|
Plant Physiol. (1998) 117: 821-829
Analysis of Promoter Activity for the Gene Encoding Pyruvate
Orthophosphate Dikinase in Stably Transformed
C4
Flaveria Species1
Elke Rosche2,
Julie Chitty,
Peter Westhoff, and
William
C. Taylor*
Cooperative Research Centre for Plant Science, G.P.O. Box 475, Canberra 2601, Australia (E.R., W.C.T.); Commonwealth Scientific and
Industrial Research Organisation Plant Industry, G.P.O. Box 1600, Canberra 2601, Australia (J.C., W.C.T.); and Institut für
Entwicklungs und Molekularbiologie der Pflanzen, Heinrich-Heine
Universität Düsseldorf, D-40225 Düsseldorf, Germany
(P.W.)
 |
ABSTRACT |
The
C4 enzyme pyruvate orthophosphate dikinase is encoded by a
single gene, Pdk, in the C4 plant
Flaveria trinervia. This gene also encodes enzyme
isoforms located in the chloroplast and in the cytosol that do not have
a function in C4 photosynthesis. Our goal is to identify
cis-acting DNA sequences that regulate the expression of
the gene that is active in the C4 cycle. We fused 1.5 kb of
a 5 flanking region from the Pdk gene, including the
entire 5 untranslated region, to the uidA reporter gene
and stably transformed the closely related C4 species
Flaveria bidentis.  -Glucuronidase (GUS) activity was
detected at high levels in leaf mesophyll cells. GUS activity was
detected at lower levels in bundle-sheath cells and stems and at very
low levels in roots. This lower-level GUS expression was similar to the
distribution of mRNA encoding the nonphotosynthetic form of the enzyme.
We conclude that cis-acting DNA sequences controlling
the expression of the C4 form in mesophyll cells and the
chloroplast form in other cells and organs are co-located within the
same 5 region of the Pdk gene.
| |
INTRODUCTION |
PPDK (EC 2.7.9.1) is active in the mesophyll chloroplasts of
C4 plants, where it converts pyruvate to PEP, the
primary CO2 acceptor (Edwards and Walker, 1983 ;
Hatch, 1987). It has, like the other enzymes of the
C4 cycle, evolved from an ancestral
C3 form (Moore, 1982). Although the function of
PPDK in C3 tissues is not evident yet, it has
been suggested that it might be involved in the conversion of the
C3 and C4 compounds of
amino acids (Aoyagi and Bassham, 1985). Low levels of PPDK have been
found in various C3 plants as both chloroplastic
and cytoplasmic isoenzymes (Meyer et al., 1982; Aoyagi and Bassham,
1983, 1984a, 1984b; Hata and Matsuoka, 1987). The presence of PPDK in
C3 plants and the high similarities of the
proteins of C3 and C4
plants (about 80% amino acid sequence identity; Matsuoka et al., 1988;
Rosche and Westhoff, 1990; Rosche et al., 1994), as well as bacteria
(about 53% amino acid identity with the plant enzymes; Pocalyko et
al., 1990; Bruchhaus and Tannich, 1993), suggest a housekeeping
function for the ancestral form. The presence of low levels of mRNA
encoding PPDK in nonphotosynthetic organs of C4
plants (Glackin and Grula, 1990; Matsuoka, 1990; Sheen, 1991; Rosche
and Westhoff, 1995) suggests that a housekeeping form may perform a
similar function in these plants. The gene coding for the
C4 form could have arisen by a gene-duplication mechanism that left the original gene coding for the housekeeping form.
However, the genes coding for PPDK do not fit in this simple evolutionary scenario (Matsuoka, 1995).
Maize has two Pdk genes, one of which encodes a cytoplasmic
isoform that is expressed at low levels in all tissues (Sheen, 1991). A
second gene encodes both chloroplastic and cytoplasmic forms. A large
intron separates the exon encoding the chloroplast transit sequence
from the exons encoding the mature polypeptide. An abundant, long
transcript encoding the C4 form contains both transit and mature coding regions and is found preferentially in MC. A
second transcript containing only the coding region for the mature
polypeptide arises from the same gene and was detected in roots at a
low level (Hudspeth et al., 1986; Glackin and Grula, 1990).
The genus Flaveria has species with C3
photosynthesis and C4 photosynthesis and those
showing intermediate characteristics (Powell, 1978), making it
particularly useful for gene comparisons. Rosche et al. (1994) detected
only a single Pdk gene in all Flaveria species
tested, regardless of the photosynthetic type. The
C4 gene is very similar in structure to the
dual-function maize gene and shows a similar expression pattern. In the
C4 species Flaveria trinervia
transcription of the entire gene produces a 3.4-kb mRNA, the expression
of which is positively light regulated (Rosche and Westhoff, 1995). The
3.4-kb mRNA and the mature protein are found predominantly, but not
exclusively, in MC (Höfer et al., 1992; Rosche and Westhoff,
1995). A shorter transcript of 3.0 kb that codes only for the mature
polypeptide was detected at low levels in roots and in darkened stems
of F. trinervia (Rosche and Westhoff, 1995). The 3.4-kb mRNA
was detected in leaves of C3 and
C3-C4 intermediate species
of Flaveria, its level showing a correlation with the degree
of C4 characteristics in the intermediate species
(Rosche et al., 1994).
