|
|
||||||||
|
Plant Physiol. (1998) 117: 559-563
Function and Substrate Specificity of the Gibberellin
3
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
cDNA
corresponding to the GA4 gene of
Arabidopsis thaliana L. (Heynh.) was
expressed in Escherichia coli, from which cell lysates
converted [14C]gibberellin (GA)9 and
[14C]GA20 to radiolabeled GA4 and
GA1, respectively, thereby confirming that
GA4 encodes a GA 3
-hydroxylase. GA9 was
the preferred substrate, with a Michaelis value of 1 µM
compared with 15 µM for GA20. Hydroxylation of these GAs was regiospecific, with no indication of
2
-hydroxylation or 2,3-desaturation. The capacity of the recombinant
enzyme to hydroxylate a range of other GA substrates was investigated.
In general, the preferred substrates contained a polar bridge between C-4 and C-10, and 13-deoxy GAs were preferred to their 13-hydroxylated analogs. Therefore, no activity was detected using
GA12-aldehyde, GA12, GA19,
GA25, GA53, or GA44 as the open
lactone (20-hydroxy-GA53), whereas GA15,
GA24, and GA44 were hydroxylated to
GA37, GA36, and GA38, respectively.
The open lactone of GA15 (20-hydroxy-GA12) was
hydroxylated but less efficiently than GA15. In contrast to the free acid, GA25 19,20-anhydride was 3
-hydroxylated
to give GA13. 2,3-Didehydro-GA9 and
GA5 were converted by recombinant GA4 to the corresponding
epoxides 2,3-oxido-GA9 and GA6.
Dwarf mutants with reduced biosynthesis of the GA plant hormones
have been valuable tools in studies of the function of these compounds
(Ross, 1994 The GA4 locus was isolated by T-DNA tagging and, on the
basis of the derived amino acid sequence, was also shown to encode a
dioxygenase (Chiang et al., 1995 Expression of GA4 in Escherichia coli
![]()
INTRODUCTION
Top
Abstract
Introduction
Methods
Results & Discussion
References
). In Arabidopsis thaliana, mutations
at six loci (GA1-GA6) that result in reduced GA
biosynthesis have been identified (Koorneef and van der Veen, 1980;
Sponsel et al., 1997
), and three of these loci have recently been
cloned. The GA1 locus was isolated by genomic subtraction
(Sun et al., 1992
) and shown by heterologous expression in
Escherichia coli to encode the enzyme that cyclizes
geranylgeranyl diphosphate to copalyl diphosphate (Sun and Kamiya,
1994
). This enzyme was formerly referred to as ent-kaurene
synthase A but has been renamed copalyl diphosphate synthase
(Hedden and Kamiya, 1997
; MacMillan, 1997
). The GA5
locus was shown to correspond to one of the GA 20-oxidase genes (Xu et
al., 1995
), the products of which catalyze the conversion of GA12 to GA9 and
GA53 to GA20 (Phillips et
al., 1995
; Xu et al., 1995
). GA 20-oxidases are
2-oxoglutarate-dependent dioxygenases that are encoded by small
multigene families, members of which are differentially expressed in
plant tissues (Phillips et al., 1995
; Garcia-Martinez et al., 1997).
). Several lines of evidence indicate
that the GA4 gene encodes a GA 3
-hydroxylase. Shoots of a
ga4 mutant, all alleles of which are semidwarf, contained reduced concentrations of the 3
-hydroxy GAs
GA1, GA4, and
GA8 compared with the Landsberg erecta
wild type, whereas levels of immediate precursors to these GAs were
elevated (Talon et al., 1990
). Furthermore, metabolism of
[13C]GA20 to
[13C]GA1 was
substantially less in the mutant than in the wild type (Kobayashi et
al., 1994
). In the present paper we confirm by functional expression of
its cDNA in E. coli that GA4 encodes a GA
3
-hydroxylase. In addition, we determine the substrate specificity
of recombinant GA4 using a number of C20- and
C19-GAs and show by kinetic analysis that the enzyme
has a higher affinity for GA9 than for
GA20, which is consistent with the
non-13-hydroxylation pathway predominating in Arabidopsis (Talon et
al., 1990
).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Methods
Results & Discussion
References
) using
oligonucleotide primers with NcoI and BamHI
sites: forward primer, CAACCATGGCTGCTATGTTAACAGA; reverse primer,
CAAGGATCCTCATTCTTCTCTGTGATTT.
