|
Plant Physiol. (1998) 117: 1165-1170
RNA Polymerase Subunits Encoded by the Plastid rpo
Genes Are Not Shared with the Nucleus-Encoded Plastid
Enzyme1
Germán Serino and
Pal Maliga*
Waksman Institute, Rutgers, The State University of New Jersey, 190 Frulinghuysen Road, Piscataway, New Jersey 08854-8020
 |
ABSTRACT |
Plastid genes in photosynthetic
higher plants are transcribed by at least two RNA polymerases. The
plastid rpoA, rpoB, rpoC1, and rpoC2 genes encode subunits of the plastid-encoded
plastid RNA polymerase (PEP), an Escherichia coli-like
core enzyme. The second enzyme is referred to as the nucleus-encoded
plastid RNA polymerase (NEP), since its subunits are assumed to be
encoded in the nucleus. Promoters for NEP have been previously
characterized in tobacco plants lacking PEP due to targeted deletion of
rpoB (encoding the  -subunit) from the plastid genome.
To determine if NEP and PEP share any essential subunits, the
rpoA, rpoC1, and rpoC2
genes encoding the PEP  -,  -, and "-subunits were removed by
targeted gene deletion from the plastid genome. We report here that
deletion of each of these genes yielded photosynthetically defective
plants that lack PEP activity while maintaining transcription specificity from NEP promoters. Therefore, rpoA,
rpoB, rpoC1, and rpoC2 encode PEP
subunits that are not essential components of the NEP transcription
machinery. Furthermore, our data indicate that no functional copy of
rpoA, rpoB, rpoC1, or
rpoC2 that could complement the deleted plastid
rpo genes exists outside the plastids.
| |
INTRODUCTION |
At least two distinct RNA polymerases are involved in the
transcription of plastid genes in photosynthetic higher plants. One of
these contains homologs of the Escherichia coli enzyme, including the -, -, -, and "-subunits encoded in the
plastid rpoA, rpoB, rpoC1, and
rpoC2 genes, and is referred to as PEP. The promoters for
PEP are reminiscent of the E. coli
 70-type promoters, and have two conserved
hexameric blocks of sequences (TTGACA or "-35" element; TATAAT or
" 10" element) 17 to 19 nucleotides apart. Transcription from PEP
promoters initiates 5 to 7 nucleotides downstream of the "10"
promoter element (Igloi and Kössel, 1992 ; Gruissem and Tonkyn,
1993; Link, 1996). Promoter specificity to PEP is conferred by
nuclear-encoded -like factors (Isono et al., 1997; Tanaka et al.,
1997).
Several reports indicate the existence of a second, NEP activity
(Morden et al., 1991; Hess et al., 1993; Allison et al., 1996). A
candidate for NEP is an approximately 110-kD protein that has
properties similar to the mitochondrial and phage T3/T7 RNA polymerases
that may be part of a larger complex (Lerbs-Mache, 1993; Hedtke et al.,
1997). NEP promoters share a loose, 10-nucleotide consensus,
ATAGAATA/GAA, overlapping the transcription-initiation site, which is
reminiscent of promoters recognized by the mitochondrial and phage
T3/T7 RNA polymerases (Hajdukiewicz et al., 1997; Hübschmann and Börner, 1998; for review, see Maliga, 1998).
Plastid RNA polymerase activities with distinct sensitivities to
inhibitors are present in higher plants in multisubunit complexes (Pfannschmidt and Link, 1994). Sharing of essential subunits of RNA
polymerases has been reported in yeast (Sentenac et al., 1992). Therefore, plastid NEP and PEP could be part of the same complex. To
test if NEP and PEP share any essential subunits, the
rpo genes encoding PEP subunits were removed by
targeted gene deletion from the plastid genome. Study of promoter
activity in plastids lacking the rpoB gene has shown that
the PEP -subunit is essential for PEP transcription activity, but it
is not required for transcription by NEP (Allison et al., 1996;
Hajdukiewicz et al., 1997).