Therefore, the single Flaveria Pdk gene encodes PPDKs
of different function, location, and abundance. The
C4 isoform appears to have arisen from a gene
encoding a nonphotosynthetic form by the addition of new
cis-acting regulatory sequences while preserving the ancestral gene regulatory sequences. We have begun to
localize these regulatory sequences by fusing 1.5 kb of the 5 end of
the F. trinervia (C4 species) to the
uidA reporter gene. This has been stably transformed into
the genome of Flaveria bidentis, a closely related species
also showing full development of C4 characteristics. By measuring GUS activities in transgenic plants we
can determine whether sequences controlling the expression of the
C4 form of PPDK are located within 1.5 kb of the
upstream region of the gene.
| |
MATERIALS AND METHODS |
Flaveria bidentis plants were grown in a growth chamber
with a light/dark cycle of 14/10 h and temperatures of 28/16°C. The light intensity reached about 300 µE m 2
s1. The plants were watered twice a day and
supplied with nutrients every 2nd d. Mature plants used for
reillumination experiments were darkened under the same temperature
conditions and reilluminated in the same chamber as the light-grown
control plants.
Cloning of the uidA Fusion Construct
The 2.8-kb XbaI fragment of the genomic clone in
lnFtrpdkA-F containing 1.2 kb of the 5 untranscribed region of the
single Pdk gene of Flaveria trinervia (Rosche and
Westhoff, 1995; EMBL accession no. X79095) was used for the reporter
gene fusion. The 1257-bp XbaI/ClaI fragment was
ligated to a 237-bp PCR fragment extending from the ClaI
site to the amino terminal ATG of Pdk, where an artificial
NcoI site was created for ligation to the uidA
gene from pKIWI105 (Janssen and Gardner, 1989) with an ocs 3 end. Primers for the PCR reaction were CGTCTGATATGCCCGTAATCTAG (5)
and GCATCCATGGTTCTTCACCTGCTCAATTTCAC (3). The resulting plasmid was
linearized with HindIII and cloned into the binary vector
pGA470 (An, 1986).
Transformation
The transformation of F. bidentis was performed as
described by Chitty et al. (1994).
GUS Histochemistry
Histochemical staining of GUS activity was done by incubating
tissue sections in 1 mg mL1 5-bromo-4-chloro-3
indolyl -D-glucuronic acid, 0.1 M
Na2HPO4 buffer (pH 7.0), 0.5 mM
K3(Fe[CN]6), 0.5 mM
K4(Fe[CN]6), and 10 mM EDTA.
Analysis of Nucleic Acids
The preparation of RNA and genomic DNA and its analysis were
performed as described earlier (Rosche and Westhoff, 1995), except that
Hybond N+ (northern, Amersham) or Hybond N (genomic
Southern, Amersham) were used to blot the nucleic acids. Hybridizations
were carried out overnight at 64°C in 250 mM
Na2HPO4, 2.5 mM
EDTA, and 7% (w/v) SDS, pH 7.2 (Church and Gilbert, 1984). Washings
were done at hybridization temperature in 5, 2, 1, and 0.5× SSC and
0.1% SDS for 15 to 30 min each. The probes used for the hybridizations of the northern blots were PCR products of the uidA gene in
pKIWI105 (1.8 kb), the carboxy-terminal fragment of the PPDK cDNA of
F. trinervia (1.8 kb), and the actin gene of F. bidentis (446 bp). The genomic DNA was cut with HindIII
and the blot was probed with the BamHI/EcoRI
restriction fragment of pKIWI105 containing the entire uidA
gene (1.9 kb). Each T-DNA insert should give a unique band on the
Southern blot because one HindIII site will be in the
flanking plant DNA.
Separation of MC and BSC
BSC strands were separated from the MC by differential
homogenization steps and extensive washing of the BSC strands using a
modification of the method of Agostino et al. (1989). About 3 g of
leaf material was cut into 2-mm strips and homogenized for 10 s at
low speed (20% line voltage) in 70 mL of buffer A (0.3 M
sorbitol, 25 mM Hepes-KOH, pH 7.4, 10 mM DTT,
and 1 mM MgCl2) in an Omnimixer
(Sorvall). From this mixture 5 mL was taken as the WLC extract. An
additional 5 mL was filtered through a 20-µm net and the filtrate was
collected as the MC fraction. A second homogenization for 40 s at
full speed (100% line voltage) detached most of the remaining MC from
the BSC strands. The BSC strands were collected on a 20-µm net,
washed with 20 to 30 mL of buffer B (50 mM Hepes KOH, pH
7.0, 10 mM MgCl2, 0.5 mM
EDTA, 1% PVP-40, 5 mM DTT, 2 mM PMSF, and 2 mM  -aminocapronate), and resuspended in 5 mL of buffer
B. The remaining cells in each fraction were broken in a glass
homogenizer, aliquots were taken for chlorophyll and protein
quantitations, and BSA in a final concentration of 0.1% (w/v) was
added to the remaining samples before they were frozen in liquid
N2. The relative purity of each fraction was determined by measuring the activities of the marker enzymes PEPC (MC
specific) and ME (BSC specific) as described by Ashton et al. (1990).
GUS activity was measured in separated cell fractions using the
fluorometric assay described by Jefferson et al. (1987). The cell
extracts for measuring of GUS in whole leaves, roots, and stems were
prepared by grinding the plant material in buffer A with the addition
of some sand.
