Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (36)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Williams, J.
Right arrow Articles by Hedden, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Williams, J.
Right arrow Articles by Hedden, P.
Agricola
Right arrow Articles by Williams, J.
Right arrow Articles by Hedden, P.

Plant Physiol. (1998) 117: 559-563

Function and Substrate Specificity of the Gibberellin 3beta -Hydroxylase Encoded by the Arabidopsis GA4 Gene1

Jacqueline Williams2, Andy L. Phillips, Paul Gaskin, and Peter Hedden*

IACR-Long Ashton Research Station, Department of Agricultural Sciences, University of Bristol, Long Ashton, Bristol BS41 9AF, United Kingdom

    ABSTRACT
Top
Abstract
Introduction
Methods
Results & Discussion
References

cDNA corresponding to the GA4 gene of Arabidopsis thaliana L. (Heynh.) was expressed in Escherichia coli, from which cell lysates converted [14C]gibberellin (GA)9 and [14C]GA20 to radiolabeled GA4 and GA1, respectively, thereby confirming that GA4 encodes a GA 3beta -hydroxylase. GA9 was the preferred substrate, with a Michaelis value of 1 µM compared with 15 µM for GA20. Hydroxylation of these GAs was regiospecific, with no indication of 2beta -hydroxylation or 2,3-desaturation. The capacity of the recombinant enzyme to hydroxylate a range of other GA substrates was investigated. In general, the preferred substrates contained a polar bridge between C-4 and C-10, and 13-deoxy GAs were preferred to their 13-hydroxylated analogs. Therefore, no activity was detected using GA12-aldehyde, GA12, GA19, GA25, GA53, or GA44 as the open lactone (20-hydroxy-GA53), whereas GA15, GA24, and GA44 were hydroxylated to GA37, GA36, and GA38, respectively. The open lactone of GA15 (20-hydroxy-GA12) was hydroxylated but less efficiently than GA15. In contrast to the free acid, GA25 19,20-anhydride was 3beta -hydroxylated to give GA13. 2,3-Didehydro-GA9 and GA5 were converted by recombinant GA4 to the corresponding epoxides 2,3-oxido-GA9 and GA6.

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results & Discussion
References

Dwarf mutants with reduced biosynthesis of the GA plant hormones have been valuable tools in studies of the function of these compounds (Ross, 1994). In Arabidopsis thaliana, mutations at six loci (GA1-GA6) that result in reduced GA biosynthesis have been identified (Koorneef and van der Veen, 1980; Sponsel et al., 1997), and three of these loci have recently been cloned. The GA1 locus was isolated by genomic subtraction (Sun et al., 1992) and shown by heterologous expression in Escherichia coli to encode the enzyme that cyclizes geranylgeranyl diphosphate to copalyl diphosphate (Sun and Kamiya, 1994). This enzyme was formerly referred to as ent-kaurene synthase A but has been renamed copalyl diphosphate synthase (Hedden and Kamiya, 1997; MacMillan, 1997). The GA5 locus was shown to correspond to one of the GA 20-oxidase genes (Xu et al., 1995), the products of which catalyze the conversion of GA12 to GA9 and GA53 to GA20 (Phillips et al., 1995; Xu et al., 1995). GA 20-oxidases are 2-oxoglutarate-dependent dioxygenases that are encoded by small multigene families, members of which are differentially expressed in plant tissues (Phillips et al., 1995; Garcia-Martinez et al., 1997).