This study addresses the contribution of the rpoA,
rpoC1, and rpoC2 genes to transcription from PEP
and NEP promoters. We report here that deletion of each of these genes
yields photosynthetically defective plants that lack PEP activity while
maintaining transcription from NEP promoters. Therefore,
rpoA, rpoB, rpoC1, and
rpoC2 encode essential PEP subunits that are not components
of the NEP transcription machinery. Furthermore, no functional copy of
the rpo genes that could complement the deleted plastid
rpo genes exists outside the plastid.
| |
MATERIALS AND METHODS |
Plasmid Construction
Plasmid pGS95 carries the tobacco (Nicotiana tabacum)
ptDNA HincII fragment (sites are at nucleotides 78990-82117
in the ptDNA) (Shinozaki et al., 1986), cloned into the
EcoRV site of a pBSKS+ (Stratagene) plasmid derivative with
the ScaI site removed. The BglII/ScaI
fragment (sites are at positions 80549 and 81466) containing the
rpoA-coding region was replaced by a chimeric
spectinomycin-resistance gene (aadA) from plasmid pOVZ34 as
a BamHI/SmaI fragment (note that the
BamHI and BglII ends are compatible). Plasmid
pOVZ34 is a pUC119 plasmid derivative and carries the aadA
gene in a psbA cassette as in plastid vector pOVZ15
(Zoubenko et al., 1994).
Plasmid pGS97 carries the PstI/Psp1406I ptDNA
fragment (sites are at nucleotides 20283 and 25662) cloned into
PstI/AccI-digested pBSIIKS+ plasmid
(Stratagene). Note that AccI and Psp1406I ends
are compatible. In the cloned ptDNA fragment most of the
rpoC1-coding region is contained between AccI
sites at positions 21797 and 23840. The rpoC1-coding region
between the indicated AccI sites was replaced with a
chimeric aadA gene as a BspHI/Acc65I
fragment (ends were rendered blunt with T4 DNA polymerase) from plasmid
pOVZ11, a pUC118 plasmid derivative. The pOVZ11 plasmid carries the
Prrn::aadA::TpsbA chimeric gene in plastid vector pPRV112 (Zoubenko et al., 1994).
Plasmid pGS99 carries the tobacco ptDNA SacI fragment (sites
are at nucleotides 15662 and 22658) cloned into
SacI-digested pBSIIKS+ plasmid (Stratagene). The
rpoC2-coding region was excised as a
StuI/BsrGI fragment (sites are at nucleotides
17397 and 21048) and replaced with the chimeric aadA gene
(BspHI/Acc65I fragment) from plasmid pOVZ11, as
described for pGS97.
Plastid Transformation
Tungsten particles were coated with pGS95, pGS97, or pGS99 plasmid
DNA and introduced into plastids of tobacco leaves with a
particle-delivery system (PDS1000He, Bio-Rad) (Svab and Maliga, 1993).
Transgenic shoots were regenerated on spectinomycin-containing (500 µg/mL) RMOP medium containing Murashige and Skoog salts (Murashige and Skoog, 1962), 3% Suc, 1.0 mg/L 6-benzylaminopurine, and 0.1 mg/L naphthaleneacetic acid (Svab et al., 1990). White sectors lacking rpo genes were identified in variegated leaves
during propagation on antibiotic-free plant maintenance (RM) medium
(Murashige and Skoog salts and 3% Suc; Murashige and Skoog,
1962). Uniformly transformed white shoots were regenerated from white
sectors in spectinomycin-free RMOP medium. The  rpoB
plants were described previously (Allison et al., 1996).
DNA and RNA Gel Blots
Total leaf DNA (Mettler, 1987) was digested with restriction
endonucleases and electrophoresed in 0.7% agarose gels (3 µg per
lane). For the RNA gel blots, total leaf RNA was extracted using the
TRIzol reagent (GIBCO-BRL) and electrophoresed in 1% agarose/formaldehyde gels (5 µg of RNA per lane). RNA and DNA gels
were transferred to N-Hybond membranes (Amersham) with the PosiBlot
Transfer apparatus (Stratagene). Nucleic acid hybridization was carried
out for 3 or more h at 65°C in Rapid Hybridization buffer (Amersham)
with [32P]dCTP-labeled double-stranded DNA
probes synthesized by random priming (Boehringer-Mannheim). The
following gene probes were used: 16SrDNA,
EcoRI/EcoRV fragment, sites are at nucleotides 138447 and 140855 in the tobacco ptDNA; atpB, PCR amplified
with primers GCAGGAGCAGGGTCGGTCAAATC and GAGAGGAATGGAAGTGATTGACA
(fragment ends are at nucleotides 55751-56512 of the tobacco ptDNA);
clpP, fragment PCR amplified with primers GAGGGAATGCTAGACG
and GACTTTATCGAGAAAG (ends are at nucleotides 73340-73621 of the
tobacco ptDNA); rbcL, BamHI fragment (restriction
sites are at nucleotides 58047-59285 of the tobacco ptDNA);
accD, fragment PCR amplified with primers GGATTTAGGGGCGAA
and GTGATTTTCTCTCCG (ends are at nucleotides 60211-60875 of the
tobacco ptDNA); cytoplasmic 25S rRNA gene, fragment PCR amplified with
primers TCACCTGCCGAATCAACTAGC and GACTTCCCTTGCCTACATTG.