-hydroxylase activity, sequencing of the PCR
product identified a point mutation, resulting in a change of amino
acid within the coding region. To prepare expression constructs with
the correct sequence (Chiang et al., 1997
), a SacI-BamHI fragment containing the mutation was
replaced in both vectors with the corresponding fragment from the
GA4 cDNA clone pCD7 (Chiang et al., 1995
). Cultures (50 mL)
of E. coli BL21 transformed with the recombinant plasmids
were grown with shaking at 37°C in 2× YT broth (1.6% [w/v]
bactotryptone, 1% [w/v] yeast extract, and 0.5% [w/v] NaCl)
containing 200 µg L
1 carbenicillin (pET3d) or
100 µg mL
1 kanamycin (pET9d). At the
mid-logarithmic stage, cultures were transferred to 30°C and shaken
for 30 min, after which expression was induced by the addition of IPTG
(final concentration, 5 mM). At the same time, more
antibiotics were added (400 µg mL
1
carbenicillin or 200 µg mL
1 kanamycin).
Cultures were grown for another 3 h at 30°C and then placed on
ice for 10 min, and cells were harvested by centrifugation at 5000 rpm
at 4°C for 5 min. Pellets were resuspended in 25 mL of 100 mM Tris-HCl, pH 7.1, at 25°C containing 4 mM
DTT, and recentrifuged as described above. Pellets were then
resuspended in the same buffer (2 mL) containing lysozyme at 1 mg/mL,
incubated at 30°C with shaking for 15 min, and, after cooling on ice,
sonicated (three 5-s pulses). After centrifugation of the lysates at
12,000g for 15 min at 4°C, the supernatants were frozen in
liquid N2 and stored at
80°C.
Analysis of Expressed Protein by SDS-PAGE
Proteins from cultures induced with IPTG, described above, were analyzed by SDS-PAGE. For comparison, proteins were analyzed from cells grown under the same conditions but without the addition of IPTG. Induced cells contained typically 0.5 to 1.0 mg protein mL
1 culture, whereas noninduced cells contained
approximately 30% of the protein concentration present in induced
cells. Soluble and insoluble protein fractions were obtained after
lysis of cells (1 mL) using lysozyme, as described above. After the
sample was centrifuged, the supernatant and resuspended pellet, in 100 mM Tris-HCl buffer, pH 7.5 (0.1 mL), were diluted 1:1 with
loading buffer. Equal quantities of protein for each sample were loaded onto the gel.
Enzyme Assays with Recombinant Protein
Provision of Substrates
[17-14C]GA9 (specific radioactivity 2.10 TBq mol
1) and
[17-13C,3H]GA5
(1.51 TBq mol
1) were gifts from Dr I. Yamaguchi
(University of Tokyo) and Prof. J. MacMillan (Long Ashton Research
Station), respectively.
[17-14C]GA24 (1.72 TBq
mol
1) and
[17-14C]GA19 (1.72 TBq
mol
1) were obtained from Prof. L.N. Mander
(Australian National University, Canberra).
2,3-Didehydro[17-14C]GA9
(1.75 TBq mol
1) and
[17-14C]GA20 (1.84 TBq
mol
1) were synthesized as described by
MacMillan et al. (1997)
1),
GA12-aldehyde (6.90 TBq
mol
1), and
GA15 (6.32 TBq mol
1) were prepared from
R-[2-14C]mevalonic acid using a
cell-free system from pumpkin endosperm, as described by Graebe et al.
