maximum at the turning
stage, and present at decreasing levels during the later stages of
normal tomato fruit ripening. At the turning stage of ripeness, the
transcript was present in all fruit tissues and was highest in the
outermost tissues (including the peel). Confirmation that pTomgal 4 codes for -galactosidase II was derived from matching protein and
deduced amino acid sequences. Furthermore, analysis of the deduced
amino acid sequence of pTomgal 4 suggested a high probability for
secretion based on the presence of a hydrophobic leader sequence, a
leader-sequence cleavage site, and three possible
N-glycosylation sites. The predicted molecular mass and
isoelectric point of the pTomgal 4-encoded mature protein were
similar to those reported for the purified -galactosidase II protein
from tomato fruit.
The most conspicuous and important processes related to
postharvest quality of climacteric fruit are the changes in texture, color, taste, and aroma that occur during ripening. Because of the
critical relationship that deleterious changes in texture have to
quality and postharvest shelf life, emphasis has been placed on
studying the mechanisms involved in the loss of firmness that occurs
during tomato (Lycopersicon esculentum) fruit ripening. Although fruit softening may involve changes in turgor pressure, anatomical characteristics, and cell wall integrity, it is generally assumed that cell wall disassembly leading to a loss of wall integrity is a critical feature. The most apparent changes, in terms of composition and size, occur in the pectic fraction of the cell wall
(for refs., see Seymour and Gross, 1996 The best-characterized pectin-modifying enzymes are PG (EC 3.2.1.15)
and PME (EC 3.1.1.11). Although PG and PME are relatively abundant and
have substantial activity during tomato fruit ripening, softening still
occurs, albeit with a slight delay, in fruit of transgenic plants in
which PG (Smith et al., 1988 Among the other known pectin modifications that occur during fruit
development, one of the best characterized is the significant net loss
of galactosyl residues that occurs in the cell walls of many ripening
fruit (Gross and Sams, 1984 The view that Carey et al. (1995) Tomato (Lycopersicon esculentum Mill. cv Rutgers)
plants were grown in a greenhouse using standard cultural practices.
The ripening mutants ripening inhibitor (rin),
nonripening (nor), and never-ripe
(Nr) (Tigchelaar et al., 1978 RNA Extraction
INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References
), which include increased solubility, depolymerization, deesterification, and a significant net
loss of neutral, sugar-containing side chains (Huber, 1983; Fischer and
Bennett, 1991; Seymour and Gross, 1996).
) or PME (Tieman et al., 1992; Hall et al.,
1993) gene expression and enzyme activity were significantly
down-regulated. Moreover, overexpression of PG in nonripening mutant
rin tomato fruit did not result in softening, even though
depolymerization and solubilization of pectin was evident (Giovannoni
et al., 1989).
; Kim et al., 1991; Seymour and Gross,
1996). Although some loss of galactosyl residues could result
indirectly from the action of PG, -galactosidase (exo-[14]-D-galactopyranosidase; EC
3.2.1.23) is the only enzyme identified in higher plants capable of
directly cleaving (14)galactan bonds, and probably plays a role
in galactan side chain loss (DeVeau et al., 1993; Carey et al., 1995;
Carrington and Pressey, 1996). No endo-acting galactanase has yet been
identified in higher plants.
-galactosidase is active in releasing galactosyl
residues from the cell wall during ripening is supported by the
dramatic increase in free Gal, a product of -galactosidase activity
(Gross, 1984), and a concomitant increase in -galactosidase II
activity in tomatoes during ripening (Carey et al., 1995). -Galactosidases are generally assayed using artificial substrates such as p-nitrophenyl--D-galactopyranoside,
4-methylumbelliferyl--D-galactopyranoside, and
X-Gal. However, it is clear that -galactosidase II is also active
against natural substrates such as (14)galactan (Pressey, 1983;
Carey et al., 1995; Carrington and Pressey, 1996). -Galactosidase proteins have been purified and characterized in a number of other fruits including kiwifruit (Actinidia deliciosa; Ross et
al., 1993), coffee (Coffea arabica; Golden et al., 1993),
persimmon (Diospyros kaki; Kang et al., 1994), and apple
(Malus domestica; Ross et al., 1994).
were able to purify one of the three previously
identified -galactosidases from ripening tomato fruit (Pressey,
1983), but only one (-galactosidase II) was active against
(14)galactan. Even though they were able to identify putative
-galactosidase cDNA clones, none of the deduced amino acid sequences
of the cDNAs matched the N-terminal sequence of the -galactosidase
II protein. Here we describe the cloning of a cDNA (pTomgal 4) that
apparently codes for -galactosidase II. We also show that the gene
corresponding to pTomgal 4 is expressed in wild-type fruit during
ripening and exhibits the expression pattern expected for
-galactosidase II in both wild-type and mutant fruit.