Calculation of Cell-Specific GUS Activities
To calculate the amount of GUS activity in BSC, we measured the
GUS activity in WLC, MC, and BSC strand fractions and then used a
linear-regression method similar to that described by Stitt and Heldt
(1985) to correct for cross-contamination in the BSC fraction. Here the
total GUS activity per fraction is defined as the sum of GUS activities
coming from the MC and BSC:
Because the MC-specific GUS activity is proportional to the
activity of the marker enzyme for MC, PEPC (constant a = GUSMC/PEPC), and the GUS activity in BSC
preparations is proportional to the activity of ME (constant b = GUSBS/ME), the first equation can be transformed
into a function of the form y = a + b(x),
where GUStotal/PEPC = y and
ME/PEPC = x. The plotting of this function and
extrapolation to the axes results in the constants a and b, which can
be used to calculate the ratio of MC-specific or BSC-specific GUS
activities in each fraction. The reciprocal plot should result in
similar values. To minimize errors, we used the activities per volume
in each fraction to calculate the linear regressions.
| |
RESULTS |
Transformation of F. bidentis
The 5 region of the F. trinervia Pdk gene extends from
position  1212 relative to the start of transcription up to the start of translation at position +279. This includes an exon of 135 bp (exon
1a), an intron of 133 bp in the 5 untranslated region, and 10 bp of
exon 1b in front of the first ATG codon, which initiates translation of
the transit peptide (Fig. 1). This
gus fusion was transformed into hypocotyl explants of
F. bidentis, a species closely related to F. trinervia. Both species exhibit full development of
C4 photosynthesis.
View larger version (6K):
[in this window]
[in a new window]
| Figure 1.
Schematic representation of the Pdk
promoter/uidA construct used for the transformation of
F. bidentis. Black boxes indicate the 5 untranslated
exon and the first 10 bp of the next exon in front of the translational
start codon. The uidA gene and the ocs 3
terminator are symbolized as gray boxes.
|
|
After callus formation on kanamycin-containing medium we obtained 11 shoots, each from a different callus; 8 of these shoots survived to
give mature plants. The plants were transferred to soil and grown in
the greenhouse until they set seeds. The seeds of two primary
transformants did not germinate. The T1
generation of the remaining six primary transformants were used for the
experiments described here, together with two T0
plants, which could be propagated by cuttings. Only one of these
T0 plants produced fertile seeds; the resulting
T1 plants were included in the analysis.
GUS Expression Changes with Leaf Age
Prior to comparative measurements between different plants we
compared the GUS levels between the leaves of single plants. Using the
fluorometric quantitation of the conversion of methylumbelliferyl glucuronide by the GUS protein we found the highest levels in leaves at
the third or fourth node when counting from the youngest visible node
downward. These leaves were already well developed and at least
three-quarters in size compared with the largest leaves of the plant.
Older leaf pairs showed a significant decrease in GUS activity per
milligram protein. The oldest, but not visibly senescent, leaf
displayed GUS levels similar to that in stems (data not shown).
Although we tried to use tissues of similar age, we could not exclude
some variability due to age.
When leaves of the third or fourth node were separated into the top,
middle, and basal sections, we obtained the lowest GUS activity in the
tip. The levels increased in the middle section and reached 2-fold that
of the tip at the basal part, where most of the cell divisions occur
(data not shown).
To determine the range of GUS activities in different transgenic lines
we prepared leaf extracts from the third leaf pair of plants that were
4 to 6 weeks old. The results of these measurements are shown in Figure
2. Each dot represents one plant. In five lines of T1 plants the highest activities were
2.5 to 4 times that of the lowest levels measured, about what one would
expect from the offspring of a self-fertilized T0
plant. One group of T1 plants (217-3) showed
considerable variability between 0.3 and 75 nmol methylumbelliferone
mg1 protein min1.
View larger version (15K):
[in this window]
[in a new window]
| Figure 2.
Distribution of GUS activities in leaves of
transgenic T1 plants. GUS activities in extracts of the
third leaf pairs of 4- to 6-week-old plants were quantified using the
fluorometric analysis of the conversion of methylumbelliferyl
glucuronide. Each circle represents one plant and each column
represents the progeny of one T0 plant. MU,
Methylumbelliferyl.
|
|
Two T0 plants as well as five
T1 plants of each of the six fertile transgenic
lines were analyzed by Southern-blot hybridization to confirm that the
chimeric genes were intact and to estimate the number of the integrated
copies (Table I). No correlation was
found between the copy number, which ranged from one to six, and the
levels of GUS expression.
View this table:
[in this window]
[in a new window]
|
Table I.
Calculation of GUS activities in MC and BS
GUS activities in the actual cell fractions were measured using the
fluorescent assay. The purity of the BSC fraction was estimated using
activities of the marker enzymes PEPC and ME. The calculated activity
of the promoter/GUS construct in pure BSC fractions was determined by
the linear-regression method. The copy number of the integrated T-DNA
was determined in genomic Southern blots.
|
|
Organ-Specific GUS Activities in Transgenic Plants
The organ specificity of the promoter construct was investigated
in T1 plants of each transgenic line as well as
in two T0 plants (Fig.
3). The line 217-5 is represented by
four T1 plants exhibiting different levels of GUS
expression in leaves. For the preparation of leaf extracts we used the
middle sections of the third-youngest leaf pairs. Stem tissues
represent the internodal areas between the second and fifth nodes,
which are green in both F. trinervia and F. bidentis. Root material was taken from young roots grown in
vermiculite.
View larger version (26K):
[in this window]
[in a new window]
| Figure 3.