(1974)
1) and
[17-14C]GA44 (1.42 TBq
mol
1) were prepared from
[14C4]GA12
and
[14C1]GA12,
respectively, using a homogenate of developing pea cotyledons (Kamiya
and Graebe, 1983
1) was prepared from
[14C4]GA12
using a partially purified GA 20-oxidase from pumpkin endosperm (Lange
et al., 1994Enzyme Assays
For incubations with different substrates, cell lysates (5 or 50 µL) were incubated for 1 h at 30°C with the substrate, which was added in 5 µL of methanol in the presence of 100 mM Tris-HCl, pH 7.5, and a cofactor mixture (5 µL, containing 80 mM 2-oxoglutarate, 80 mM ascorbate, 80 mM DTT, 10 mM FeSO4, 40 mg mL
1 BSA, and 20 mg
mL
1 catalase in 100 mM Tris-HCl, pH
7.5) in a total volume of 0.1 mL. After the addition of acetic acid (10 µL) and water (140 µL), the incubation mixture was centrifuged at
3000 rpm for 10 min and then analyzed directly by HPLC with on-line
radiomonitoring (MacMillan et al., 1997| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
Heterologous Expression of GA4 in E. coli
GA4 cDNA was inserted into pET3d and pET9d vectors, and expression was induced in E. coli with 5 mM IPTG. Cell lysates from cultures of bacteria containing either expression construct metabolized [14C]GA9 to [14C]GA4, and [14C]GA20 to [14C]GA1, with higher activity obtained with pET3d (Fig. 1). Lysates from bacteria containing vector with no insert did not metabolize either substrate (data not shown). Therefore, it is confirmed that GA4 encodes a GA 3
-hydroxylase. The
LE gene of pea has now also been cloned and, after
expression in E. coli, shown to encode a GA 3
-hydroxylase
with 54% amino acid identity to the corrected (Chiang et al., 1997
|
Characteristics of Recombinant GA4
[14C]GA9 and [14C]GA20 were compared as the substrates for recombinant GA4 in cell lysates. Plots of reaction rate against substrate concentration, produced by nonlinear regression analysis (Fig. 2), yielded Km values of 1.0 µM (Vmax 6.8 pmol min
1
mg
1) and 15 µM
(Vmax 2.8 pmol min
1
mg
1) for GA9 and
GA20, respectively. The preference for
GA9 as a substrate is consistent with the
predominance of non-13-hydroxylated GAs in Arabidopsis; the major
C19-GA identified from entire shoots is
GA4 (Talon et al., 1990
-hydroxylated to
GA4. The Km values
are very similar to those determined recently for the GA
3
-hydroxylase from pea, obtained by expression of the LE
cDNA in E. coli (Martin et al., 1997
|
Received November 26, 1997;
accepted March 11, 1998.
Abbreviation:
IPTG, isopropyl- We thank Dr. I. Yamaguchi (University of Tokyo), Professor J. MacMillan (IACR-Long Ashton Research Station), and Professor L.N.
Mander (Australian National University, Canberra), for gifts of
radiolabeled GAs, and Dr. C.L. Willis (School of Chemistry, University
of Bristol, UK) for providing the GA25 anhydride.
Albone KS,
Gaskin P,
MacMillan J,
Phinney BO,
Willis CL
(1990)
Biosynthetic origin of gibberellins A3 and A7 in cell-free preparations from seeds of Marah macrocarpus and Malus domestica.
Plant Physiol
94:
132-142
Chiang H-H,
Hwang I,
Goodman HM
(1995)
Isolation of the Arabidopsis GA4 locus.
Plant Cell
7:
195-201
[Abstract]
Chiang H-H,
Hwang I,
Goodman HM
(1997)
Correction to: Isolation of the Arabidopsis GA4 locus (Plant Cell 7: 195-201).
Plant Cell
9:
979-980
García-Martínez JL,
López-Diaz I,
Sánchez-Beltrán MJ,
Phillips AL,
Ward DA,
Gaskin P,
Hedden P
(1997)
Isolation and transcript analysis of gibberellin 20-oxidase genes in pea and bean in relation to fruit development.
Plant Mol Biol
33:
1073-1084
[CrossRef][Web of Science][Medline]
Gaskin P, MacMillan J (1991) GC-MS of the Gibberellins and Related
Compounds: Methodology and a Library of Spectra. Cantock's
Enterprises, Bristol, UK
Graebe JE,
Hedden P,
Gaskin P,
MacMillan J
(1974)
Biosynthesis of gibberellins Al2, Al5, A24, A36 and A37 by a cell-free system from Cucurbita maxima.
Phytochemistry
13:
1433-1440
[CrossRef]
Hedden P,
Kamiya Y
(1997)
Gibberellin biosynthesis: enzymes, genes and their regulation.
Annu Rev Plant Physiol Plant Mol Biol
48:
431-460
[CrossRef][Web of Science]
Kamiya Y,
Graebe JE
(1983)
The biosynthesis of all major pea gibberellins in a cell-free system from Pisum sativum L.