Primer-Extension Reactions
Reactions were carried out with 10 µg of total leaf RNA (Allison
and Maliga, 1995) using the following primers: 16SrDNA,
TTCATAGTTGCATTACTTATAGCTTC (5 nucleotide complementary to 102757);
clpP, GGGACTTTTGGAACACCAATAGGCAT (5 at nucleotide 74479);
rbcL, ACTTGCTTTAGTCTCTGTTTGTGGTGACAT (5 nucleotide
complementary to 57616); accD, ccgagcTCTTATTTCCTATCAGACTAAGC (5 nucleotide complementary to 59758); and atpB,
CCCCAGAACCAGAAGTAGTAGGATTGA (5 nucleotide at 56736).
The primers listed above were previously used to map
transcription-initiation sites of these genes (Allison et al., 1996; Hajdukiewicz et al., 1997). Lowercase nucleotides are nonplastidic sequences. The position of RNA 5 ends was determined using these same
primers and homologous DNA templates as the reference. Sequence ladders
were generated with the Sequenase II kit (Amersham).
| |
RESULTS |
Targeted Deletion of rpoA, rpoC1, and
rpoC2 from the Plastid Genome Yields Pigment-Deficient
Plants
To construct vectors for targeted deletion of the rpo
genes, ptDNA fragments were cloned in Bluescript plasmids.
Subsequently, the rpo-coding region in the cloned ptDNA
fragment was replaced by a selectable spectinomycin-resistance gene
(aadA) (Fig. 1, A-C). The
size of the deletion in the targeting plasmids was: rpoA,
90% of the coding region; rpoC1, 63% of the coding region (80% of the 3 exon); and rpoC2, 73% of the coding
region. The transforming DNA was introduced into tobacco chloroplasts
in leaf cells by the biolistic process. Targeted deletion of the
rpo genes was achieved by replacement of the coding region
with aadA as the result of two homologous recombination
events via the flanking ptDNA sequences (Fig. 1, A-C). Culture of the
bombarded leaf segments on spectinomycin-containing RMOP medium
facilitated shoot regeneration with transformed plastid genomes. Since
the chimeric aadA gene is transcribed by PEP, cells carrying
only knockout plastid genomes are sensitive to spectinomycin.
Therefore, the developing green shoots and calli contained plastids
with a mixed population of knockout plastid genomes expressing
aadA, and wild-type plastid genomes expressing the targeted
rpo subunit gene (Fig. 2A). To facilitate formation of homoplasmic sectors, the shoots regenerating on
the leaf segments were excised and transferred onto antibiotic-free plant maintenance medium. Plastid genome sorting in developing shoots
facilitated formation of chimeric leaves, with white sectors containing
a uniform population of knockout plastid genomes and green sectors with
wild-type ptDNA (Fig. 2B). A second cycle of shoot regeneration from
the white sectors yielded white plants (Fig. 2C). These plants carry a
uniform population of transformed ptDNA lacking rpoA (Fig.
1, A and D), rpoC1 (Fig. 1, B and D), or rpoC2
(Fig. 1, C and D).
View larger version (23K):
[in this window]
[in a new window]
| Figure 1.
Targeted deletion of rpo genes from
the plastid genome. A, Deletion of the rpoA gene.
Homologous recombination events (hatched lines) between ptDNA sequences
in vector pGS95 and the tobacco plastid genome yields a genome lacking
rpoA. Probes for Southern blots in D are marked with
thick horizontal lines. Map position of the probed restriction
fragments with size in kilobases is shown below the maps.
aadA, Chimeric spectinomycin resistance gene (Svab and
Maliga, 1993); rpoA, rpoB,
rpoC1, and rpoC2, the plastid genes
encoding the -, -, -, and "-subunits of PEP, respectively;
atpI, petD, rps2, and
rps11, plastid genes (Shinozaki et al., 1986).