MATERIALS AND METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References
) were all in the cv Rutgers
background. Flowers were tagged at anthesis and fruit were harvested
according to the number of DPA or based on their surface color using
ripeness stages, as previously described (Mitcham et al., 1989). For
gene-expression studies, a variety of leaf, flower, and stem tissues
were harvested from greenhouse-grown plants and roots were harvested
from seedlings grown in basal tissue culture medium for 4 weeks after
seed germination.
80°C. RNA was extracted using the method described by
Verwoerd et al. (1989). Poly(A+) RNA was
purified from total RNA using oligo(dT) columns
(Pharmacia2). RNA
was quantified by measuring A260 using a
dual-beam spectrophotometer.
RT-PCR
Degenerate primers were designed based on the highest shared deduced amino acid sequence identity we found between apple (Malus domestica; accession no. P48981), asparagus (Asparagus officinalis; accession no. P45582), and carnation (Dianthus caryophyllus; accession no. Q00662)-galactosidase cDNA clones. The two primers used for the first
reaction were BG5
E1 (WSNGGNWSNATHCAYTAYCC) and BG3E
(CCRTAYTCRTCNADNGGNGC). A second reaction was done on the products of
the first reaction using BG5I1 (ATHCARACNTAYGTNTTYTGG) and BG3E. The
degeneracy code for the primer sequences is N = a + t + c + g;
H = a + t + c; B = t + c + g; D = a + t + g; V = a + c + g; R = a + g; Y = c + t; M = a + c; K = t + g; S = c + g; and W = a + t. The 5 and 3 primers
corresponded to amino acids 72 to 78 and 321 to 315, respectively, of
the apple clone. Amplification was with DNA polymerase (AmpliTaq,
Perkin-Elmer) and standard PCR conditions using the cDNA made for the
first cDNA library described below as a template (Ausubel et al.,
1987). PCR products were separated in an agarose gel and fragments of the expected size (approximately 750 bp) were purified, cloned into
pCRscript (Stratagene), and sequenced.
cDNA Library
Two cDNA libraries were constructed. The first comprised poly(A+) RNA isolated from breaker, turning, and pink fruit pericarp from cv Rutgers plants. The cDNA synthesis and library construction were done exactly according to the manufacturer's instructions for the ZAP-cDNA Gigapak II Gold cloning kit (Stratagene). First-strand cDNA synthesis was primed using a poly(dT) primer and inserts were directionally cloned into the Uni-Zap XR vector using EcoRI and XhoI restriction sites. The second library comprised poly(A+) RNA isolated from all fruit tissues (except seeds) from immature green, mature green, breaker, turning, pink, red-ripe, and overripe fruit of cv Rutgers plants. The cDNA synthesis and library construction was done exactly according to the manufacturer's instructions for the SuperScript Lambda System for cDNA synthesis and
cloning (GIBCO-BRL).
First-strand cDNA synthesis was primed using an oligo(dT) primer and
cDNA inserts were directionally cloned into the ZipLox cloning vector using SalI and NotI restriction
sites. Both libraries were amplified and maintained using the host
strains provided by the manufacturers according to their instructions.
DNA and RNA Gel-Blot Analysis
Total RNA (20 µg/lane) was separated in a formaldehyde/Mops agarose gel, transferred to a Hybond-N+ nylon membrane (Amersham), fixed by incubating for 2 h at 80°C, hybridized overnight in a hybridization incubator (Robbins Scientific, Sunnyvale, CA) using a buffer described by Church and Gilbert (1984),
washed to a final stringency of 0.1× SSC with 0.2% SDS at 65°C, and
autoradiographed essentially as described by Ausubel et al. (1987). An
RNA ladder standard (GIBCO-BRL) was used to estimate the lengths of the
RNAs. Probes were synthesized using a random-priming kit with
[32P]dATP as the label (Boehringer Mannheim).
pTomgal 4-specific probe was synthesized using an approximately 1-kb
BamHI-XhoI fragment from the 3 end of the cDNA
insert (for northern-blot analysis) or a 0.5-kb fragment from the
3-most end of the cDNA generated by PCR using the gene-specific primer
4-5F (GGTACAAGGCTACATTTAAC) and vector-specific primer T7 (for
Southern-blot analysis). As a loading control, RNA blots were stripped
and reprobed at a reduced hybridization and washing stringency using a
soybean 26S rDNA fragment (Turano et al., 1997). For all
hybridizations, [32P]dATP-labeled probe was
diluted to 1 × 106 to 2 × 106 dpm/mL. DNA gel-blot analysis was done
essentially as described by Smith and Fedoroff (1995), except that 3 µg of genomic DNA was used for each digest.