Phytochemistry
22:
681-689
[CrossRef]
Kobayashi M,
Gaskin P,
Spray CR,
Phinney BO,
MacMillan J
(1994)
The metabolism of gibberellin A20 to gibberellin A1 by tall and dwarf mutants of Oryza sativa and Arabidopsis thaliana.
Plant Physiol
106:
1367-1372
[Abstract]
Kobayashi M,
Kwak S-S,
Kamiya Y,
Yamane H,
Takahashi N,
Sakurai A
(1991)
Conversion of GA5 to GA6 and GA3 in cell-free systems from Phaseolus vulgaris and Oryza sativa.
Agric Biol Chem
55:
249-251
Koornneef M,
van der Veen JH
(1980)
Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) Heynh.
Theor Appl Genet
58:
257-263
[CrossRef][Web of Science]
Lange T,
Robatzek S,
Frisse A
(1997)
Cloning and expression of a gibberellin 2
Lange T,
Schweimer A,
Ward DA,
Hedden P,
Graebe JE
(1994)
Separation and characterization of three 2-oxoglutarate-dependent dioxygenases from Cucurbita maxima L. endosperm involved in gibberellin biosynthesis.
Planta
195:
98-107
Lester DR,
Ross JJ,
Davies PJ,
Reid JB
(1997)
Mendel's stem length gene (Le) encodes a gibberellin 3
MacMillan J
(1997)
Biosynthesis of the gibberellin plant hormones.
Nat Prod Rep
14:
221-243
[CrossRef]
MacMillan J,
Ward DA,
Phillips AL,
Sánchez-Beltrán MJ,
Gaskin P,
Lange T,
Hedden P
(1997)
Gibberellin biosynthesis from gibberellin A12-aldehyde in endosperm and embryos of Marah macrocarpus.
Plant Physiol
113:
1369-1377
[Abstract]
Martin DN,
Proebsting WM,
Hedden P
(1997)
Mendel's dwarfing gene: cDNAs from the Le alleles and the function of the expressed proteins.
Proc Natl Acad Sci USA
94:
8907-8911
Phillips AL,
Ward DA,
Uknes S,
Appleford NEJ,
Lange T,
Huttly AK,
Gaskin P,
Graebe JE,
Hedden P
(1995)
Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.
Plant Physiol
108:
1049-1057
[Abstract]
Ross JJ
(1994)
Recent advances in the study of gibberellin mutants.
Plant Growth Regul
15:
193-206
Smith VA,
Gaskin P,
MacMillan J
(1990)
Partial purification and characterization of the gibberellin A20 3
Sponsel VM,
Schmidt FW,
Porter SG,
Nakayama M,
Kohlstruk S,
Estelle M
(1997)
Characterization of new gibberellin-responsive semidwarf mutants of Arabidopsis.
Plant Physiol
115:
1009-1020
[Abstract]
Sun TP,
Goodman HM,
Ausubel FM
(1992)
Cloning the Arabidopsis GA1 locus by genomic subtraction.
Plant Cell
4:
119-128
Sun TP,
Kamiya Y
(1994)
The Arabidopsis GA1 locus encodes the cyclase ent-kaurene synthetase A of gibberellin biosynthesis.
Plant Cell
6:
1509-1518
[Abstract]
Talon M,
Koornneef M,
Zeevaart JAD
(1990)
Endogenous gibberellins in Arabidopsis thaliana and possible steps blocked in the biosynthetic pathways of the semidwarf ga4 and ga5 mutants.
Proc Natl Acad Sci USA
87:
7983-7987
Xu YL,
Li L,
Wu K,
Peeters AJM,
Gage D,
Zeevaart JAD
(1995)
The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.
Proc Natl Acad Sci USA
92:
6640-6644
View this table:
Table I.
Efficiency of 3
-hydroxylation of
potential GA substrates by cell lysates from E. coli expressing GA4
Products were identified by comparison of their mass spectra with
published data for unlabeled compounds (Gaskin and MacMillan, 1991
).

View larger version (23K):
[in a new window]
Figure 3.
Structures of potential substrates and products
arranged in their proposed biosynthetic relationship.
-lactone.