Restriction endonuclease cleavage sites: H, HincII; X,
XbaI; Bg, BglII; Sc, ScaI;
P, PstI; B, BamHI; Pp,
Psp1406I; A, AccI; SI,
SacI; SII, SacII; StI,
StuI; E, EcoRV; Bs, BsrGI.
Brackets indicate restriction sites eliminated during cloning. B,
Deletion of the rpoC1 gene. Homologous recombination
events (crossed lines) between ptDNA sequences in vector pGS97 and the tobacco plastid
genome yields a genome lacking rpoC1. C, Deletion of the
rpoC2 gene. Homologous recombination events (crossed
lines) between ptDNA sequences in vector pGS99 and the tobacco plastid
genome yields a genome lacking rpoC2. D, Southern
probing demonstrates a uniform population of transformed plastid
genomes. Total cellular DNA was isolated from the leaves of plants
transformed with plasmids pGS95 (targeting rpoA), pGS97
(targeting rpoC1), and pGS99 (targeting
rpoC2), and from wild-type green leaves (WT). Data are
shown for two independently transformed lines (pGS95-2, pGS95-3), or
two plants derived from the same transformation event (pGS97-2.2,
pGS97-2.3 and pGS99-4.1, pGS99-4.4).
|
|
View larger version (54K):
[in this window]
[in a new window]
| Figure 2.
Isolation of homoplasmic rpoA
plants. A, Callus and shoots carrying a mixed population of wild-type
and rpoA plastid genomes are green. B, Chimeric
leaves with white (transgenic) and green (wild-type) sectors. C, White,
homoplasmic rpoA plant with transgenomes only.
|
|
Plastid Transcript Accumulation Pattern Is Similar in All Plastid
rpo-Deleted Mutants
Deletion of genes for essential PEP subunits prevents assembly of
functional PEP enzyme. In the absence of PEP activity, mRNAs will
accumulate at significant levels only from NEP promoters. The mRNAs
initiating from PEP promoters will be absent. However, transcripts for
genes with PEP promoters only may be present at low levels due to
read-through transcription from upstream NEP promoters and processing
(Allison et al., 1996; Hajdukiewicz et al., 1997). We expect that if
NEP and PEP share a subunit, deletion of the relevant rpo
gene should prevent mRNA accumulation from both PEP and NEP promoters.
Therefore, steady-state mRNA level in the rpo plants was
determined for a number of plastid genes (Fig.
3). The rbcL gene in tobacco
plastids is transcribed from a PEP promoter. Accumulation of
rbcL mRNA in each of the rpo deletion derivatives
at significantly reduced (25-fold lower) levels is consistent with the
lack of transcription from the PEP promoter, and with the accumulation
of processed read-through transcripts (Allison et al., 1996). The
atpB, 16SrDNA, and clpP genes have both PEP and NEP promoters (Allison et al., 1996; Hajdukiewicz et al.,
1997). High steady-state levels of mRNAs for each of these genes in the
rpo plants is consistent with sustained NEP promoter activity. The accD gene in tobacco is transcribed from a NEP
promoter from which mRNA accumulation in wild-type chloroplasts is low, while it is highly elevated in rpoB plants (Hajdukiewicz
et al., 1997). Accumulation of accD mRNA in the
rpoA, rpoC1, and rpoC2 deletion
derivatives is elevated as in the rpoB plants (Fig. 3).
Sustained NEP activity in the rpo-deleted plants indicates the lack of contribution of the PEP -, -, and "-subunit
to NEP function.
View larger version (66K):
[in this window]
[in a new window]
| Figure 3.
Accumulation of plastid mRNAs in wild-type and
plastid rpo gene deletion derivatives. Data are shown
for genes carrying only PEP promoters (rbcL), only NEP
promoters (accD), or PEP and NEP promoters
(clpP, 16S rDNA, atpB) in
wild-type, rpoA, rpoB,
rpoC1, and rpoC2 leaves. The excess
of wild-type over rpo intensities (average of the
four rpo lines) for each probe is given in
parentheses. Gel blots were prepared with total leaf RNA (5 µg per
lane) from wild-type plants, and in plants transformed with plasmids
pGS95 (rpoA), pGS97 (rpoC1), and
pGS99 (rpoC2). Upper panels show blots probed for
plastid genes. Lower panels show loading controls, obtained by probing
the same filters for the cytoplasmic 25S rRNA. The blots were scanned
with a phosphor imager (Molecular Dynamics, Sunnyvale, CA).