Sequence Analysis
Sequencing was done at the Iowa State University Sequencing Facility (Ames) using a PCR-based dideoxynucleotide terminator protocol and an automated sequencer (Applied Biosystems). The sequencing of both cDNA-insert strands was done by primer walking. Nucleotide and deduced amino acid sequence comparisons against the databases were done using BLAST searches (Altschul et al., 1990). Sequence data were analyzed and
aligned using DNA Strider 1.2 (Marck, 1988) and MacDNAsis (Hitachi, San
Bruno, CA) software.
Expression in Escherichia coli and -Galactosidase
Activity
gal 4 was PCR amplified using
oligonucleotides so that the signal peptide (amino acids 1-23) was
removed and a BglII and an EcoRI restriction site
was created at the 5 and the 3 end of the ORF, respectively. The
2.183-kb fragment was cloned into a
BglII-plus-EcoRI-digested pFLAG-CTC vector
(Kodak). The vector was transformed into the E. coli strain
XL1-Blue MR (lacZ) (Stratagene). As a positive control for
maximal -galactosidase activity the vector pGEM (containing the
E. coli lacZ gene fragment, Promega) was transformed into
the strain DH5
(containing the lacIqZ
M15 cassette). Cultures were
grown overnight to saturation in Luria-Bertani medium containing 0.4%
Glc and 100 µg/mL ampicillin at 37°C.
-Galactosidase
activity was estimated by harvesting 1 mL of cells every 12 h. The
cells were spun at full speed in a microcentrifuge (14,000 rpm) for 1 min, resuspended in 1 mL of water, and lysed by the addition of 50 µL
of chloroform and vortexing. The lysate was spun at full speed for 2 min in a microcentrifuge, the supernatant was removed, 1 mL of
dimethylformamide was added, and the tube was vortexed and sonicated
for 10 s to solubilize any blue precipitate resulting from the
cleavage of X-Gal. The tubes were again centrifuged at full speed for 5 min, and 750 µL of the supernatant was used to measure the
A615.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
Cloning
Degenerate primers were designed based on the most highly conserved regions of shared amino acid identity among three plant-galactosidase cDNAs from apple, asparagus, and carnation. These primers were used in a RT-PCR protocol, and a single product of approximately 750 bp was amplified (see ``Materials and Methods'').
Several PCR-product clones were sequenced and three unique, putative
tomato -galactosidase clones were identified. One of the clones
(RT-PCR2-1) was used to screen 106 plaques from a
tomato fruit cDNA library at low stringency. Thirty positive cDNA
clones were identified and partially sequenced. Complete sequencing and
characterization of the RT-PCR and cDNA clones revealed the possibility
of seven unique -galactosidase genes (data not shown).
Sequence Characterization
One of the seven unique clone sequences was nearly identical, except for the 5-untranslated region, to the previously published sequence of the tomato -galactosidase cDNA clone pTomgal 1 isolated from ripe cv Ailsa Craig fruit (Carey et al., 1995). The
matching cDNA clone was named pTomgal 10 (accession no. AF023847), and most likely corresponds to the same gene as pTomgal 1, but differs because different tomato cultivars were used to isolate the
cDNAs.
DNA Gel-Blot Analysis
pTom
pTom
Although it is apparent that a number of enzymes may be involved
in the degradation of cell wall pectin during fruit ripening, it is
important to identify each enzyme and the corresponding gene. It should
then be possible to create null mutations for each gene and gene
combination to understand the overall effect each gene product has on
cell wall metabolism and its consequential effect, if any, on fruit
softening. To meet part of this objective, we investigated the role of
Received October 9, 1997;
accepted February 10, 1998.
Abbreviations:
DPA, days postanthesis.
IPTG, isopropyl- The authors express their appreciation to Karen Green
and J. Norman Livsey for excellent technical support, to Frank Turano for generously providing the 26S soybean rDNA clone, and to Luca Pelligrini for critically reviewing the manuscript.
Altschul SF,
Gish W,
Miller W,
Meyers EW,
Lipman DJ
(1990)
Basic local alignment search tool.
J Mol Biol
215:
403-410
[CrossRef][ISI][Medline]
Ausubel F, Brent R, Kingston R, Moore D, Seidman J, Smith J, Struhl K,
eds (1987) Current Protocols in Molecular Biology. John Wiley & Sons, New York
Carey AT,
Holt K,
Picard S,
Wilde R,
Tucker GA,
Bird CR,
Schuch W,
Seymour GB
(1995)
Tomato exo-(1
Carrington CM,
Pressey R
(1996)
Church GM,
Gilbert W
(1984)
Genomic sequencing.