Organ specificity of the GUS activity in
transgenic plants. GUS activities were measured in the middle parts of
leaves (white bars), in the internodal areas of stems (gray bars)
between the second and fifth node, and in young roots (black bars) of
transgenic plants. Data were obtained from two T0 plants
(217-1 and 217-3), one representative each of five transgenic lines
(showing medium to high GUS activities in leaves; 217-2, 217-3,
217-6, 217-9, and 217-10) and four plants of line 217-5 expressing
a range of GUS activities in leaves. MU, Methylumbelliferyl.
|
|
GUS activities in stems ranged from 12 to 0.01% of that found in
leaves. The four T1 plants of line 217-5 showed
stem activities ranging from 7 to 12% of that in leaves. The levels in
roots were slightly above background, ranging from 0.04 to 1.6% of the
activities in leaves. A similar distribution of GUS expression in
stems, leaves, and roots was found in 25-d-old T1
seedlings (data not shown) as in the more mature plants (analyzed in
Fig. 3). The range of the GUS activities in stem tissue relative to the
corresponding leaf extracts might be due to high variabilities of the
GUS activities at different developmental stages of stems. We tried to
circumvent developmental differences by pooling the stem sections
between the second and the fifth node. However, we cannot exclude the possibility of varying amounts of lignified material, leading to high
variations of the measured GUS activities on a protein basis. The
results shown here do prove, however, that the promoter is expressed
mainly in leaves and to a lesser degree in stems.
The GUS staining in stems was visible mainly in the vascular bundles
and a faint staining was seen in the MC between them (Fig.
4A). As the stem aged, the pronounced
vascular staining decreased.
View larger version (75K):
[in this window]
[in a new window]
| Figure 4.
Histochemical analysis of GUS activity. A,
Sections of young stems incubated for 2 h. Bar = 1 mm. B,
Leaf section incubated for 20 min. C and D, Leaf sections incubated for
2 h viewed under dark-field microscopy. Bars = 100 µm in B,
C, and D. M, MC; B, BSC.
|
|
GUS Expression in MC and BSC
The function of PPDK in the C4 cycle of
photosynthesis is restricted to the MC, but small amounts of
transcripts and proteins for this enzyme have been found in BSC as
well. We determined whether the promoter construct was sufficient to
direct a similar distribution of GUS activity. When leaf sections from
T0 and T1 plants were
incubated in 5-bromo-4-chloro-3 indolyl -D-glucuronic acid for periods of up to 30 min, the indigo GUS product appeared first
in MC, as expected (Fig. 4B). Some indigo was also detected in BSC.
Epidermal cells were not stained. However, longer incubation resulted
in the accumulation of GUS product (seen as a red birefringence in
dark-field microscopy) in both cell types and in most cells of veins
(Fig. 4C). Incubation times of several hours or more gave as much GUS
product in veins as in MC (Fig. 4D). GUS product was even detectable in
epidermal cells.
The equivocal results from the histochemical analysis of GUS
distribution led us to measure activity directly in isolated cell
preparations. In C4 plants the BSC are encased by
thick cell walls with no intercellular spaces between adjacent BS.
Differential homogenization of leaves allows one to prepare relatively
pure bundle-sheath strands consisting of BS and veins (Agostino et al.,
1989). However, in C4 plants of the genus
Flaveria it is not possible to make MC preparations with a
similar degree of purity. The purity of any cell fraction can be
accurately determined by measuring the activities of selected
C4 enzymes, which have been shown to be cell
specific in a wide range of C4 plants (Hatch, 1987). We used PEPC and ME as marker enzymes for MC and BS,
respectively, and routinely obtained bundle-sheath preparations, which
were about 95% pure. Mesophyll preparations were generally only 60 to
70% pure. We compared the measured GUS activities of bundle-sheath preparations with WL extracts to obtain estimates for MC. For the
calculation of GUS activities in pure BS we used the linear-regression method as described in ``Materials and Methods''. Since this method
is based on the relation of GUS activities to the marker enzymes, it is
independent of the purity of the actual cell preparations. The measured
GUS activities and calculated values for pure BS are listed in Table I.
The results for two T0 plants and three to four
T1 plants of each transgenic line are shown in
Figure 5. The estimated GUS activities in
bundle-sheath strands vary between 0.2 and 10% of the activities in
whole leaves. Within each set of T1 siblings the
values diverge to a lesser degree. Based on these measurements we
deduce that the promoter construct is mainly expressed in MC but that
there is also a low level of expression in BS. We have no data that
help us to determine whether any of the GUS activity measured in our
bundle-sheath strand preparations is due to promoter activity in vein
cells. The quantitative measurements show that the high levels of GUS
in BS and veins seen in the histochemical analysis are artifacts.
View larger version (39K):
[in this window]
[in a new window]
| Figure 5.
Measured GUS activities in extracts of whole
leaves (gray bars) compared with BSC (black bars). The BSC preparations
were at least 95% pure. The purity was calculated using the activities of the marker enzymes for both cell types. MU, Methylumbelliferyl.
|
|
Histochemical staining for GUS activity in young F. bidentis
leaves has proven to be difficult because of poor substrate
penetration. When young leaves were cut into thin sections, we could
observe staining at the cut edges and see a good correlation between
the degree of vascularization and the amount of GUS activity (data not
shown). Because full development of C4 Kranz
anatomy is dependent on complete vascularization of the leaf, this
correlation suggests that high-level expression of the Pdk
promoter is dependent on cellular differentiation.
Light Regulation of the Introduced Promoter Construct
The 3.4-kb PPDK transcript in leaves of F. trinervia is
positively light regulated (Rosche and Westhoff, 1995). The
darkening of mature plants results in a significant decrease of the
transcript levels, which increase again after illumination.