Hybridization signals were quantified with Imagequant software
(Molecular Dynamics) and normalized to the 25S rRNA signal.
|
|
Promoter Utilization Is Identical in All rpo
Deletion Lines
Many of the plastid genes have multiple promoters. Therefore, it
was important to show which of the promoters are active in the
rpo plants. Transcription activity from previously
characterized NEP and PEP promoters was determined by mapping
transcript 5 ends with primer-extension analysis.
The photosynthetic rbcL gene is transcribed from a single
PEP promoter (PrbcL-182 in wild-type tobacco chloroplasts
[Shinozaki and Sugiura, 1982]). This promoter is not active in the
rpo-deletion derivatives (Fig.
4). The 5 end at position 59
(indicated by  in Fig. 4) derives from longer transcripts by
processing in both wild-type and rpo mutants (Mullet et
al., 1985; Allison et al., 1996). The atpB gene in wild-type
tobacco is transcribed from four promoters (Fig. 4; Hajdukiewicz et
al., 1997). The PatpB-255, PatpB-488/-502, and
PatpB-611 PEP promoters are active in the wild-type, but not
in the rpo plants (Fig. 4). In contrast, the PatpB-289 NEP promoter is active in the leaves of wild-type
and rpo plants. The tobacco rRNA operon (rrn)
has one promoter for each of the two RNA polymerases (Vera and Sugiura,
1995; Allison et al., 1996). The PEP promoter initiates transcription
113 and 114 bp upstream of the mature 16SrRNA in wild-type leaves,
whereas it is inactive in the rpo-deleted plants. In
contrast, the Prrn-62 NEP promoter is inactive in wild-type
leaves, but active in the rpo deletion derivatives (Fig. 4).
The clpP gene is transcribed from four promoters
(Hajdukiewicz et al., 1997; fig. 5B). Although the PEP
transcript (PclpP-95) is absent in all
rpo-deleted lines, the activity of the three NEP promoters
(PclpP-53, PclpP-173, PclpP-511) is
evident in the rpo mutants (Fig. 4; Hajdukiewicz et al.,
1997). Finally, accD has one NEP promoter. This promoter, located 129 bp upstream of the accD- coding region
(Hajdukiewicz et al., 1997), is active in the lines deficient in the
PEP -, -, -, and "-E. coli-like subunits (Fig.
4). In summary, the PEP promoters (six tested) were inactive, whereas
transcription initiated at the same position from each of the six NEP
promoters tested in the rpoA-, rpoB-, rpoC1-, and
rpoC2-deletion derivatives.
View larger version (55K):
[in this window]
[in a new window]
| Figure 4.
Mapping of transcription-initiation sites in
plastids of wild-type and rpo-deletion derivatives.
Primer-extension data are shown for the rbcL,
atpB, 16SrDNA, clpP, and
accD genes. Mapped NEP ( ) and PEP ( ) promoters are
identified by the distance between the transcription-initiation site
and the translation-initiation codon (ATG) in nucleotides (Allison et
al., 1996; Hajdukiewicz et al., 1997). Processing sites are also marked
(). Schematic maps with transcription-initiation sites for NEP and
PEP promoters are shown at the bottom of the figure.
|
|
| |
DISCUSSION |
The first successful targeted deletion of a plastid RNA polymerase
subunit gene was that of rpoB from the tobacco plastid genome (Allison et al., 1996). We report here deletion of the genes for
the remaining core subunits of the plastid-encoded RNA polymerase
(rpoA, rpoC1, and rpoC2). We propose
that deletion of the rpo genes from the plastid genome is
possible because NEP, an alternative, nucleus-encoded enzyme
transcribes all essential housekeeping and metabolic genes. Attempts at
targeted deletion of the plastid rpoB1, rpoB2, or
rpoC2a genes in the unicellular alga Chlamydomonas
reinhardtii failed to yield homoplasmic cells lacking PEP
(Rochaix, 1997). Therefore, C. reinhardti may not have NEP,
or it may have NEP but transcription of at least some of the essential
genes is dependent on PEP. NEP promoters are active in the liverwort
Marchantia polymorpha and the conifer Pinus
contorta, indicating duplication of the plastid-transcription machinery early during the evolution of the land plants (D. Silhavy and