The GA4 locus was isolated by T-DNA tagging and, on the basis of the derived amino acid sequence, was also shown to encode a dioxygenase (Chiang et al., 1995). Several lines of evidence indicate that the GA4 gene encodes a GA 3beta -hydroxylase. Shoots of a ga4 mutant, all alleles of which are semidwarf, contained reduced concentrations of the 3beta -hydroxy GAs GA1, GA4, and GA8 compared with the Landsberg erecta wild type, whereas levels of immediate precursors to these GAs were elevated (Talon et al., 1990). Furthermore, metabolism of [13C]GA20 to [13C]GA1 was substantially less in the mutant than in the wild type (Kobayashi et al., 1994). In the present paper we confirm by functional expression of its cDNA in E. coli that GA4 encodes a GA 3beta -hydroxylase. In addition, we determine the substrate specificity of recombinant GA4 using a number of C20- and C19-GAs and show by kinetic analysis that the enzyme has a higher affinity for GA9 than for GA20, which is consistent with the non-13-hydroxylation pathway predominating in Arabidopsis (Talon et al., 1990).

    MATERIALS AND METHODS
Top
Abstract
Introduction
Methods
Results & Discussion
References

Expression of GA4 in Escherichia coli

The coding region of GA4 was amplified by reverse transcription-PCR from mRNA extracted from floral apices of the ga1-2 mutant of Arabidopsis thaliana (L.) Heynh. as described previously (Phillips et al., 1995) using oligonucleotide primers with NcoI and BamHI sites: forward primer, CAACCATGGCTGCTATGTTAACAGA; reverse primer, CAAGGATCCTCATTCTTCTCTGTGATTT.

The cloned PCR product was transferred into pET3d and pET9d E. coli expression vectors (Pharmacia). Although the expression products contained 3beta -hydroxylase activity, sequencing of the PCR product identified a point mutation, resulting in a change of amino acid within the coding region. To prepare expression constructs with the correct sequence (Chiang et al., 1997), a SacI-BamHI fragment containing the mutation was replaced in both vectors with the corresponding fragment from the GA4 cDNA clone pCD7 (Chiang et al., 1995). Cultures (50 mL) of E. coli BL21 transformed with the recombinant plasmids were grown with shaking at 37°C in 2× YT broth (1.6% [w/v] bactotryptone, 1% [w/v] yeast extract, and 0.5% [w/v] NaCl) containing 200 µg L-1 carbenicillin (pET3d) or 100 µg mL-1 kanamycin (pET9d). At the mid-logarithmic stage, cultures were transferred to 30°C and shaken for 30 min, after which expression was induced by the addition of IPTG (final concentration, 5 mM). At the same time, more antibiotics were added (400 µg mL-1 carbenicillin or 200 µg mL-1 kanamycin). Cultures were grown for another 3 h at 30°C and then placed on ice for 10 min, and cells were harvested by centrifugation at 5000 rpm at 4°C for 5 min. Pellets were resuspended in 25 mL of 100 mM Tris-HCl, pH 7.1, at 25°C containing 4 mM DTT, and recentrifuged as described above. Pellets were then resuspended in the same buffer (2 mL) containing lysozyme at 1 mg/mL, incubated at 30°C with shaking for 15 min, and, after cooling on ice, sonicated (three 5-s pulses). After centrifugation of the lysates at 12,000g for 15 min at 4°C, the supernatants were frozen in liquid N2 and stored at -80°C.

Analysis of Expressed Protein by SDS-PAGE

Proteins from cultures induced with IPTG, described above, were analyzed by SDS-PAGE. For comparison, proteins were analyzed from cells grown under the same conditions but without the addition of IPTG. Induced cells contained typically 0.5 to 1.0 mg protein mL-1 culture, whereas noninduced cells contained approximately 30% of the protein concentration present in induced cells. Soluble and insoluble protein fractions were obtained after lysis of cells (1 mL) using lysozyme, as described above. After the sample was centrifuged, the supernatant and resuspended pellet, in 100 mM Tris-HCl buffer, pH 7.5 (0.1 mL), were diluted 1:1 with loading buffer. Equal quantities of protein for each sample were loaded onto the gel.