Because the GUS protein tends to be very stable (Jefferson et al.,
1987), we measured transcript levels in the plants 217-1 and 217-3,
which were kept in the dark for 3 d prior to reillumination for up
to 6 h. Poly(A+) RNA was probed with the
uidA gene and Pdk cDNA from F. trinervia. Results for the plant 217-3 are shown in Figure
6. The endogenous Pdk mRNA
decreased to low levels in the dark and then rapidly increased within
6 h to levels similar to light-grown plants. The uidA
mRNA transcribed from the introduced construct showed an increase with
reillumination as well. However, this increase seems to be less
pronounced than that of the Pdk transcript, possibly due to
lower overall transcript levels of the uidA mRNA. Although we used probes of similar lengths and comparable labeling in
three independent experiments, the signal strengths of the
uidA mRNA were always lower compared with the Pdk
transcript.
View larger version (89K):
[in this window]
[in a new window]
| Figure 6.
Northern-blot analysis of plants left in the dark
and reilluminated plants. The T0 plant 217-3 was left in
the dark for 3 d and was subsequently reilluminated in the
greenhouse. Leaves were harvested after 0, 3, and 6 h of
reillumination, as well as from light-grown control plants. Five
micrograms of poly(A+) RNA of each sample was loaded twice
onto the same gel, generating two identical patterns. The gel was
blotted and hybridized with labeled PCR products of the
uidA gene and the Pdk cDNA of F. trinervia. The blots were hybridized a second time with a probe
for actin to test for equal loadings.
|
|
To examine light induction in etiolated seedlings we germinated and
grew T1 seeds either in the dark or in constant
light. The seeds had been previously illuminated for 1 d to ensure
germination. As shown in Table II,
cotyledons grown in the light had severalfold greater GUS activity than
those grown in the dark. After 10 d of growth in the dark,
transfer to light gave a progressive 3-fold increase in GUS. Although
we did not determine the extent of leaf-cell development in these
seedlings, we conclude that light induces the expression of the
reporter gene in both seedlings and in mature plants.
View this table:
[in this window]
[in a new window]
|
Table II.
Light induction of GUS activity in seedlings
GUS activity was measured in cotyledons from individual seedlings.
Seedlings were grown for the indicated number of days in either
continuous dark or light, or dark-grown seedlings were transferred to
continuous light for the indicated number of hours.
|
|
| |
DISCUSSION |
The genes coding for some C4 enzymes are
members of small gene families. Gene duplications created additional
gene copies, which subsequently gained the necessary
cis-acting regulatory elements that confer high-level,
light-regulated, and cell-specific expression that is necessary for the
assembly of the C4 pathway. This mechanism
preserved the ancestral genes coding for nonphotosynthetic isoforms,
which are found in C4 species and which are
expressed at levels similar to C3 species.
Examples are the gene families coding for PEPC and ME. The
C3 species F. pringlei and the
C4 species F. trinervia have similar
numbers of genes coding for PEPC (Hermans and Westhoff, 1990, 1992).
Gene-specific probes identified orthologous Ppc genes in the
C3 species that are very similar in sequence to
the PpcA genes encoding the C4 isoform in the C4 species. In the
C3 species these PpcA genes are
expressed at low levels in most organs. Stockhaus et al. (1997) showed
that 5 sequences from the PpcA1 gene of F. pringlei (C3) also directed low-level
uidA gene expression in transgenic F. bidentis
(C4) plants, whereas 5 sequences from the
F. trinervia (C4) gene directed high
level expression. This result provides evidence for the role of new
cis-acting sequences in the C4
species.
A similar analysis identified two genes encoding chloroplast-localized
ME isoforms in Flaveria (Marshall et al., 1996). One gene,
Me1, encodes the C4 form in the
C4 species. Me1 is present in the
C3 species but is expressed at low levels. The
second gene, Me2, is expressed at very low levels in all
species.
The Pdk gene does not fit this simple evolutionary story. In
the genus Flaveria it is present as a single-copy gene,
which performs both the function of the ancestral nonphotosynthetic gene and the MC-specific C4 gene. We have used a
transformation approach to determine the relationship of the
cis-acting DNA sequences controlling the different programs
of expression of the Pdk gene from F. trinervia,
a C4 species. Rosche and Westhoff (1995)
previously showed that the 3.4-kb transcript of this gene could be
detected not only in MC, where it encodes the enzyme used in the
C4 pathway, but also at much lower levels in BSC
and in stems. Our data show that 1.5 kb of DNA upstream of the ATG
directs similar expression of the uidA reporter gene. Most
GUS activity was located in MC, with lower levels in BSC and in stems
(Figs. 3 and 5). Although the 3.4-kb transcript was not detected in
roots, extremely low amounts of GUS were found in roots, which may be
due to the greater sensitivity of the GUS fluorescence assay compared
with RNA northern blots.
We tried to localize the GUS activity in stem sections by GUS staining
and found most of the indigo in the vascular bundles. However, the
level of the actual GUS activity in these cells remains to be
investigated. In leaves the GUS product accumulated in cells of the
veins, although the cell-separation data clearly show a preferred
expression in MC. Taken together, it seems that GUS-expression studies
based on histochemical data alone can lead to questionable results. The
high stability of the GUS product enhances the accumulation in cells
with low promoter activity. In addition, diffusion of the initial GUS
product via the frequent and large plasmodesmata that occur between the
MC and BSC of C4 plants (Robinson-Beers and
Evert, 1991) can lead to the precipitation of the insoluble end product
in cells where the uidA gene is not expressed. The accumulation in veins indicates a preferred precipitation of the GUS
product in this compartment. The histochemical analysis of the GUS
expression driven by the Ppc promoter (Stockhaus et al., 1997) indicates that the problems mentioned above are not as evident when the promoter activity is strictly cell specific. The authors report the diffusion of the GUS product in BSC only after longer incubation periods. Our cell-separation data show low GUS activity in
BSC, in accordance with the northern data obtained previously for the
endogenous Pdk gene (Rosche and Westhoff, 1995). The
resulting GUS staining of these cells was not proportional to the
actual GUS activity measured in the separated cells.