P. Maliga, unpublished data).
Deletion of the plastid rpo genes in this study led to the
loss of transcription from 70-type PEP
promoters and to a mutant phenotype. These findings indicate that
subunits of the E. coli-like plastid RNA polymerase are the
products of plastid genes and that no functional copy of the
rpo genes exists outside the plastids, which could
complement the deleted-plastid rpo genes. Our experiments
extend the earlier work of Bogorad and coworkers, who provided evidence
for the contribution of the plastid rpo genes to the plastid
RNA polymerase activity by sequencing the N-terminal amino acids of a
purified maize RNA polymerase (Hu and Bogorad, 1990; Hu et al., 1991).
Contribution of plastid rpo genes to plastid RNA polymerase
activity was also shown by the sensitivity of in vitro transcription to
antibodies obtained in rabbits immunized with fusion peptides expressed
from genes containing rpo gene segments (Little and Hallick,
1988).
We report here that deletion of the plastid-encoded PEP subunit genes
does not affect NEP transcription specificity, so PEP subunits are not
shared with NEP. The -subunit gene could be deleted without
interfering with the expression of other plastid genes since
rpoA is the last open reading frame of the rpl23
operon. Interpretation of data in plants lacking the "-subunit gene
was also unambiguous, since rpoC2 is the last gene of the
rpoB operon. rpoC1 is the second gene of the
rpoB operon, which, after deletion of rpoC1,
consists of three genes: rpoB, aadA (replacing
rpoC1), and rpoC2. Since polycistronic mRNAs are
efficiently translated on the plastid ribosomes (Staub and Maliga,
1995), it is likely that deletion of rpoC1 does not
interfere with the expression of the downstream rpoC2 gene.
Furthermore, deletion of rpoC1 could only affect the
expression of rpoC2 already shown to be nonessential for NEP
activity. Transcription of the rpoB operon initiates 345 nucleotides upstream of rpoB (nucleotide position 27846 in
the plastid genome; G. Serino and P. Maliga, unpublished data). In the
previously described rpoB plant (Allison et al., 1996),
expression of the entire rpoB operon should be affected
since the deletion included the operon promoter. Therefore, the
rpoC2, rpoC1, and rpoB plants
form a series lacking the " (rpoC2), and possibly " (rpoC1), and , , and "
(rpoB) PEP subunits. Collectively, these data indicate
that none of the PEP subunits is part of the NEP complex.
Identification of NEP subunits will depend on purification of the NEP
enzyme and development of an in vitro transcription assay. Important
steps in this direction were the cloning of the gene for a 113-kD
protein, the likely catalytic subunit of NEP (Hedtke et al., 1997), and
identification of promoters recognized by the NEP-transcription
machinery (Allison et al., 1996; Hajdukiewicz et al., 1997;
Hübschmann and Börner, 1998).
| |
FOOTNOTES |
1
This research was supported by the National
Science Foundation (grant no. MCB96-30763). G.S. was the recipient of a
Johanna and Charles Busch Predoctoral Fellowship award.
*
Corresponding author; e-mail maliga{at}waksman.rutgers.edu; fax
1-732-445-5735.
Received February 11, 1998;
accepted May 5, 1998.
| |
ABBREVIATIONS |
Abbreviations:
NEP, nuclear-encoded plastid RNA
polymerase.
PEP, plastid-encoded plastid RNA polymerase.
ptDNA, plastid DNA.
| |
LITERATURE CITED |
Allison A,
Simon D,
Maliga P
(1996)
Deletion of rpoB reveals a second distinct transcription system in plastids of higher plants.
EMBO J
15:
2802-2809
[Web of Science][Medline]
Allison LA,
Maliga P
(1995)
Light-responsive and transcription-enhancing elements regulate the plastid psbD core promoter.
EMBO J
14:
3721-3730
[Web of Science][Medline]
Gruissem W,
Tonkyn JC
(1993)
Control mechanisms of plastid gene expression.
Crit Rev Plant Sci
12:
19-55
Hajdukiewicz PTJ,
Allison LA,
Maliga P
(1997)
The two RNA polymerases encoded by the nuclear and the plastid compartments transcribe distinct groups of genes in tobacco plastids.