Proc Natl Acad Sci USA
81:
1991-1995
DeVeau EJ,
Gross KC,
Huber DJ,
Watada AE
(1993)
Degradation and solubilization of pectin by
Fischer RL,
Bennett AB
(1991)
Role of cell wall hydrolases in fruit ripening.
Annu Rev Plant Physiol Plant Mol Biol
42:
675-703
[CrossRef][ISI]
Giovannoni JJ,
DellaPenna D,
Bennett AB,
Fischer RL
(1989)
Expression of a chimeric polygalacturonase gene in transgenic rin (ripening inhibitor) tomato fruit results in polyuronide degradation but not fruit softening.
Plant Cell
1:
53-63
Golden KD,
John MA,
Kean EA
(1993)
Gross KC
(1984)
Fractionation and partial characterization of cell walls from normal and non-ripening mutant tomato fruit.
Physiol Plant
62:
25-32
Gross KC,
Sams CE
(1984)
Changes in cell wall neutral sugar composition during fruit ripening: a species survey.
Phytochemistry
23:
2457-2461
[CrossRef]
Hall LN,
Tucker GA,
Smith CJS,
Watson CF,
Seymour GB,
Bundick Y,
Boniwell JM,
Fletcher JD,
Ray JA,
Schuch W,
and others
(1993)
Antisense inhibition of pectin esterase gene expression in transgenic tomatoes.
Plant J
3:
121-129
Huber DJ
(1983)
The role of cell wall hydrolases in fruit softening.
Hortic Rev
5:
169-219
Kang IK,
Suh SG,
Gross KC,
Byun JK
(1994)
N-terminal amino acid sequence of persimmon fruit
Kim J,
Gross KC,
Solomos T
(1991)
Galactose metabolism and ethylene production during development and ripening of tomato fruit.
Postharv Biol Technol
1:
67-80
Marck C
(1988)
DNA Strider: a "C" program for the fast analysis of DNA and protein sequences on the Apple Macintosh family of computers.
Nucleic Acids Res
16:
1829-1836
Mitcham EJ,
Gross KC,
Ng TJ
(1989)
Tomato fruit cell wall synthesis during development and senescence. In vivo radiolabeling of cell wall fractions using [14C]sucrose.
Plant Physiol
89:
477-481
Nakai K,
Kanehisa M
(1992)
A knowledge base for predicting protein localization sites in eukaryotic cells.
Genomics
14:
897-911
[CrossRef][ISI][Medline]
Nielsen H,
Engelbrecht J,
Brunak S,
von Heijne G
(1997)
Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.
Protein Eng
10:
1-6
Pressey R
(1983)
Ross GS,
Redgwell RJ,
MacRae EA
(1993)
Kiwifruit
Ross GS,
Wegrzyn T,
MacRae EA,
Redgwell RJ
(1994)
Apple
Seymour GB,
Gross KC
(1996)
Cell wall disassembly and fruit softening.
Postharvest News Info
7:
45N-52N
Smith CJS,
Watson CFS,
Ray J,
Bird CR,
Morris PC,
Schuch W,
Grierson D
(1988)
Antisense RNA inhibition of polygalacturonase gene expression in transgenic tomatoes.
Nature
334:
724-726
[CrossRef]
Smith DL,
Fedoroff NV
(1995)
LRP1, a gene expressed in lateral and adventitious root primordia of Arabidopsis.
Plant Cell
7:
735-745
[Abstract]
Tieman DM,
Harriman RW,
Ramamohan G,
Handa AK
(1992)
An antisense pectin methylesterase gene alters pectin chemistry and soluble solids in tomato fruit.
Plant Cell
4:
667-679
Tigchelaar EC,
McGlasson WB,
Buescher RW
(1978)
Genetic regulation of tomato fruit ripening.
HortScience
13:
508-513
[ISI]
Turano FJ,
Thakkar SS,
Fang T,
Weisemann JM
(1997)
Characterization and expression of NAD(H) dependent glutamate dehydrogenase genes in Arabidopsis thaliana.
Plant Physiol
113:
1329-1341
[Abstract]
Verwoerd TC,
Dekker BMM,
Hoekema A
(1989)
A small-scale procedure for the rapid isolation of plant RNAs.
Nucleic Acids Res
17:
2362
-galactosidase clones revealed that the deduced amino acid sequence of one cDNA (pTomgal 4) most closely matched (28 of 30 amino acids)
the partial N-terminal amino acid sequence of -galactosidase II
(TOMAA) that was purified from ripening tomato fruit and was shown to
have exo-(14)galactosidase activity against tomato cell wall preparations and galactan substrates in vitro (Fig. 1) (Carey et al., 1995). We suspect that
the second- and third-to-last residues (KY) in the TOMAA sequence are
incorrect (Fig. 1). In all of the plant -galactosidase sequences
published to date, the residues ST occur at these positions (Fig. 1).