Enzyme Assays with Recombinant Protein

Provision of Substrates

[17-14C]GA9 (specific radioactivity 2.10 TBq mol-1) and [17-13C,3H]GA5 (1.51 TBq mol-1) were gifts from Dr I. Yamaguchi (University of Tokyo) and Prof. J. MacMillan (Long Ashton Research Station), respectively. [17-14C]GA24 (1.72 TBq mol-1) and [17-14C]GA19 (1.72 TBq mol-1) were obtained from Prof. L.N. Mander (Australian National University, Canberra). 2,3-Didehydro[17-14C]GA9 (1.75 TBq mol-1) and [17-14C]GA20 (1.84 TBq mol-1) were synthesized as described by MacMillan et al. (1997). [1,7,12,18-14C4]GA12 (5.74 TBq mol-1), -GA12-aldehyde (6.90 TBq mol-1), and -GA15 (6.32 TBq mol-1) were prepared from R-[2-14C]mevalonic acid using a cell-free system from pumpkin endosperm, as described by Graebe et al. (1974). [1,7,12,18-14C4]GA53 (5.59 TBq mol-1) and [17-14C]GA44 (1.42 TBq mol-1) were prepared from [14C4]GA12 and [14C1]GA12, respectively, using a homogenate of developing pea cotyledons (Kamiya and Graebe, 1983). [14C4]GA25 (6.83 TBq mol-1) was prepared from [14C4]GA12 using a partially purified GA 20-oxidase from pumpkin endosperm (Lange et al., 1994). The open-lactone forms of GA15 and GA44 were prepared by heating the lactones in 0.5 M KOH at 90°C for 1 h in a sealed vial. An appropriate volume (3-5 µL) of the hydrolysate was then added directly to the incubation mixture.

Enzyme Assays

For incubations with different substrates, cell lysates (5 or 50 µL) were incubated for 1 h at 30°C with the substrate, which was added in 5 µL of methanol in the presence of 100 mM Tris-HCl, pH 7.5, and a cofactor mixture (5 µL, containing 80 mM 2-oxoglutarate, 80 mM ascorbate, 80 mM DTT, 10 mM FeSO4, 40 mg mL-1 BSA, and 20 mg mL-1 catalase in 100 mM Tris-HCl, pH 7.5) in a total volume of 0.1 mL. After the addition of acetic acid (10 µL) and water (140 µL), the incubation mixture was centrifuged at 3000 rpm for 10 min and then analyzed directly by HPLC with on-line radiomonitoring (MacMillan et al., 1997). Product identities were determined by full-scan GC-MS of methyl ester-trimethylsilyl ether derivatives by comparison with published data (Gaskin and MacMillan, 1991).

For kinetic studies [14C]GA9 added in 5 µL of methanol was incubated for 15 min at 30°C at different concentrations in the presence of cell lysate (equivalent to 0.22 µL containing 2 µg of protein) and 10 µL of the cofactor mixture in a total volume of 0.2 mL. [14C]GA20 was incubated with cell lysate (equivalent to 0.55 µL containing 5 µg of protein) under the same conditions except that 2.5 µL of the cofactor mixture was used and the total volume was 50 µL. The dependence of the GA-hydroxylation rate (determined by HPLC with on-line radiomonitoring as described above) on GA concentration was established by nonlinear regression analysis using Enzfitter (Elsevier, Cambridge, UK).

    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Methods
Results & Discussion
References

Heterologous Expression of GA4 in E. coli

GA4 cDNA was inserted into pET3d and pET9d vectors, and expression was induced in E. coli with 5 mM IPTG. Cell lysates from cultures of bacteria containing either expression construct metabolized [14C]GA9 to [14C]GA4, and [14C]GA20 to [14C]GA1, with higher activity obtained with pET3d (Fig. 1). Lysates from bacteria containing vector with no insert did not metabolize either substrate (data not shown). Therefore, it is confirmed that GA4 encodes a GA 3beta -hydroxylase. The LE gene of pea has now also been cloned and, after expression in E. coli, shown to encode a GA 3beta -hydroxylase with 54% amino acid identity to the corrected (Chiang et al., 1997) GA4 sequence (Lester et al., 1997; Martin et al., 1997). Separation of proteins from total cell extracts of both E. coli cultures by SDS-PAGE revealed a band of the anticipated size (Mr approximately 40,000). Although this band was more intense in extracts from cells containing the pET9d construct, virtually all of the protein was present in the insoluble fraction in this case and was presumably present in inclusion bodies. Therefore, the pET3d vector was used to produce active protein for characterization of enzyme activity.