The high level expression of the Pdk gene in MC was also
dependent on light and on the stage of leaf development. Here we show
that the uidA transcript exhibited a similar response to light in transgenic F. bidentis plants (Fig. 6), indicating
that the cis-element responsible for the light-regulated
expression is present within the 1.5-kb promoter region. Although the
transcripts of the endogenous Pdk gene and the introduced
uidA construct in the investigated transplant were not
quantified, the level of the GUS mRNA seemed to be significantly lower.
Reasons for these differences could be different stabilities of the
transcripts or position effects within the genome.
In mature leaves the measured GUS activity was found to be greatest in
the basal region of the leaf, where most of the cell divisions occur.
The activity decreased toward the tip of the leaf, where the cellular
development is most advanced. In contrast, the GUS staining of very
young leaves indicated a good correlation between the intensity of the
color and the cell differentiation. The histochemical results are
similar to those found for the ppcA promoter/uidA
construct in F. bidentis transplants (Stockhaus et al.,
1997). Thus, these C4 promoters seem to be active
in developing leaves in correlation with the differentiation of MC and
BSC. In mature leaves, however, the oldest regions show the lowest GUS
activity.
We conclude that DNA sequences sufficient for expression of the
C4 form of PPDK in MC and for expression of the
chloroplast form in other cells and organs are co-located within the
same 5 region of the F. trinervia Pdk gene. In evolutionary
terms, the C4 cis-acting sequences
appear to have been added to a promoter that was active in a wide range
of cells without significantly altering the activity of that promoter.
Our next step will be to identify the cis-acting sequences
controlling both expression programs and determine their structural and
functional relationships to one another. The strong correlation between
GUS activity directed by 5 sequences of the gene and the distribution
of Pdk mRNA suggest that these cis-acting
sequences control transcription. However, the inclusion of the 5
untranslated region of the Pdk transcript in our reporter
gene construct means that we cannot exclude the involvement of mRNA
stability in gene regulation.
The dual-function maize Pdk gene has also been analyzed for
cis-acting regulatory sequences. Transient expression assays
in maize leaf protoplasts (Sheen, 1991) and in
microprojectile-bombarded maize leaves (Matsuoka and Numazawa, 1991)
identified sequences upstream of the transcription initiation site,
which are necessary for high level leaf expression. These analyses were
not able to determine whether the promoter constructs were active at
lower levels in other cells and organs. Matsuoka et al. (1993) were able to show that the promoter for the chloroplast form of maize PPDK
was specifically expressed in transgenic rice leaves and that this
expression was at high levels, preferentially in MC. These data
strongly suggest that the dual-function maize gene is equivalent to the
single Flaveria Pdk gene and that the evolutionary origin of
the maize gene may also have been from the addition of
C4 regulatory elements to an ancestral gene.
However, it is not evident if the chloroplast form of the maize gene is
expressed in other cells and organs.
The F. bidentis transformation system has been used by
Stockhaus et al. (1997) to look for regulatory sequences from the
F. trinervia (C4) PpcA1
gene, which codes for the mesophyll-specific isoform of PEPC. 5
Sequences, including the entire 5 untranslated region, directed a
pattern of GUS expression that was very similar to the distribution of
PpcA mRNA. The authors draw similar conclusions to ours
about the importance of 5 cis-acting sequences in
regulating, most likely through transcriptional control, the expression
of a gene coding for a C4 enzyme. In contrast,
Marshall et al. (1997) have found that 5 and 3 sequences from the
Me1 gene of F. bidentis, which codes for the
C4 isoform of ME, are required for high-level BSC
expression of the uidA reporter gene in transgenic F. bidentis. They have not yet determined the level of this
regulation or how 3 sequences interact with 5 sequences. 3 Sequences
have also been shown to be important in controlling BSC-specific
expression of the maize RbcS-m3 gene (Viret et al., 1994),
whereas Ramsperger et al. (1996) have presented evidence that
translational regulation may be important in BSC specificity of both
Rubisco subunits. Thus, there does not appear to be one single
mechanism regulating the expression of genes coding for enzymes of the
C4 pathway.
| |
FOOTNOTES |
1
The isolation of the Pdk promoter
was done in Düsseldorf, Germany, and was supported by a grant
from the Deutsche Forschungsgemeinschaft via Sonderforschungsbereicht
189. E.R. was supported by a postdoctoral fellowship from the Deutsche
Forschungsgemeinschaft.
2
Present address: Department of Biological
Sciences, University of Newcastle, Newcastle NSW 2308, Australia.
*
Corresponding author; e-mail bt{at}pi.csiro.au; fax
61-2-6246-5000.
Received December 2, 1997;
accepted March 27, 1998.
| |
ABBREVIATIONS |
Abbreviations:
BSC, bundle-sheath cell(s).
MC, mesophyll
cell(s).
ME, NADP-malic enzyme.
PEPC, PEP carboxylase.
PPDK, pyruvate
Pi dikinase.