In addition, all of the other tomato -galactosidase clones we have
sequenced also contain the residues ST or conserved substitutions at
these positions (not shown). Therefore, the deduced amino acid sequence of pTomgal 4 probably codes for the
exo-(14)galactanase characterized by Carey et al.
(1995).
View larger version (97K):
[in a new window]
Figure 1.
Multiple sequence alignment of the N-terminal
amino acid sequence of -galactosidase II protein from tomato fruit
and the deduced amino acid sequences of various plant -galactosidase cDNA clones. The two-amino acid mismatch between the partial N-terminal amino acid sequence of -galactosidase II (TOMAA) and the deduced amino acid sequences discussed at length in ``Results'' is indicated
by boldface type. An asterisk (*) below any amino acid indicates that
that position is conserved in all sequences. The accession numbers for
the cDNA clones are: pTomgal 4, AF020390; pTomgal 1, P48980;
asparagus, P45582; apple, P48981; and carnation, Q00662.
gal 4 is available
in GenBank. The cDNA insert is 2554 nucleotides long and contains a
single, long ORF predicted to start with the first in-frame ATG at
nucleotide 64 and end with TAA at nucleotide 2238. This ORF codes for a
79-kD protein 725 amino acids long. The programs PSORT version 6.4 (Nakai and Kanehisa, 1992) and SignalP version 1.1 (Nielsen et al.,
1997) were used to predict that the ORF contains a hydrophobic leader
sequence that would be cleaved between the Ala and Ser residues at
positions 23 and 24, respectively, and that the mature polypeptide has
an extracellular location. The mature polypeptide contains three
possible N-glycosylation sites at Asn-282, Asn-459, and
Asn-713; however, the Asn at position 713 is unlikely to be
glycosylated because of the Pro at position 714. The predicted
molecular mass of the unglycosylated mature polypeptide was 75 kD, with
a pI of 8.9.
gal 4 shared significant
identity with all published plant -galactosidase amino acid sequences in the database (Fig. 1). When the entire ORF of each -galactosidase gene was compared with that of pTomgal 4, the shared sequence identity was 64% for tomato pTomgal 1, 68% for apple, 62% for asparagus, and 56% for carnation.
-galactosidases exist as a multigene family,
gel blots were performed to test all seven of the putative -galactosidase clones for possible cross-hybridization. When the
full-length pTomgal 4 was used as a probe, no cross-hybridization to
the other six clones was detected under high-stringency hybridization and washing conditions (data not shown). A 0.5-kb fragment derived from
the 3 end of the pTomgal 4 cDNA insert was used as a probe to
determine the gene's copy number because the genomic DNA sequence of
this gene is uncharacterized. When high-stringency conditions were
used, only one band was observed for each restriction-enzyme digest,
suggesting that the gene corresponding to pTomgal 4 is present as a
single copy (Fig. 2).
View larger version (68K):
[in a new window]
Figure 2.
Autoradiograph of a gDNA gel blot. The probe was
synthesized using a 0.5-kb fragment from the 3 end of the pTomgal 4 cDNA insert. Three micrograms of gDNA was digested with
BamHI (B), EcoRI (E), or
HindIII (H) and loaded in each lane.
gal 4 Hybridizes to a Transcript Expressed in Ripening Fruit
gal 4 transcript was present during fruit and plant development. To minimize any potential signal during the long exposures necessary for
northern-blot analysis due to cross-hybridization, the probe used was
synthesized using the 3 one-third of the pTomgal 4 insert. The 3
ends of the various plant and putative tomato -galactosidase clones
have the lowest degree of shared sequence identity (see Fig. 1).
pTomgal 4-specific probe did not detect transcript in tomato fruit
peel, pericarp, or columella tissues between 10 and 45 DPA, i.e. up to
the mature green stage of development. However, transcript was detected
at the breaker stage (Fig. 3A), the stage
representing incipient coloration and the visible beginning of
ripening. Transcript reached maximum accumulation at the turning stage
and continued to be present during the later stages of fruit ripening,
albeit at decreasing levels (Fig. 3A). At the turning stage of
development, maximum transcript levels were detected in the peel and/or
outermost region of the outer pericarp, and was present in all fruit
tissues tested (Fig. 3B). Expression of the gene corresponding to
pTomgal 4 was not limited to fruit; transcript was detected in
roots, stems, and flowers but not in leaves (Fig. 3C).
View larger version (74K):
[in a new window]
Figure 3.
Detection of pTom gal 4 hybridization by RNA
gel-blot analysis. All lanes were prepared using 20 µg of total RNA.