View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. HPLC-radiochromatograms from incubations of [14C]GA9 and [14C]GA20 with cell lysates of E. coli expressing GA4 in pET3d or pET9d. The equivalent of 0.05 or 0.12 µL of lysate was incubated in 100 µL total volume with GA9 or GA20, respectively, plus the necessary cofactors.

Characteristics of Recombinant GA4

[14C]GA9 and [14C]GA20 were compared as the substrates for recombinant GA4 in cell lysates. Plots of reaction rate against substrate concentration, produced by nonlinear regression analysis (Fig. 2), yielded Km values of 1.0 µM (Vmax 6.8 pmol min-1 mg-1) and 15 µM (Vmax 2.8 pmol min-1 mg-1) for GA9 and GA20, respectively. The preference for GA9 as a substrate is consistent with the predominance of non-13-hydroxylated GAs in Arabidopsis; the major C19-GA identified from entire shoots is GA4 (Talon et al., 1990). Furthermore, the Arabidopsis GA 20-oxidases convert non-13-hydroxylated substrates, e.g. GA12, more effectively than their 13-hydroxylated equivalents, e.g. GA53 (Phillips et al., 1995). Therefore, the preferred biosynthetic pathway in Arabidopsis appears to involve conversion of GA12 to GA9, which is then 3beta -hydroxylated to GA4. The Km values are very similar to those determined recently for the GA 3beta -hydroxylase from pea, obtained by expression of the LE cDNA in E. coli (Martin et al., 1997). In pea shoots, which produce mainly 13-hydroxylated GAs, the preference of the enzyme for GA9 was unexpected.


View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. Michaelis-Menten and Lineweaver-Burk (inset) plots for the 3beta -hydroxylation of GA9 to GA4 (bullet ) and of GA20 to GA1 (open circle ) by cell lysates from recombinant E. coli expressing GA4 in pET3d.

The substrate specificity of GA4 was further tested by incubating cell lysate with a number of nonhydroxylated and 13-hydroxylated C19- and C20-GAs at similar concentrations (1.8 µM; Table I); products, when formed, were identified by full-scan GC-MS. The structures of the tested potential substrates and products are shown in Figure 3, where they are arranged in their proposed biosynthetic relationship. In most cases the substrates were labeled with 14C, enabling their degree of conversion to be quantified by radiomonitoring after HPLC. Therefore, their relative effectiveness as substrates could be readily compared. To compare the broad range of hydroxylation efficiencies encountered with these substrates, incubations were performed with both 5- and 50-µL cell lysate volumes, when appropriate. In general, C19-GAs were much better substrates than C20-GAs, and the presence of a 13-hydroxy group reduced the efficiency of conversion. No conversion was observed with GA12-aldehyde, GA12, GA53, GA19, or GA25, whereas GA15, GA44, and GA24 were hydroxylated to GA37, GA38, and GA36, respectively. GA15, as the lactone, was hydroxylated almost as efficiently as GA20. In contrast, the open-lactone forms of GA15 and GA44 were poor substrates.

 
View this table:
[in this window] [in a new window]
 
Table I. Efficiency of 3beta -hydroxylation of potential GA substrates by cell lysates from E. coli expressing GA4

Products were identified by comparison of their mass spectra with published data for unlabeled compounds (Gaskin and MacMillan, 1991).