EMBO J
16:
4041-4048
[CrossRef][Web of Science][Medline]
Hedtke B,
Börner T,
Weihe A
(1997)
Mitochondrial and chloroplast phage-type RNA polymerases in Arabidopsis.
Science
277:
809-811
[Abstract/Free Full Text]
Hess WR,
Prombona A,
Fieder B,
Subramanian AR,
Börner T
(1993)
Chloroplast rps15 and the rpoB/C1/C2 gene cluster are strongly transcribed in ribosome-deficient plastids: evidence for a functioning non-chloroplast-encoded RNA polymerase.
EMBO J
12:
563-571
[Web of Science][Medline]
Hu J,
Bogorad L
(1990)
Maize chloroplast RNA polymerase: the 180-, 120-, and 38-kilodalton polypeptides are encoded in chloroplast genes.
Proc Natl Acad Sci USA
87:
1531-1535
[Abstract/Free Full Text]
Hu J,
Troxler RF,
Bogorad L
(1991)
Maize chloroplast RNA polymerase: the 78-kilodalton polypeptide is encoded by the plastid rpoC1 gene.
Nucleic Acids Res
19:
3431-3434
[Abstract/Free Full Text]
Hübschmann T,
Börner T
(1998)
Characterization of transcription initiation sites in ribosome-deficient barley plastids.
Plant Mol Biol
36:
493-496
[CrossRef][Web of Science][Medline]
Igloi GL,
Kössel H
(1992)
The transcriptional apparatus of chloroplasts.
Crit Rev Plant Sci
10:
525-558
Isono K,
Shimizu M,
Yoshimoto K,
Niwa Y,
Satoh K,
Yokota A,
Kobayashi H
(1997)
Leaf-specifically expressed genes for polypeptides destined for chloroplasts with domains for 70 factors of bacterial RNA polymerases in Arabidopsis thaliana.
Proc Natl Acad Sci USA
94:
14948-14953
[Abstract/Free Full Text]
Lerbs-Mache S
(1993)
The 110-kDa polypeptide of spinach plastid DNA-dependent RNA polymerase: single-subunit enzyme or catalytic core of multimeric enzyme complexes?
Proc Natl Acad Sci USA
90:
5509-5513
[Abstract/Free Full Text]
Link G
(1996)
Green life: control of chloroplast gene transcription.
Bioessays
18:
465-471
[CrossRef]
Little MC,
Hallick RB
(1988)
Chloroplast rpoA, rpoB, and rpoC genes specify at least three components of a chloroplast DNA-dependent RNA polymerase active in tRNA and mRNA transcription.
J Biol Chem
263:
14302-14307
[Abstract/Free Full Text]
Maliga P
(1998)
Two plastid RNA polymerases of higher plants: an evolving story.
Trends Plant Sci
3:
4-6
Mettler IJ
(1987)
A simple and rapid method for minipreparation of DNA from tissue cultured plant cells.
Plant Mol Biol Rep
5:
346-349
Morden CW,
Wolfe KH,
dePamphilis CW,
Palmer JD
(1991)
Plastid translation and transcription in a non-photosynthetic plant: intact, missing and pseudo genes.
EMBO J
10:
3281-3288
[Web of Science][Medline]
Mullet JE,
Orozco EM,
Chua NH
(1985)
Multiple transcripts for higher plant rbcL and atpB genes and localization of the transcription initiation site of the rbcL gene.
Plant Mol Biol
4:
39-54
Murashige T,
Skoog F
(1962)
A revised medium for rapid growth and bioassays with tobacco tissue culture.
Physiol Plant
15:
493-497
Pfannschmidt T,
Link G
(1994)
Separation of two classes of plastid DNA-dependent RNA polymerases that are differentially expressed in mustard (Sinapis alba L.) seedlings.
Plant Mol Biol
25:
69-81
[CrossRef][Web of Science][Medline]
Rochaix JD
(1997)
Chloroplast reverse genetics: new insights into the function of plastid genes.
Trends Plant Sci
2:
419-425
[CrossRef]
Sentenac A,
Riva M,
Thuriaux P,
Buhler JM,
Treich I,
Carles C,
Werner M,
Ruet A,
Huet J,
Mann C,
and others
(1992)
Yeast RNA polymerase subunits and genes.
In
KR Yamamoto,
SL McKnight,
eds, Transcriptional Regulation.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 27-54
Shinozaki K,
Ohme M,
Tanaka M,
Wakasugi T,
Hayashida N,
Matsubayashi T,
Zaita N,
Chunwongse J,
Obokata J,
Yamaguchi-Shinozaki K,
and others
(1986)
The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expression.
EMBO J
5:
2043-2049
[Web of Science][Medline]
Shinozaki K,
Sugiura M
(1982)
The nucleotide sequence of the tobacco chloroplast gene for the largest subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase.
Gene
20:
91-102
[CrossRef][Web of Science][Medline]
Staub JM,
Maliga P
(1995)
Expression of a chimeric uidA gene indicates that polycistronic mRNAs are efficiently translated in tobacco plastids.
Plant J
7:
845-848
[CrossRef][Web of Science][Medline]
Svab Z,
Hajdukiewicz PTJ,
Maliga P
(1990)
Stable transformation of plastids in higher plants.
Proc Natl Acad Sci USA
87:
8526-8530
[Abstract/Free Full Text]
Svab Z,
Maliga P
(1993)
High-frequency plastid transformation in tobacco by selection for a chimeric aadA gene.
Proc Natl Acad Sci USA
90:
913-917
[Abstract/Free Full Text]
Tanaka K,
Tozawa Y,
Mochizuki N,
Shinozaki K,
Nagatani A,
Wakasa K,
Takahashi H
(1997)
Characterization of three cDNA species encoding plastid RNA polymerase sigma factors in Arabidopsis thaliana: evidence for the sigma factor heterogeneity in higher plant plastids.
FEBS Lett
413:
309-313
[CrossRef][Web of Science][Medline]
Vera A,
Sugiura M
(1995)
Chloroplast rRNA transcription from structurally different tandem promoters: an additional novel-type promoter.
Curr Genet
27:
280-284
[CrossRef][Web of Science][Medline]
Zoubenko OV,
Allison LA,
Svab Z,
Maliga P
(1994)
Efficient targeting of foreign genes into the tobacco plastid genome.
Nucleic Acids Res
22:
3819-3824
[Abstract/Free Full Text]
This article has been cited by other articles:
|
|
|
|
 
Z. Svab and P. Maliga
From the Cover: Exceptional transmission of plastids and mitochondria from the transplastomic pollen parent and its impact on transgene containment
PNAS,
April 24, 2007;
104(17):
7003 - 7008.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Nagashima, M. Hanaoka, T. Shikanai, M. Fujiwara, K. Kanamaru, H. Takahashi, and K. Tanaka
The Multiple-Stress Responsive Plastid Sigma Factor, SIG5, Directs Activation of the psbD Blue Light-Responsive Promoter (BLRP) in Arabidopsis thaliana
Plant Cell Physiol.,
April 15, 2004;
45(4):
357 - 368.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Liere, D. Kaden, P. Maliga, and T. Borner
Overexpression of phage-type RNA polymerase RpoTp in tobacco demonstrates its role in chloroplast transcription by recognizing a distinct promoter type
Nucleic Acids Res.,
February 18, 2004;
32(3):
1159 - 1165.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Yao, S. Roy-Chowdhury, and L. A. Allison
AtSig5 Is an Essential Nucleus-Encoded Arabidopsis {sigma}-Like Factor
Plant Physiology,
June 1, 2003;
132(2):
739 - 747.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Kanamaru, A. Nagashima, M. Fujiwara, H. Shimada, Y. Shirano, K. Nakabayashi, D. Shibata, K. Tanaka, and H. Takahashi
An Arabidopsis Sigma Factor (SIG2)-Dependent Expression of Plastid-Encoded tRNAs in Chloroplasts
Plant Cell Physiol.,
October 1, 2001;
42(10):
1034 - 1043.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Kapoor and M. Sugiura
Identification of Two Essential Sequence Elements in the Nonconsensus Type II PatpB-290 Plastid Promoter by Using Plastid Transcription Extracts from Cultured Tobacco BY-2 Cells
PLANT CELL,
September 1, 1999;
11(9):
1799 - 1810.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
C.-C. Chang, J. Sheen, M. Bligny, Y. Niwa, S. Lerbs-Mache, and D. B. Stern
Functional Analysis of Two Maize cDNAs Encoding T7-like RNA Polymerases
PLANT CELL,
May 1, 1999;
11(5):
911 - 926.
[Abstract]
[Full Text]
|
|
|
|
|
Top
Abstract
Introduction