Probes used are indicated to the right of each blot. A, RNA was
isolated from total pericarp and peel tissue of fruit from 10 to 45 DPA
and from breaker (Br), turning (Tr), pink (Pk), red-ripe (Rd), and overripe (OR) fruit. B, RNA for this blot was isolated from various tissues including the peel (Pl), outer pericarp (OP), inner
pericarp/columella (IP), and locules not including seeds (Lo) of
turning-stage fruit. C, RNA for this blot was isolated from flower (F),
leaf (L), root (R), and stem (S) tissues. The blots in the upper panels
of A and C were exposed to Kodak XAR film using an intensifying screen at 80°C for 4 d, and the blot in the upper panel of B was
exposed to Kodak Biomax film using an intensifying screen at 80°C
for 2 d.
-Galactosidase II Gene Expression Is Attenuated in the Ripening
Mutants nor, rin, and Nr
showed that -galactosidase II activity
increased 4-fold during ripening in wild-type cv Ailsa Craig fruit, whereas in the mutants rin and nor, enzyme
activity remained at the basal level of normal, mature green fruit and
did not change during ripening. They also showed that total
-galactosidase activity showed no marked ripening-related changes,
and levels were similar in both wild-type and mutant fruit. We
therefore concluded that if pTomgal 4 coded for -galactosidase
II, then it should not detect an increase in gene transcript in the
mutants rin and nor during the period
corresponding to the red-ripe stages of normal fruit development.
Indeed, when pTomgal 4 was used as a probe, very little if any
transcript was detected in RNA extracted from nor and
rin fruit at either 45 or 50 DPA (Fig.
4).
View larger version (65K):
[in a new window]
Figure 4.
Autoradiograph of RNA gel blots of mutant fruit.
Twenty micrograms of total RNA from wild-type (wt) and the ripening
mutants nor, rin, and Nr
fruit peel and pericarp was loaded into each lane. Fruit was harvested
at the DPA indicated or at the turning (Tr) or red-ripe (Rd) stages of
development. Probes used were synthesized using the clones indicated to
the right of each blot. The blots were exposed to Kodak Biomax film
using an intensifying screen at 80°C for 2 d.
gal 4 also failed to hybridize to any transcript in RNA isolated
from fruit of Nr (Fig. 4). As a positive control, pTomgal 10 was used as a probe for the same RNA gel-blot analysis (Fig. 4).
Carey at al (1995) had shown that the pTomgal 1 clone detected transcript in fruit of the mutants nor and rin 45 and 65 DPA. Because we suspect that pTomgal 10 corresponds to the
same gene as pTomgal 1 but that they are from different cultivars,
it should hybridize to transcript isolated from both nor and
rin fruit 45 to 65 DPA. As expected, pTomgal 10 did
hybridize to transcript isolated from fruit of nor and
rin plants 45 and 50 DPA (Fig. 4). pTomgal 10 also
detected transcript in RNA isolated from fruit of Nr plants
(Fig. 4).
gal 4 Codes for a -Galactosidase
gal 4 ORF was cloned in-frame into the
repressible/inducible bacterial expression vector pFLAG-CTC. The host
strain XL1-Blue MR is a mutant strain containing neither endogenous
-galactosidase activity nor -complementation. Induction of gene
transcription by IPTG caused the immediate cessation of E. coli growth at 30 to 37°C; however, induction at 20°C did
allow for some limited growth. When clones containing the pTomgal 4 ORF were grown at 20°C and induced with IPTG, the cells slowly turned
blue after 36 h of growth in medium containing the
-galactosidase substrate X-Gal (Fig.
5). If not induced with IPTG, no blue
coloration was seen, even after extended growth in medium containing
X-Gal. As an additional negative control, clones consisting of XL1-Blue MR transformed with the FLAG vector alone showed no -galactosidase activity with or without IPTG induction, even after 7 d of growth (Fig. 5). As a positive control for maximal -galactosidase
(derived from E. coli -galactosidase) activity, the
cloning vector pGEM was transformed into the host strain DH5. These
results are shown in Figure 5.
View larger version (11K):
[in a new window]
Figure 5.
Detection of -galactosidase activity from
pTomgal 4 expression in E. coli. Cells were harvested
and extracts were prepared every 12 h and the
A615 was measured. Cultures were grown with the addition of the chromogenic substrate X-Gal (open symbols) or X-Gal
and the transcriptional inducer IPTG (closed symbols) in the medium.
The vector used as a positive control for E. coli -galactosidase activity was pGEM (
), and the vector used as a
negative control and for expression was pFLAG-CTC either without (
,
) or with (
, 
) the pTomgal 4 ORF.
DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References
-galactosidases in tomato during fruit ripening and softening, and
describe the cloning of a -galactosidase cDNA clone that most likely
codes for a (14)galactan-degrading enzyme and is expressed in
ripening tomato fruit tissues.
isolated three -galactosidase
isozymes and several related cDNAs, it is not known why a cDNA coding
for -galactosidase II, the isozyme with known activity against
native polysaccharide substrates, was never identified (G. Seymour,
personal communication). We used one of the RT-PCR clones (2-1) to
screen our own cDNA library; however, this RT-PCR clone did not share
more sequence identity to pTomgal 4 than did pTomgal 1 (data not
shown). It is possible that the choice of
poly(A+) RNA that was used to construct the
libraries was critical in the identification of -galactosidase cDNA
clones.
gal 4 is a cDNA derived from the transcript of a
gene that codes for -galactosidase II for three reasons. First, the
deduced amino acid sequence of the highly conserved N-terminal portion
of the expected mature pTomgal 4 translation product matches almost
exactly (28 of 30 amino acids) the N-terminal sequence of
-galactosidase II (Fig. 1). The two amino acids (KY) in the
-galactosidase II sequence that do not match the pTomgal 4 deduced amino acid sequence are believed to be incorrect, since all
plant -galactosidase sequences in the database and four additional -galactosidase-related cDNAs that were identified from tomato match
the deduced amino acid sequence of pTomgal 4 at these same two amino
acid (ST) positions (Fig. 1).
gal 4 is present in
normal ripening fruit at the same time that -galactosidase II activity is detected (Fig. 3) (Carey et al., 1995). Moreover, little or
no transcript was detected in fruit at 45 and 50 DPA from the mutants
nor, rin, and Nr (Fig. 4). This
observation also coincides with the data presented by Carey et al.
(1995) that -galactosidase II activity remained at levels equal to
those in mature green fruit and did not increase in fruit from
nor or rin plants 45 to 65 DPA. Carrington and
Pressey (1996) recently reported that -galactosidase II activity was
detected in cv Rutgers fruit only after the turning stage of ripeness.
The northernblot data in the present study suggest that maximum
-galactosidase II activity should occur only after the turning
stage, assuming that mRNA levels predict extractable enzyme activity
(Fig. 3).
gal 4 sequence are similar to those determined for -galactosidase II.
Pressey (1983) estimated a molecular mass of 62 kD by gel-filtration
column chromatography and a pI of 7.8 by IEF, and Carey et al. (1995) estimated a molecular mass of 75 kD by SDS-PAGE and a pI of 9.8.
gal 4 in
tomato fruit ripening/softening, we have initiated gene-knockout studies. We are currently establishing transgenic tomato plant lines
via Agrobacterium tumefaciens-mediated transformation, which are expressing pTomgal 4 in the antisense orientation.
1
Present address: Department of Biology, MS 6200, Southeast Missouri State University, Cape Girardeau, MO 63701.
FOOTNOTES
*
Corresponding author; e-mail kgross{at}asrr.arsusda.gov; fax
1-301-504-5107.
The accession number for the pTomgal 4 sequence reported in this
article is AF020390.
2
Use of a company or product name by the U.S.
Department of Agriculture does not imply approval or recommendation of
the product to the exclusion of others that may also be suitable.
ABBREVIATIONS
-D-thiogalactopyranoside.
ORF, open reading
frame.
PG, polygalacturonase (endo-14-D-galacturonan
hydrolase).
PME, pectin methylesterase.
RT, reverse transcriptase.
X-Gal, 5-bromo-4-chloro-3-indoxyl--D-galactopyranoside.
ACKNOWLEDGMENTS
LITERATURE CITED
Top
Abstract
Introduction
Methods
Results
Discussion
References
4)--D-galactanase. Isolation, changes during ripening in normal and mutant tomato fruit, and characterization of a related clone.
Plant Physiol
108:
1099-1107
[Abstract] -Galactosidase II activity in relation to changes in cell wall galactosyl composition during tomato ripening.
J Am Soc Hortic Sci
121:
132-136
-galactosidases purified from avocado mesocarp.
Physiol Plant
87:
279-285
[CrossRef] -Galactosidase from Coffea arabica and its role in fruit ripening.
Phytochemistry
34:
355-360
[CrossRef] -galactosidase.
Plant Physiol
105:
975-979
[Abstract] -Galactosidases in ripening tomatoes.
Plant Physiol
71:
132-135
-galactosidase: isolation and activity against specific fruit cell-wall polysaccharides.
Planta
189:
499-506
-galactosidase. Activity against cell wall polysaccharides and characterization of a related cDNA clone.