View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Structures of potential substrates and products arranged in their proposed biosynthetic relationship.

It seems likely that these GAs in the lactone form mimic the C19-GA substrates, which contain a gamma -lactone. The low level of hydroxylation of the open-lactone form of GA15 may be due to some lactone formation during incubation. In solution, GA24 is likely to exist partially as a lactol between the C-20 aldehyde and the C-19 carboxylic acid group and would therefore also mimic the C19-GA structure. Whereas the tricarboxylic acid GA25 was not metabolized by GA4, its 19-20 anhydride (Fig. 3) was hydroxylated to give GA13. The incubation was conducted with unlabeled GA25 anhydride and, therefore, it was not possible to determine the conversion efficiency accurately. However, on the basis of GC-MS on the total extracted products, about 40% of the 1.4 nmol of substrate was converted by 120 µL of cell lysate (140 µL total incubation volume) in 1 h, indicating relatively efficient conversion. The expected product, GA13 anhydride, would be converted to GA13 on acidification of the incubation mixture prior to extraction.

These results indicate that a presumably polar bridge between C atoms 4 and 10 (lactone, lactol, or anhydride) is necessary for substrate binding to the 3beta -hydroxylase. This requirement is in contrast to that of a GA 2beta ,3beta -dihydroxylase, which was recently cloned from pumpkin endosperm and shown to utilize C20-GAs, particularly GA25, more effectively than C19-GAs (Lange et al., 1997). The high substrate specificity of the Arabidopsis 3beta -hydroxylase for bridged, non-13-hydroxylated C20-GAs may account for the occurrence of the 3beta -hydroxylated C20-GAs GA37, GA36, and GA13 in shoots of this species (Talon et al., 1990). The first two compounds would be formed by 3beta -hydroxylation of the relatively abundant intermediates GA15 and GA24, whereas GA13 may be a minor product of 20-oxidase activity on GA36. The major product of this activity is likely to be GA4.

The 2,3-didehydro-GAs GA5 and 2,3-didehydroGA9 were converted by GA4 to the corresponding epoxides, GA6 and 2,3-oxidoGA9, but these conversions were less efficient than those of their saturated analogs, GA20 and GA9. Epoxidation of GA5 has also been observed with a GA 3beta -hydroxylase from immature seeds of Phaseolus vulgaris (Kobayashi et al., 1991) and contrasts the conversion of GA5 to GA3 in seeds of Marah macrocarpus, a reaction that is initiated by oxidation at C-1 (Albone et al., 1990). The 3beta -hydroxylation of GA9 and GA20 by GA4 is regiospecific, with no indication of 2,3-desaturation or 2beta -hydroxylation, as was found for the enzyme from P. vulgaris (Smith et al., 1990).

    FOOTNOTES
1   IACR receives grant-aided support from the Biotechnology and Biological Sciences Research Council of the United Kingdom.
2   Present address: Department of Medicine, University of Bristol, Dorothy Crowfoot Hodgkin Laboratories, Bristol Royal Infirmary, Marlborough St., Bristol BS2 8HW, UK.
*   Corresponding author; e-mail peter.hedden{at}bbsrc.ac.uk; fax 44-1275-394281.

   Received November 26, 1997; accepted March 11, 1998.

    ABBREVIATIONS

Abbreviation: IPTG, isopropyl-beta -thiogalactoside.

    ACKNOWLEDGMENTS

We thank Dr. I. Yamaguchi (University of Tokyo), Professor J. MacMillan (IACR-Long Ashton Research Station), and Professor L.N. Mander (Australian National University, Canberra), for gifts of radiolabeled GAs, and Dr. C.L. Willis (School of Chemistry, University of Bristol, UK) for providing the GA25 anhydride.