The low level of hydroxylation of the open-lactone form of
GA15 may be due to some lactone formation during
incubation. In solution, GA24 is likely to exist
partially as a lactol between the C-20 aldehyde and the C-19 carboxylic
acid group and would therefore also mimic the C19-GA structure. Whereas the tricarboxylic acid
GA25 was not metabolized by GA4, its 19-20
anhydride (Fig. 3) was hydroxylated to give GA13.
The incubation was conducted with unlabeled GA25 anhydride and, therefore, it was not possible to determine the conversion efficiency accurately. However, on the basis of GC-MS on the
total extracted products, about 40% of the 1.4 nmol of substrate was
converted by 120 µL of cell lysate (140 µL total incubation volume)
in 1 h, indicating relatively efficient conversion. The expected
product, GA13 anhydride, would be converted to
GA13 on acidification of the incubation mixture
prior to extraction.
-hydroxylase. This requirement is in contrast to
that of a GA 2
,3
-dihydroxylase, which was recently cloned from
pumpkin endosperm and shown to utilize
C20-GAs, particularly GA25,
more effectively than C19-GAs (Lange et al., 1997
). The high substrate specificity of the Arabidopsis
3
-hydroxylase for bridged, non-13-hydroxylated
C20-GAs may account for the occurrence of the
3
-hydroxylated C20-GAs
GA37, GA36, and
GA13 in shoots of this species (Talon et al.,
1990
). The first two compounds would be formed by 3
-hydroxylation of
the relatively abundant intermediates GA15 and
GA24, whereas GA13 may be a
minor product of 20-oxidase activity on GA36. The
major product of this activity is likely to be
GA4.
-hydroxylase from immature seeds of Phaseolus vulgaris
(Kobayashi et al., 1991
) and contrasts the conversion of
GA5 to GA3 in seeds of
Marah macrocarpus, a reaction that is initiated by oxidation
at C-1 (Albone et al., 1990
). The 3
-hydroxylation of
GA9 and GA20 by GA4 is
regiospecific, with no indication of 2,3-desaturation or
2
-hydroxylation, as was found for the enzyme from P. vulgaris (Smith et al., 1990
).
1
IACR receives grant-aided support from the
Biotechnology and Biological Sciences Research Council of the United
Kingdom.
![]()
FOOTNOTES
2
Present address: Department of Medicine,
University of Bristol, Dorothy Crowfoot Hodgkin Laboratories, Bristol
Royal Infirmary, Marlborough St., Bristol BS2 8HW, UK.
*
Corresponding author; e-mail peter.hedden{at}bbsrc.ac.uk; fax
44-1275-394281.
![]()
ABBREVIATIONS
-thiogalactoside.
![]()
ACKNOWLEDGMENTS
![]()
LITERATURE CITED
Top
Abstract
Introduction
Methods
Results & Discussion
References
,3
-hydroxylase cDNA from pumpkin endosperm.
Plant Cell
9:
1459-1467
[Abstract]
-hydroxylase.
Plant Cell
9:
1435-1443
[Abstract]
-hydroxylase from seeds of Phaseolus vulgaris.