Plant Physiol
106:
521-528
[Abstract]
Copyright Clearance Center: 0032-0889/98/117/0417/07
© 1998 American Society of Plant Physiologists
This article has been cited by other articles:
|
|
 |
|
  J. Agusti, P. Merelo, M. Cercos, F. R. Tadeo, and M. Talon Ethylene-induced differential gene expression during abscission of citrus leaves J. Exp. Bot., July 1, 2008; 59(10): 2717 - 2733. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Macquet, M.-C. Ralet, O. Loudet, J. Kronenberger, G. Mouille, A. Marion-Poll, and H. M. North A Naturally Occurring Mutation in an Arabidopsis Accession Affects a {beta}-D-Galactosidase That Increases the Hydrophilic Potential of Rhamnogalacturonan I in Seed Mucilage PLANT CELL, December 1, 2007; 19(12): 3990 - 4006. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Shipkowski and J. E. Brenchley Bioinformatic, Genetic, and Biochemical Evidence that Some Glycoside Hydrolase Family 42 {beta}-Galactosidases Are Arabinogalactan Type I Oligomer Hydrolases Appl. Envir. Microbiol., December 1, 2006; 72(12): 7730 - 7738. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kotake, S. Dina, T. Konishi, S. Kaneko, K. Igarashi, M. Samejima, Y. Watanabe, K. Kimura, and Y. Tsumuraya Molecular Cloning of a {beta}-Galactosidase from Radish That Specifically Hydrolyzes {beta}-(1->3)- and {beta}-(1->6)-Galactosyl Residues of Arabinogalactan Protein Plant Physiology, July 1, 2005; 138(3): 1563 - 1576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Wu and J. K. Burns A {beta}-galactosidase gene is expressed during mature fruit abscission of 'Valencia' orange (Citrus sinensis) J. Exp. Bot., July 1, 2004; 55(402): 1483 - 1490. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Moctezuma, D. L. Smith, and K. C. Gross Antisense suppression of a {beta}-galactosidase gene (TB G6) in tomato increases fruit cracking J. Exp. Bot., September 1, 2003; 54(390): 2025 - 2033. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Smith, J. A. Abbott, and K. C. Gross Down-Regulation of Tomato beta -Galactosidase 4 Results in Decreased Fruit Softening Plant Physiology, August 1, 2002; 129(4): 1755 - 1762. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. O. Sozzi, L. C. Greve, G. A. Prody, and J. M. Labavitch Gibberellic Acid, Synthetic Auxins, and Ethylene Differentially Modulate alpha -L-Arabinofuranosidase Activities in Antisense 1-Aminocyclopropane-1-Carboxylic Acid Synthase Tomato Pericarp Discs Plant Physiology, July 1, 2002; 129(3): 1330 - 1340. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Trainotti, R. Spinello, A. Piovan, S. Spolaore, and G. Casadoro {beta}-Galactosidases with a lectin-like domain are expressed in strawberry J. Exp. Bot., August 1, 2001; 52(361): 1635 - 1645. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Tateishi, H. Inoue, H. Shiba, and S. Yamaki Molecular Cloning of {beta}-Galactosidase from Japanese Pear (Pyrus pyrifolia) and its Gene Expression with Fruit Ripening Plant Cell Physiol., May 1, 2001; 42(5): 492 - 498. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Orfila, G. B. Seymour, W. G.T. Willats, I. M. Huxham, M. C. Jarvis, C. J. Dover, A. J. Thompson, and J. P. Knox Altered Middle Lamella Homogalacturonan and Disrupted Deposition of (1{right-arrow}5)-{alpha}-L-Arabinan in the Pericarp of Cnr, a Ripening Mutant of Tomato Plant Physiology, May 1, 2001; 126(1): 210 - 221. [Abstract] [Full Text]
|
|
|
|
|
|
A. T. Carey, D. L. Smith, E. Harrison, C. R. Bird, K. C. Gross, G. B. Seymour, and G. A. Tucker Down-regulation of a ripening-related {beta}-galactosidase gene (TBG1) in transgenic tomato fruits J. Exp. Bot., April 15, 2001; 52(357): 663 - 668. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Smith and K. C. Gross A Family of at Least Seven beta -Galactosidase Genes Is Expressed during Tomato Fruit Development Plant Physiology, July 1, 2000; 123(3): 1173 - 1184. [Abstract] [Full Text]
|
|
|
|
|
|
D. A. Brummell, M. H. Harpster, P. M. Civello, J. M. Palys, A. B. Bennett, and P. Dunsmuir Modification of Expansin Protein Abundance in Tomato Fruit Alters Softening and Cell Wall Polymer Metabolism during Ripening PLANT CELL, November 1, 1999; 11(11): 2203 - 2216. [Abstract] [Full Text]
|
|
| ||||||
-Galactosidase II Is Expressed
during Fruit Ripening