    LITERATURE  CITED
Top
Abstract
Introduction
Methods
Results & Discussion
References

Albone KS, Gaskin P, MacMillan J, Phinney BO, Willis CL (1990) Biosynthetic origin of gibberellins A3 and A7 in cell-free preparations from seeds of Marah macrocarpus and Malus domestica. Plant Physiol 94: 132-142 [Abstract/Free Full Text]

Chiang H-H, Hwang I, Goodman HM (1995) Isolation of the Arabidopsis GA4 locus. Plant Cell 7: 195-201 [Abstract]

Chiang H-H, Hwang I, Goodman HM (1997) Correction to: Isolation of the Arabidopsis GA4 locus (Plant Cell 7: 195-201). Plant Cell 9: 979-980

García-Martínez JL, López-Diaz I, Sánchez-Beltrán MJ, Phillips AL, Ward DA, Gaskin P, Hedden P (1997) Isolation and transcript analysis of gibberellin 20-oxidase genes in pea and bean in relation to fruit development. Plant Mol Biol 33: 1073-1084 [CrossRef][Web of Science][Medline]

Gaskin P, MacMillan J (1991) GC-MS of the Gibberellins and Related Compounds: Methodology and a Library of Spectra. Cantock's Enterprises, Bristol, UK

Graebe JE, Hedden P, Gaskin P, MacMillan J (1974) Biosynthesis of gibberellins Al2, Al5, A24, A36 and A37 by a cell-free system from Cucurbita maxima. Phytochemistry 13: 1433-1440 [CrossRef]

Hedden P, Kamiya Y (1997) Gibberellin biosynthesis: enzymes, genes and their regulation. Annu Rev Plant Physiol Plant Mol Biol 48: 431-460 [CrossRef][Web of Science]

Kamiya Y, Graebe JE (1983) The biosynthesis of all major pea gibberellins in a cell-free system from Pisum sativum L. Phytochemistry 22: 681-689 [CrossRef]

Kobayashi M, Gaskin P, Spray CR, Phinney BO, MacMillan J (1994) The metabolism of gibberellin A20 to gibberellin A1 by tall and dwarf mutants of Oryza sativa and Arabidopsis thaliana. Plant Physiol 106: 1367-1372 [Abstract]

Kobayashi M, Kwak S-S, Kamiya Y, Yamane H, Takahashi N, Sakurai A (1991) Conversion of GA5 to GA6 and GA3 in cell-free systems from Phaseolus vulgaris and Oryza sativa. Agric Biol Chem 55: 249-251

Koornneef M, van der Veen JH (1980) Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) Heynh. Theor Appl Genet 58: 257-263 [CrossRef][Web of Science]

Lange T, Robatzek S, Frisse A (1997) Cloning and expression of a gibberellin 2beta ,3beta -hydroxylase cDNA from pumpkin endosperm. Plant Cell 9: 1459-1467 [Abstract]

Lange T, Schweimer A, Ward DA, Hedden P, Graebe JE (1994) Separation and characterization of three 2-oxoglutarate-dependent dioxygenases from Cucurbita maxima L. endosperm involved in gibberellin biosynthesis. Planta 195: 98-107

Lester DR, Ross JJ, Davies PJ, Reid JB (1997) Mendel's stem length gene (Le) encodes a gibberellin 3beta -hydroxylase. Plant Cell 9: 1435-1443 [Abstract]

MacMillan J (1997) Biosynthesis of the gibberellin plant hormones. Nat Prod Rep 14: 221-243 [CrossRef]

MacMillan J, Ward DA, Phillips AL, Sánchez-Beltrán MJ, Gaskin P, Lange T, Hedden P (1997) Gibberellin biosynthesis from gibberellin A12-aldehyde in endosperm and embryos of Marah macrocarpus. Plant Physiol 113: 1369-1377 [Abstract]

Martin DN, Proebsting WM, Hedden P (1997) Mendel's dwarfing gene: cDNAs from the Le alleles and the function of the expressed proteins. Proc Natl Acad Sci USA 94: 8907-8911 [Abstract/Free Full Text]