Plant Physiol
94:
1390-1401
Copyright Clearance Center: 0032-0889/98/117/0559/05
© 1998 American Society of Plant Physiologists
This article has been cited by other articles:
![]() |
J. Thiel, D. Weier, N. Sreenivasulu, M. Strickert, N. Weichert, M. Melzer, T. Czauderna, U. Wobus, H. Weber, and W. Weschke Different Hormonal Regulation of Cellular Differentiation and Function in Nucellar Projection and Endosperm Transfer Cells: A Microdissection-Based Transcriptome Study of Young Barley Grains Plant Physiology, November 1, 2008; 148(3): 1436 - 1452. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Kim, S. Yamaguchi, S. Lim, E. Oh, J. Park, A. Hanada, Y. Kamiya, and G. Choi SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 PLANT CELL, May 1, 2008; 20(5): 1260 - 1277. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hu, M. G. Mitchum, N. Barnaby, B. T. Ayele, M. Ogawa, E. Nam, W.-C. Lai, A. Hanada, J. M. Alonso, J. R. Ecker, et al. Potential Sites of Bioactive Gibberellin Production during Reproductive Growth in Arabidopsis PLANT CELL, February 1, 2008; 20(2): 320 - 336. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Matsushita, T. Furumoto, S. Ishida, and Y. Takahashi AGF1, an AT-Hook Protein, Is Necessary for the Negative Feedback of AtGA3ox1 Encoding GA 3-Oxidase Plant Physiology, March 1, 2007; 143(3): 1152 - 1162. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Benschop, J. Bou, A. J.M. Peeters, N. Wagemaker, K. Guhl, D. Ward, P. Hedden, T. Moritz, and L. A.C.J. Voesenek Long-Term Submergence-Induced Elongation in Rumex palustris Requires Abscisic Acid-Dependent Biosynthesis of Gibberellin1 Plant Physiology, August 1, 2006; 141(4): 1644 - 1652. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Reyes, D. Rodriguez, M. P. Gonzalez-Garcia, O. Lorenzo, G. Nicolas, J. L. Garcia-Martinez, and C. Nicolas Overexpression of a Protein Phosphatase 2C from Beech Seeds in Arabidopsis Shows Phenotypes Related to Abscisic Acid Responses and Gibberellin Biosynthesis Plant Physiology, August 1, 2006; 141(4): 1414 - 1424. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhao, J. C. Craig, H. E. Petzold, A. W. Dickerman, and E. P. Beers The Xylem and Phloem Transcriptomes from Secondary Tissues of the Arabidopsis Root-Hypocotyl Plant Physiology, June 1, 2005; 138(2): 803 - 818. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gomez-Mena, S. de Folter, M. M. R. Costa, G. C. Angenent, and R. Sablowski Transcriptional program controlled by the floral homeotic gene AGAMOUS during early organogenesis Development, February 1, 2005; 132(3): 429 - 438. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zhou, M. Yu, and R. P. Pharis 16,17-Dihydro Gibberellin A5 Competitively Inhibits a Recombinant Arabidopsis GA 3{beta}-Hydroxylase Encoded by the GA4 Gene Plant Physiology, June 1, 2004; 135(2): 1000 - 1007. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Israelsson, E. Mellerowicz, M. Chono, J. Gullberg, and T. Moritz Cloning and Overproduction of Gibberellin 3-Oxidase in Hybrid Aspen Trees. Effects on Gibberellin Homeostasis and Development Plant Physiology, May 1, 2004; 135(1): 221 - 230. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Tudzynski, M. Mihlan, M. C. Rojas, P. Linnemannstons, P. Gaskin, and P. Hedden Characterization of the Final Two Genes of the Gibberellin Biosynthesis Gene Cluster of Gibberella fujikuroi: des AND P450-3 ENCODE GA4 DESATURASE AND THE 13-HYDROXYLASE, RESPECTIVELY J. Biol. Chem., August 1, 2003; 278(31): 28635 - 28643. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-G. Kang, S.-H. Jun, J. Kim, H. Kawaide, Y. Kamiya, and G. An Cloning of Gibberellin 3{beta}-Hydroxylase cDNA and Analysis of Endogenous Gibberellins in the Developing Seeds in Watermelon Plant Cell Physiol., February 1, 2002; 43(2): 152 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Tudzynski, P. Hedden, E. Carrera, and P. Gaskin The P450-4 Gene of Gibberella fujikuroi Encodes ent-Kaurene Oxidase in the Gibberellin Biosynthesis Pathway Appl. Envir. Microbiol., August 1, 2001; 67(8): 3514 - 3522. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. D. Cassan, C. D. Lucangeli, R. Bottini, and P. N. Piccoli Azospirillum spp. metabolize [17,17-2H2]gibberellin A20 to [17,17-2H2]gibberellin A1 in vivo in dy rice mutant seedlings Plant Cell Physiol., July 1, 2001; 42(7): 763 - 767. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hedden and W. M. Proebsting Genetic Analysis of Gibberellin Biosynthesis Plant Physiology, February 1, 1999; 119(2): 365 - 370. [Full Text] |
||||
![]() |
S. Yamaguchi, M. W. Smith, R. G. S. Brown, Y. Kamiya, and T.-p. Sun Phytochrome Regulation and Differential Expression of Gibberellin 3ß-Hydroxylase Genes in Germinating Arabidopsis Seeds PLANT CELL, December 1, 1998; 10(12): 2115 - 2126. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|