WLC, whole-leaf cell(s).
| |
ACKNOWLEDGMENTS |
We thank Tony Agostino for advice concerning cell-separation
methods; John Lunn for help with linear-regression analyses; and Brian
Surin, Tony Ashton, and Paul Whitfeld for helpful comments about the
manuscript.
| |
LITERATURE CITED |
Agostino A,
Furbank RT,
Hatch MD
(1989)
Maximising photosynthetic activity and cell integrity in isolated bundle sheath cell strands from C4 species.
Aust J Plant Physiol
16:
279-290
An G
(1986)
Development of plant promoter expression vectors and their use for analysis of differential activity of nopaline synthase promoter in transformed cells.
Plant Physiol
81:
86-91
[Abstract/Free Full Text]
Aoyagi K,
Bassham JA
(1983)
Pyruvate orthophosphate dikinase in wheat leaves.
Plant Physiol
73:
853-854
[Abstract/Free Full Text]
Aoyagi K,
Bassham JA
(1984a)
Pyruvate orthophosphate dikinase mRNA organ specificity in wheat and maize.
Plant Physiol
76:
278-280
[Abstract/Free Full Text]
Aoyagi K,
Bassham JA
(1984b)
Pyruvate orthophosphate dikinase of C3 seeds and leaves as compared to the enzyme from maize.
Plant Physiol
75:
387-392
[Abstract/Free Full Text]
Aoyagi K,
Bassham JA
(1985)
Synthesis and uptake of cytoplasmically synthesized pyruvate, Pi dikinase polypeptide by chloroplasts.
Plant Physiol
78:
661-664
[Abstract/Free Full Text]
Ashton AR,
Burnell JN,
Furbank RT,
Jenkins CLD,
Hatch MD
(1990)
Enzymes of C4 photosynthesis.
Methods Plant Biochem
3:
39-72
Bruchhaus I,
Tannich E
(1993)
Primary structure of the pyruvate phosphate dikinase in Entamoeba histolytica.
Mol Biochem Parasitol
62:
153-156
[CrossRef][Medline]
Chitty JA,
Furbank RT,
Marshall JS,
Chen Z,
Taylor WC
(1994)
Genetic transformation of the C4 plant, Flaveria bidentis.
Plant J
6:
949-956
[CrossRef]
Church GM,
Gilbert W
(1984)
Genomic sequencing.
Proc Natl Acad Sci USA
81:
1991-1995
[Abstract/Free Full Text]
Edwards GE,
Walker DA
(1983)
C3, C4: Mechanism, and Cellular and Environmental Regulation, of Photosynthesis.
Blackwell Scientific Publications, Oxford, London
Glackin CA,
Grula JW
(1990)
Organ-specific transcripts of different size and abundance derive from the same pyruvate, orthophosphate dikinase gene in maize.
Proc Natl Acad Sci USA
87:
3004-3008
[Abstract/Free Full Text]
Hata S,
Matsuoka M
(1987)
Immunological studies on pyruvate orthophosphate dikinase in C3 plants.
Plant Cell Physiol
28:
635-641
[Abstract/Free Full Text]
Hatch MD
(1987)
C4 photosynthesis: a unique blend of modified biochemistry, anatomy and ultrastructure.
Biochim Biophys Acta
895:
81-106
Hermans J,
Westhoff P
(1990)
Analysis of expression and evolutionary relationships of phosphoenolpyruvate carboxylase genes in Flaveria trinervia (C4) and F. pringlei (C3).
Mol Gen Genet
224:
459-468
[Web of Science][Medline]
Hermans J,
Westhoff P
(1992)
Homologous genes for the C4 isoform of phosphoenolpyruvate carboxylase in a C3- and a C4-Flaveria species.
Mol Gen Genet
234:
275-284
[Medline]
Höfer MU,
Santore UJ,
Westhoff P
(1992)
Differential accumulation of the 10-, 16- and 23-kDa peripheral components of the water-splitting complex of photosystem II in mesophyll and bundle-sheath chloroplasts of the dicotyledonous C4 plant Flaveria trinervia (Spreng.) C. Mohr.
Planta
186:
304-312
Hudspeth RL,
Glackin CA,
Bonner J,
Grula JW
(1986)
Genomic and cDNA clones for maize phosphoenolpyruvate carboxylase and pyruvate, orthophosphate dikinase: expression of different gene-family members in leaves and roots.
Proc Natl Acad Sci USA
83:
2884-2888
[Abstract/Free Full Text]
Janssen BJ,
Gardner RC
(1989)
Localized transient expression of GUS in leaf discs following co-cultivation with Agrobacterium.
Plant Mol Biol
14:
61-72
Jefferson RA,
Kavanagh TA,
Bevan MW
(1987)
GUS fusions: -glucuronidase as a sensitive and versatile gene fusion marker in higher plants.
EMBO J
6:
3901-3907
[Web of Science][Medline]
Marshall JS,
Stubbs JD,
Chitty JA,
Surin B,
Taylor WC
(1997)
Expression of the C4 Me1 gene from Flaveria bidentis requires an interaction between 5 and 3 sequences.
Plant Cell
9:
1515-1525
[Abstract]
Marshall JS,
Stubbs JD,
Taylor WC
(1996)
Two genes encode highly similar chloroplastic NADP-malic enzymes in Flaveria.
Plant Physiol
111:
1251-1261
[Abstract]
Matsuoka M
(1990)
Structure, genetic mapping, and expression of the gene for pyruvate, orthophosphate dikinase from maize.