Phillips AL, Ward DA, Uknes S, Appleford NEJ, Lange T, Huttly AK, Gaskin P, Graebe JE, Hedden P (1995) Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis. Plant Physiol 108: 1049-1057 [Abstract]

Ross JJ (1994) Recent advances in the study of gibberellin mutants. Plant Growth Regul 15: 193-206

Smith VA, Gaskin P, MacMillan J (1990) Partial purification and characterization of the gibberellin A20 3beta -hydroxylase from seeds of Phaseolus vulgaris. Plant Physiol 94: 1390-1401 [Abstract/Free Full Text]

Sponsel VM, Schmidt FW, Porter SG, Nakayama M, Kohlstruk S, Estelle M (1997) Characterization of new gibberellin-responsive semidwarf mutants of Arabidopsis. Plant Physiol 115: 1009-1020 [Abstract]

Sun TP, Goodman HM, Ausubel FM (1992) Cloning the Arabidopsis GA1 locus by genomic subtraction. Plant Cell 4: 119-128 [Abstract/Free Full Text]

Sun TP, Kamiya Y (1994) The Arabidopsis GA1 locus encodes the cyclase ent-kaurene synthetase A of gibberellin biosynthesis. Plant Cell 6: 1509-1518 [Abstract]

Talon M, Koornneef M, Zeevaart JAD (1990) Endogenous gibberellins in Arabidopsis thaliana and possible steps blocked in the biosynthetic pathways of the semidwarf ga4 and ga5 mutants. Proc Natl Acad Sci USA 87: 7983-7987 [Abstract/Free Full Text]

Xu YL, Li L, Wu K, Peeters AJM, Gage D, Zeevaart JAD (1995) The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression. Proc Natl Acad Sci USA 92: 6640-6644 [Abstract/Free Full Text]


Copyright Clearance Center:   0032-0889/98/117/0559/05
 
© 1998 American Society of Plant Physiologists



This article has been cited by other articles:


Home page
Plant Physiol.Home page
J. Thiel, D. Weier, N. Sreenivasulu, M. Strickert, N. Weichert, M. Melzer, T. Czauderna, U. Wobus, H. Weber, and W. Weschke
Different Hormonal Regulation of Cellular Differentiation and Function in Nucellar Projection and Endosperm Transfer Cells: A Microdissection-Based Transcriptome Study of Young Barley Grains
Plant Physiology, November 1, 2008; 148(3): 1436 - 1452.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
D. H. Kim, S. Yamaguchi, S. Lim, E. Oh, J. Park, A. Hanada, Y. Kamiya, and G. Choi
SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5
PLANT CELL, May 1, 2008; 20(5): 1260 - 1277.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
J. Hu, M. G. Mitchum, N. Barnaby, B. T. Ayele, M. Ogawa, E. Nam, W.-C. Lai, A. Hanada, J. M. Alonso, J. R. Ecker, et al.
Potential Sites of Bioactive Gibberellin Production during Reproductive Growth in Arabidopsis
PLANT CELL, February 1, 2008; 20(2): 320 - 336.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Matsushita, T. Furumoto, S. Ishida, and Y. Takahashi
AGF1, an AT-Hook Protein, Is Necessary for the Negative Feedback of AtGA3ox1 Encoding GA 3-Oxidase
Plant Physiology, March 1, 2007; 143(3): 1152 - 1162.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
J. J. Benschop, J. Bou, A. J.M. Peeters, N. Wagemaker, K. Guhl, D. Ward, P. Hedden, T. Moritz, and L. A.C.J. Voesenek
Long-Term Submergence-Induced Elongation in Rumex palustris Requires Abscisic Acid-Dependent Biosynthesis of Gibberellin1
Plant Physiology, August 1, 2006; 141(4): 1644 - 1652.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
D. Reyes, D. Rodriguez, M. P. Gonzalez-Garcia, O. Lorenzo, G. Nicolas, J. L. Garcia-Martinez, and C. Nicolas
Overexpression of a Protein Phosphatase 2C from Beech Seeds in Arabidopsis Shows Phenotypes Related to Abscisic Acid Responses and Gibberellin Biosynthesis
Plant Physiology, August 1, 2006; 141(4): 1414 - 1424.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
C. Zhao, J. C. Craig, H. E. Petzold, A. W. Dickerman, and E. P. Beers
The Xylem and Phloem Transcriptomes from Secondary Tissues of the Arabidopsis Root-Hypocotyl
Plant Physiology, June 1, 2005; 138(2): 803 - 818.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
C. Gomez-Mena, S. de Folter, M. M. R. Costa, G. C. Angenent, and R. Sablowski
Transcriptional program controlled by the floral homeotic gene AGAMOUS during early organogenesis
Development, February 1, 2005; 132(3): 429 - 438.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
R. Zhou, M. Yu, and R. P. Pharis
16,17-Dihydro Gibberellin A5 Competitively Inhibits a Recombinant Arabidopsis GA 3{beta}-Hydroxylase Encoded by the GA4 Gene
Plant Physiology, June 1, 2004; 135(2): 1000 - 1007.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. Israelsson, E. Mellerowicz, M. Chono, J. Gullberg, and T. Moritz
Cloning and Overproduction of Gibberellin 3-Oxidase in Hybrid Aspen Trees. Effects on Gibberellin Homeostasis and Development
Plant Physiology, May 1, 2004; 135(1): 221 - 230.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Tudzynski, M. Mihlan, M. C. Rojas, P. Linnemannstons, P. Gaskin, and P. Hedden
Characterization of the Final Two Genes of the Gibberellin Biosynthesis Gene Cluster of Gibberella fujikuroi: des AND P450-3 ENCODE GA4 DESATURASE AND THE 13-HYDROXYLASE, RESPECTIVELY
J. Biol. Chem., August 1, 2003; 278(31): 28635 - 28643.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
H.-G. Kang, S.-H. Jun, J. Kim, H. Kawaide, Y. Kamiya, and G. An
Cloning of Gibberellin 3{beta}-Hydroxylase cDNA and Analysis of Endogenous Gibberellins in the Developing Seeds in Watermelon
Plant Cell Physiol., February 1, 2002; 43(2): 152 - 158.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
B. Tudzynski, P. Hedden, E. Carrera, and P. Gaskin
The P450-4 Gene of Gibberella fujikuroi Encodes ent-Kaurene Oxidase in the Gibberellin Biosynthesis Pathway
Appl. Envir. Microbiol., August 1, 2001; 67(8): 3514 - 3522.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
F. D. Cassan, C. D. Lucangeli, R. Bottini, and P. N. Piccoli
Azospirillum spp. metabolize [17,17-2H2]gibberellin A20 to [17,17-2H2]gibberellin A1 in vivo in dy rice mutant seedlings
Plant Cell Physiol., July 1, 2001; 42(7): 763 - 767.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
P. Hedden and W. M. Proebsting
Genetic Analysis of Gibberellin Biosynthesis
Plant Physiology, February 1, 1999; 119(2): 365 - 370.
[Full Text]


Home page
Plant CellHome page
S. Yamaguchi, M. W. Smith, R. G. S. Brown, Y. Kamiya, and T.-p. Sun
Phytochrome Regulation and Differential Expression of Gibberellin 3ß-Hydroxylase Genes in Germinating Arabidopsis Seeds
PLANT CELL, December 1, 1998; 10(12): 2115 - 2126.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (36)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Williams, J.
Right arrow Articles by Hedden, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Williams, J.
Right arrow Articles by Hedden, P.
Agricola
Right arrow Articles by Williams, J.
Right arrow Articles by Hedden, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 1998 by the American Society of Plant Biologists