J Biol Chem
265:
16772-16777
[Abstract/Free Full Text]
Matsuoka M
(1995)
The gene for pyruvate, orthophosphate dikinase in C4 plants structure, regulation and evolution.
Plant Cell Physiol
36:
937-943
[Abstract/Free Full Text]
Matsuoka M,
Numazawa T
(1991)
Cis-acting elements in the pyruvate, orthophosphate dikinase gene in maize.
Mol Gen Genet
228:
143-152
[Medline]
Matsuoka M,
Ozeki Y,
Yamamoto N,
Hirano H,
Kano-Murakami Y,
Tanaka Y
(1988)
Primary structure of maize pyruvate, orthophosphate dikinase as deduced from cDNA sequence.
J Biol Chem
263:
11080-11083
[Abstract/Free Full Text]
Matsuoka M,
Tada Y,
Fujimura T,
Kano-Murakami Y
(1993)
Tissue-specific light-regulated expression directed by the promoter of a C4 gene, maize pyruvate, orthophosphate dikinase, in a C3 plant, rice.
Proc Natl Acad Sci USA
90:
9586-9590
[Abstract/Free Full Text]
Meyer AO,
Kelly GJ,
Latzko E
(1982)
Pyruvate orthophosphate dikinase from the immature grains of cereal grasses.
Plant Physiol
69:
7-10
[Abstract/Free Full Text]
Moore PD
(1982)
Evolution of photosynthetic pathways in flowering plants.
Nature
295:
647-648
[CrossRef]
Pocalyko DJ,
Carroll LJ,
Martin BM,
Babbitt PC,
Cunaway-Mariano D
(1990)
Analysis of sequence homologies in plant and bacterial pyruvate phosphate dikinase, enzyme I of the bacterial phosphoenolpyruvate:sugar phosphotransferase system and other PEP-utilizing enzymes. Identification of potential catalytic and regulatory motifs.
Biochemistry
29:
10757-10765
[CrossRef][Medline]
Powell AM
(1978)
Systematics of Flaveria (Flaveriinae-Asteraceae).
Ann Mo Bot Gard
65:
590-636
Ramsperger VC,
Summers RG,
Berry JO
(1996)
Photosynthetic gene expression in meristems and during initial leaf development in a C4 dicotyledonous plant.
Plant Physiol
111:
999-1010
[Abstract]
Robinson-Beers K,
Evert RF
(1991)
Ultrastructure of and plasmodesmatal frequency in mature leaves of sugarcane.
Planta
184:
291-306
Rosche E,
Streubel M,
Westhoff P
(1994)
Primary structure of the photosynthetic pyruvate orthophosphate dikinase of the C3 plant Flaveria pringlei and expression analysis of pyruvate orthophosphate dikinase sequences in C3, C3-C4 and C4 Flaveria species.
Plant Mol Biol
26:
763-769
[CrossRef][Web of Science][Medline]
Rosche E,
Westhoff P
(1990)
Primary structure of pyruvate, orthophosphate dikinase in the dicotyledonous C4 plant Flaveria trinervia.
FEBS Lett
273:
116-121
[Medline]
Rosche E,
Westhoff P
(1995)
Genomic structure and expression of the pyruvate, orthophosphate dikinase gene of the dicotyledonous C4 plant Flaveria trinervia (Asteraceae).
Plant Mol Biol
29:
663-678
[CrossRef][Web of Science][Medline]
Sheen J
(1991)
Molecular mechanisms underlying the differential expression of maize pyruvate, orthophosphate dikinase genes.
Plant Cell
3:
225-245
[Abstract/Free Full Text]
Stitt M,
Heldt HW
(1985)
Control of photosynthetic sucrose synthesis by fructose-2,6-bisphosphate.
Planta
164:
179-188
[CrossRef]
Stockhaus J,
Schlue U,
Koczor M,
Chitty JA,
Taylor WC,
Westhoff P
(1997)
The promoter of the gene encoding the C4 form of phosphoenolpyruvate carboxylase directs mesophyll specific expression in transgenic C4 Flaveria.
Plant Cell
9:
479-489
[Abstract]
Viret J-F,
Mabrouk Y,
Bogorad L
(1994)
Transcriptional photo-regulation of cell-type-preferred expression of maize rbcS-m3: 3 and 5 sequences are involved.
Proc Natl Acad Sci USA
91:
8577-8581
[Abstract/Free Full Text]
This article has been cited by other articles:
|
|
|
|
 
S. K. Tanz, S. G. Tetu, N. G.F. Vella, and M. Ludwig
Loss of the Transit Peptide and an Increase in Gene Expression of an Ancestral Chloroplastic Carbonic Anhydrase Were Instrumental in the Evolution of the Cytosolic C4 Carbonic Anhydrase in Flaveria
Plant Physiology,
July 1, 2009;
150(3):
1515 - 1529.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Engelmann, C. Wiludda, J. Burscheidt, U. Gowik, U. Schlue, M. Koczor, M. Streubel, R. Cossu, H. Bauwe, and P. Westhoff
The Gene for the P-Subunit of Glycine Decarboxylase from the C4 Species Flaveria trinervia: Analysis of Transcriptional Control in Transgenic Flaveria bidentis (C4) and Arabidopsis (C3)
Plant Physiology,
April 1, 2008;
146(4):
1773 - 1785.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. E. Edwards, V. R. Franceschi, M. S. B. Ku, E. V. Voznesenskaya, V. I. Pyankov, and C. S. Andreo
Compartmentation of photosynthesis in cells and tissues of C4 plants
J. Exp. Bot.,
April 1, 2001;
52(356):
577 - 590.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction
