|
Plant Physiol. (1998) 117: 1423-1431
Dedicated Roles of Plastid Transketolases during the Early Onset
of Isoprenoid Biogenesis in Pepper Fruits1
Florence Bouvier,
Alain d'Harlingue,
Claude Suire,
Ralph A. Backhaus, and
Bilal Camara*
Institut de Biologie Moléculaire des Plantes du Centre
National de la Recherche Scientifique and Université Louis
Pasteur, 12 rue du Général Zimmer, 67084 Strasbourg, France
(F.B., B.C.); Laboratoire de Pathologie et Biochimie
Végétales, Université Pierre et Marie Curie, 4 Place
Jussieu, 75250 Paris, France (A.d.'H.); Laboratoire de Pathologie et Biochimie
Végétales, Université Pierre et Marie Curie, 4 Place
Jussieu, 75250 Paris, France (A.d.'H.)Institut de Biochimie et
Génétique Cellulaire du Centre National de la Recherche
Scientifique, 1 rue Camille Saint Saëns, 33077 Bordeaux, France
(C.S.); and Department of Botany, P.O. Box 871601, Arizona State
University, Tempe, Arizona 85287-1601 (R.A.B.)
 |
ABSTRACT |
Isopentenyl diphosphate (IPP), which
is produced from mevalonic acid or other nonmevalonic substrates, is
the universal precursor of isoprenoids in nature. Despite the presence
of several isoprenoid compounds in plastids, enzymes of the mevalonate
pathway leading to IPP formation have never been isolated or identified
to our knowledge. We now describe the characterization of two pepper (Capsicum annuum L.) cDNAs, CapTKT1 and CapTKT2, that
encode transketolases having distinct and dedicated specificities.
CapTKT1 is primarily involved in plastidial pentose phosphate and
glycolytic cycle integration, whereas CapTKT2 initiates the synthesis
of isoprenoids in plastids via the nonmevalonic acid pathway. From
pyruvate and glyceraldehyde-3-phosphate, CapTKT2 catalyzes the
formation of 1-deoxy-xylulose-5-phosphate, the IPP precursor. CapTKT1
is almost constitutively expressed during the
chloroplast-to-chromoplast transition, whereas CapTKT2 is overexpressed
during this period, probably to furnish the IPP necessary for increased
carotenoid biosynthesis. Because deoxy-xylulose phosphate is shared by
the plastid pathways of isoprenoid, thiamine (vitamin B1),
and pyridoxine (vitamin B6) biosynthesis, our results may
explain why albino phenotypes usually occur in thiamine-deficient
plants.
 |
INTRODUCTION |
Because of the combined activities of mevalonate-synthesizing and
-activating enzymes, IPP is known as the universal isoprenoid building
block. How IPP is synthesized and channeled into plastid isoprenoids to
support the production of carotenoids, chlorophylls, prenylquinones,
and diterpenes is largely unknown. Two hypotheses have been proposed.
One is that plastids operate autonomously, synthesizing plastid
isoprenoids directly from carbon dioxide or from plastid glycolytic
intermediates such as pyruvate (Goodwin, 1971 ; Moore and Shephard,
1978 ; Heintze et al., 1990 , 1994 ; McCaskill and Croteau, 1995 ).
However, the mechanism of carbon flow via a pyruvate intermediate is
unknown for plants. A second hypothesis is that IPP is transported from
the cytosol (Kleinig, 1989 ), which is based on the finding that
hydroxymethylglutaryl CoA reductase and mevalonate-activating enzymes
are absent in plastids (Gray, 1987 ). This view is reinforced by the
fact that mevilonin, a specific inhibitor of
3-hydroxy-3-methylglutaryl-CoA reductase, drastically inhibits
cytosolic sterol biosynthesis at moderate concentrations but does not
affect isoprenoid synthesis in plastids (Bach and Lichtenthaler, 1983 ).
This led to consideration of an alternative IPP-generation system. In
fact, such a pathway is known for prokaryotes, in which IPP is formed
via deoxy-xylulose phosphate rather than by mevalonate (Rohmer et al.,
1993 ) in a transketolation reaction between pyruvate and
glyceraldehyde-3-phosphate (Rohmer et al., 1996 ). In vivo precursor
labeling indicates that a similar pathway operates for the synthesis of
ginkgolides (Schwarz, 1994 ) and plastid isoprenoids (Schwender et al.,
1996 ; Arigoni et al., 1997 ; Lichtenthaler et al., 1997a , 1997b ).
In this study we identified and characterized from pepper
(Capsicum annuum L.) fruits two plastid transketolases,
CapTKT1 and CapTKT2, which are dedicated to specific functions. CapTKT1 is primarily engaged in plastid pentose phosphate and glycolytic cycle
integration. CapTKT2 irreversibly converts pyruvate and glyceraldehyde-3-phosphate into deoxy-xylulose phosphate, which then
behaves as the plastidial IPP precursor via the putative intermediate
2-C-methyl-D-erythritol (Duvold et al., 1997 ). This pathway
has no steps in common with cytoplasmic IPP synthesis, which proceeds
via the mevalonic acid pathway. Our data also suggest that plastid
isoprenoid biosynthesis is tightly coupled to that of thiamine (vitamin
B1) (David et al., 1981 ; Julliard and Douce, 1991 ) and pyridoxine (vitamin B6) (Hill et al.,
1989 ; Julliard, 1992 ) biosynthesis.
 |
MATERIALS AND METHODS |
Plant Materials and Organelle Isolation
Pepper (Capsicum annuum L. cv Yolo
Wonder) plants were grown under controlled greenhouse conditions.
Chloroplasts and chromoplasts from pepper fruit were prepared as
described previously (Camara, 1993 ). Mitochondria were isolated and
purified by Percoll-gradient centrifugation (Neuburger et al., 1982 ).
The purity of the subcellular fractions was monitored by
electron-microscopic analysis (Deruère et al., 1994 ).
Antibody Preparation
A partially purified pepper chromoplast transketolase, obtained as
described previously (Murphy and Walker, 1982 ), was used to prepare
polyclonal antibodies against CapTKT1 (Harboe and Ingild, 1977 ).
Anti-CapTKT1 was further affinity purified (Smith and Fisher, 1984 )
before immunoscreening or immunoblot analysis. Anti-CapTKT2 was
prepared from the recombinant protein devoid of the plastid-targeting sequence.
cDNA Isolation and Analysis
Total RNA was isolated as described previously (Verwoerd et
al., 1989 ) and poly(A+) RNA was purified using an
mRNA purification kit (Qiagen, Chatsworth, CA) following the
manufacturer's instructions. Following immunoscreening of the pepper
cDNA library (Bouvier et al., 1996 ) according to standard methods
(Huynh et al., 1985 ; Sambrook et al., 1989 ), three overlapping partial
cDNAs designated as CapTKT1 and having 1040, 1030, and 550 bp were
isolated. Sequence analysis revealed that these CapTKT1 lacked their
5 -prime ends, whereas the 550-bp fragment contained the 3 -prime end
of the cDNA. The 5 -end of CapTKT1 was obtained by RACE. The 5 -RACE
was performed using the 5 RACE kit (GIBCO-BRL) according to the
manufacturer's instructions.
First-strand cDNA synthesis used the specific CapTKT1 internal
oligonucleotide GST1: CTCAAAGTTTTCAGGGTG. Following C-tailing the
CapTKT1-specific oligonucleotide GST2, ATGTCCAGCGGAGAGAAC, was used in
combination with the anchor primers (GIBCO-BRL) for PCR (30 cycles)
according to the program: 94°C for 1 min, 55°C for 1 min, 72°C
for 2 min, and 72°C for 7 min. Purified PCR products were cloned into
pBluescript SK vector and both strands were
sequenced. For the second transketolase, a BLAST search for
transketolase-homologous plant sequences allowed indentification of a
cDNA clone, designated CLA1 for "altered chloroplasts" (Mandel et
al., 1996 ), several EST clones from Arabidopsis (W43388), rice (D46713
and D46576), and castor bean (T14878), and an Arabidopsis genomic
sequence (Z97339) displaying characteristic transketolase motifs
(Hawkins et al., 1989 ; Schenk et al., 1997 ) but with a deduced sequence
that was very different from CapTKT1.
The sense oligonucleotide CTTTGGGATGTTGGTCATCAG, coding for the
sequence LWDVGHQ (Arabidopsis EST, W43388), and the antisense oligonucleotide AACGTGCGAGCCAAAACCTCC, coding for GGFGSHV (Arabidopsis genomic sequence, Z97339), were used to amplify a 1550-bp probe by
reverse transcriptase-PCR, using pepper fruit
poly(A+) mRNA, according to the program described
above. After sequence verification, the 1550-bp probe was used to
isolate a 600-bp fragment containing the 3 -prime end of the cDNA from
the pepper cDNA library. The 5 -prime end of the cDNA was isolated by
5 -RACE, as described above using the gene-specific probe GST1,
GTCGTTTAAAATAACAAT. After C-tailing the gene-specific oligonucleotide
GST2, GATGGTGGTGGAACTGTGGCC, was used in combination with the anchor
primers (GIBCO-BRL) for PCR according to the program described for
CapTKT1 5 -RACE. The resulting fragment was cloned into plasmid
pBluescript SK and both strands were sequenced.
Sequence data were analyzed using computer programs of the University
of Wisconsin Genetics Computer Group (Madison) (Devereux et al., 1984 ).
Expression and Purification
To express CapTKT1 and CapTKT2, the corresponding open reading
frames devoid of the transit peptide sequences were amplified by PCR according to the above- described program and cloned
into the PKK223-3 expression vector (Pharmacia). To this end, sense oligonucleotide CCGGAATTCATGCGCACTCTTCCGTCCCCCGTCGCC (encoding the
peptide sequence RTLPSPVA), containing an EcoRI site, and the antisense oligonucleotide
CCCAAGCTTAACAACTTTGGTAGACACCAGTAA, containing a
HindIII site, were used for CapTKT1. Similarly,
the sense oligonucleotide TCCCCCCGGGATGACGGTTCAGGCTTCTTTGTCAGAA
(encoding the peptide sequence TVQASLSE), containing a
XmaI site, and the antisense oligonucleotide
TCCCCCCGGGTAATATACATTCTTTTACAGTTCT, containing a XmaI site,
were used to amplify the coding region of CapTKT2. In the latter case,
the orientation of the insert was verified by PCR and
restriction-endonuclease digestion. After sequence verification,
PKK223-3 containing CapTKT1 or CapTKT2 was used
to transform competent Escherichia coli JM109.
Site-directed mutagenesis was carried out as previously described
(Bouvier et al., 1997 ) using a site-directed mutagenesis kit
(QuickChange, Stratagene). For CapTKT1 the amino acid change (Glu-491
to Ala) was introduced using the sense mutagenic oligonucleotide TTTGGTGTTCGTGCACATGGTATGGGA and the corresponding antisense
oligonucleotide. For CapTKT2 the change (Glu-449 to Ala) was introduced
using the sense GTTGGAATAGCAGCACAACATGCAGTA and the
corresponding antisense oligonucleotide. Mutants CapTKT1 and
CapTKT2 were expressed as shown for the corresponding wild-type
enzymes.
To purify the expressed proteins, E. coli harboring
CapTKT1 or CapTKT2 open reading frames was grown at 28°C to
A = 0.4 in Luria-Bertani medium (1 L) before induction with 0.25 mM IPTG for 4 h. The cells were pelleted by
centrifugation at 5,000g for 10 min before resuspension in
50 mM Tris-HCl buffer, pH 7.6, containing 5 mM
MgCl2, 50 µM thiamine diphosphate,
and 2 mM DTT. After sonication on ice at 10-s intervals for
a total of 2 min, the soluble supernatant obtained after
10,000g centrifugation for 10 min was used for protein
purification. To this end, the supernatant was loaded directly to a
Q-Sepharose Fast-Flow column (2 × 30 cm, Pharmacia) equilibrated
with 50 mM Tris-HCl buffer, pH 7.6, containing 5 mM MgCl2, 50 µM
thiamine diphosphate, and 2 mM DTT (buffer A). After
washing with 50 mM NaCl in the same buffer, the column was developed with a linear gradient of 50 to 250 mM NaCl in
buffer A. The active fractions were pooled and diluted 5-fold with
buffer A before Mono-Q HR (Pharmacia) column chromatography. Active
fractions were eluted with the same linear gradient and used for
enzymatic assays as described below.
Enzyme Assay and Analysis of Products
Two procedures were used to evaluate the transketolase activities.
In the first procedure, tranketolase activity was assayed by monitoring
the formation of D-glyceraldehyde-3-phosphate during the C2
transfer from D-xylulose-5-phosphate to
D-erythrose-4-phosphate or D-Rib-5-phosphate
using a coupled assay. The standard 100-µL reaction volume contained
50 mM Tris-HCl buffer, pH 7.6, 5 mM of each
substrate, 500 µM thiamine diphosphate, 10 mM
MgCl2, 250 µM NADH, 15 units of
triose phosphate isomerase (Sigma), 5 units of glycerol-3-phosphate
dehydrogenase (Sigma), and a definite amount of recombinant CapTKT1 and
CapTKT2 devoid of the plastid-targeting sequence. Following incubation
at 30°C, the decrease of NADH concentration was monitored
spectrophotometrically by the decrease in
A340.
For the second procedure, transketolase activity was assayed by
monitoring the C2 transfer of [2-14C] pyruvate
(26 mCi mol 1, New England Nuclear) to
D-glyceraldehyde-3-phosphate. The reaction was performed in
a volume of 100 µL, and contained 50 mM Tris-HCl buffer,
pH 7.6, 5 mM pyruvic acid (2 µCi), 5 mM
D-glyceraldehyde-3-phosphate, 500 µM thiamine
diphosphate, 10 mM MgCl2, and a
definite amount of enzyme. Following incubation at 30°C, the reaction
was stopped by the addition of 5% TCA. Insoluble proteins were removed
by centrifugation for 5 min in a microfuge at 4°C. The
supernatant was adjusted to pH 9.0 and treated with 10 units of bovine
alkaline phosphatase before further incubation for 1 h at 37°C.
Reactions were stopped by the addition of 4 volumes of cold acetone
followed by centrifugation. After addition of authentic unlabeled
deoxy-xylulose synthesized as described previously (Yokota and
Sasajima, 1984 , 1986 ) or kindly provided by Ian D. Spenser (MacMaster
University, Hamilton, Ontario, Canada), the supernatant was spotted
onto Silicagel 60 plates developed with the solvent system
(acetone:ethylacetate; 1:1, v/v). Reaction products were identified by
autoradiography and by spraying the plates with vanillin-perchloric
reagent (MacLennan et al., 1959 ). Alternatively, disposable Silicagel
60 microcolumns eluted with the same solvent system were used to
monitor the radioactivity incorporated into deoxy-xylulose.
Incorporated radioactivity was determined by liquid-scintillation
counting.
Other Methods
Protein concentrations were determined according to the
dye-binding procedure (Bradford, 1976 ). Immunoblot and northern
analyses of CapTKT1 and CapTKT2 were performed as described previously (Bouvier et al., 1996 ).
 |
RESULTS |
The Role of Transketolase in Generating Carbon-Carbon
Condensations
Indirect evidence of a precursor-product relationship or carbon
flow between carbohydrate and isoprenoid synthesis during chloroplast-to-chromoplast differentiation was suggested by the active
pentose phosphate and glycolytic cycles (Thom et al., 1998 ) and the
total disappearance of starch, which coincides with the intense
accumulation of carotenoids that occurs in chromoplasts of ripening,
nonmutant pepper fruits (Camara et al., 1995 ). More recently,
incorporation of 13C-labeled Glc into plant cells
(Eisenreich et al., 1996 ; Schwender et al., 1996 ; Arigoni et al., 1997 ;
Knöss et al., 1997 ; Lichtenthaler et al., 1997b ) followed by NMR
analysis led to new insights about the conversion of carbohydrate
precursors into IPP. The new pathway proposes the condensation between
the C2 unit from pyruvate and the C3 acceptor
glyceraldehyde-3-phosphate to yield deoxy-xylulose phosphate, the
nonmevalonic precursor of IPP (Rohmer et al., 1996 ; Arigoni et al.,
1997 ).
The above proposed pathway of carbon-carbon condensations is
reminiscent of a transketolation reaction catalyzed by several enzymes
from microorganisms (Yokota and Sasajima, 1984 ). This mechanism has
been used to generate several classes of compounds (Villafranca and
Axelrod, 1971 ; Bolte et al., 1987 ; Kobori et al., 1992 ; Hobbs et al.,
1993 ). To identify putative transketolases involved in plastid
isoprenoid biosynthesis we first raised antibodies against partially
purified chromoplast transketolase from pepper, and selected from the
National Center for Biotechnology Information (Bethesda, MD)
appropriate ESTs encoding characteristic transketolase motifs (Hawkins
et al., 1989 ; Reizer et al., 1993 ; Schenk et al., 1997 ).
Two strategies, immunoscreening and DNA hybridization, were used to
isolate two partial cDNAs, respectively designated CapTKT1 and CapTKT2,
from a pepper fruit library. The longest CapTKT1 and CapTKT2 clones
with ATG start codons isolated by the RACE procedure were 2232 and 2157 bp, respectively. CapTKT1 and CapTKT2 encode for 744 and 719 amino acid
proteins with respective molecular masses of 80.1 and 77.5 kD. The
predicted primary structure contains domains with potential functional
significance, including a transketolase motif (Schenk et al., 1997 ) and
a thiamine diphosphate-binding domain (Hawkins et al., 1989 ) (Fig.
1). Hydropathy plots of CapTKT1 and
CapTKT2 did not reveal significant transmembrane-spanning domains,
suggesting that both proteins are hydrophilic (results not shown).

View larger version (121K):
[in this window]
[in a new window]
| Figure 1.
Sequence alignment of CapTKT1 and CapTKT2 proteins
with related gene products. Black boxes indicate identity between
CapTKT1 (Captkt1) (accession no. Y15781) and CapTKT2 (Captkt2)
(accession no. Y15782) with ClaI protein from
Arabidopsis (Cla1) (Mandel et al., 1996 ), putative
Rhodobacter (Rhotkt2) (accession no. P26242),
Synechocystis (Syntkt2) (accession no. D90903), and
E. coli (Ecotkt2) (accession no. P77488) transketolases.
The underlined domain fits to the consensus thiamin diphosphate-binding
site (striped bar), which is well conserved among various
thiamine-dependent enzymes (Hawkins et al., 1989 ; Schenk et al., 1997 ),
and the transketolase motifs (Schenk et al., 1997 ) are indicated by the
striped and solid bars. The invariant Glu residue thought to be
specific for transketolase activity is indicated by a star. The
arrowheads indicate the amino terminus of the recombinant proteins
expressed in E. coli.
|
|
CapTKT1 and CapTKT2 displayed 21.6% amino acid identity with each
other. However, CapTKT1 shared 89%, 87%, and 82.7% amino acid
identity with potato (accession no. Q43848), Craterostigma plantagineum (Bernacchia et al., 1995 ), and spinach chloroplast (Flechner et al., 1996 ) transketolases, respectively. In addition, the
identity with E. coli and yeast transketolase varied from 52.3% to 53.7%. CapTKT2 also showed at least 80% amino acid identity with Arabidopsis CLA1 (Mandel et al., 1996 ) (Fig. 1), the Arabidopsis cDNA clone (Y14333), Arabidopsis genomic clone sequence (Z97339), and
several EST clones from Arabidopsis (W43388), pine (H75224), rice
(D46713 and D46576), and castor bean (T14878). In addition, CapTKT2
showed 45.6% to 54.4% amino acid sequence identity with the gene
product encoded by Synechocystis (D90903), E. coli (P77488), and Rhodobacter (P26242) open reading
frames (Fig. 1).
To localize CapTKT1 and CapTKT2 in pepper cells, antibodies
raised against recombinant CapTKT1 and CapTKT2 were used to
detect their presence in plastids and mitochondria. Intact and pure
chloroplasts, chromoplasts, and mitochondria were prepared from pepper
fruits (Fig. 2) and their total proteins
were subjected to western blotting against anti-CapTKT1 and
anti-CapTKT2 antibodies. Data displayed in Figure
3 reveal that CapTKT2 antibodies
specifically react with plastidial polypeptides having approximatively
a molecular mass of 67 to 70 kD, in good agreement with the mature size
predicted from CapTKT2 cDNA. No reactive polypeptide bands were
detected in mitochondria (Fig. 3). Similar results were obtained with
CapTKT1 (results not shown). Thus, CapTKT1 and CapTKT2 exclusively
colocalize in plastids, as suggested by the putative plastid-targeting
signal (Von Heijne et al., 1991 ) observed at the amino terminus of
CapTKT1 and CapTKT2 cDNAs (Fig. 1).

View larger version (120K):
[in this window]
[in a new window]
| Figure 2.
Electron micrograph showing the purity of pepper
cell organelles used for CapTKT2 localization in chloroplasts (A),
chromoplasts (B), and mitochondria (C). Bars, 1 µm.
|
|

View larger version (70K):
[in this window]
[in a new window]
| Figure 3.
SDS-PAGE and immunoblot analysis of CapTKT. A,
Coomassie blue-stained gel of proteins isolated from chloroplasts
(Chl), chromoplasts (Chr), and mitochondria (Mit). B, Immunoblot
analysis of organelle proteins shown in A with anti-CapTKT2. For both A
and B, molecular mass (MW) markers are shown on the left in kD.
|
|
To determine the biological function of CapTKT1 and CapTKT2, the coding
regions of both cDNAs were ligated to the bacterial vector pKK223-3
for expression in E. coli. Following IPTG induction and
SDS-PAGE analysis of samples of bacterial cultures, prominent polypeptide bands having molecular masses of 74 kD (CapTKT1) and 71 kD
(CapTKT2) were observed in extracts of transformed but not in
nontransformed E. coli cells (Fig.
4). Following lysis of bacterial cells
and centrifugation, recombinant CapTKT1 and CapTKT2 proteins recovered
in the supernatant were subjected to two chromatographic purification
steps using Q-Sepharose and Mono-Q columns (Fig. 4) before analyzing
their transketolase activity according to the two enzymatic procedures
described in the experimental section. Preliminary enzyme tests
were performed on purified CapTKT1 and CapTKT2 by incubating each
with D-xylulose-5-phosphate (a C2 donor) and
D-Rib-5-phosphate (a C2 acceptor), the two usual substrates of transketolases. Under these conditions only CapTKT1 showed significant activity (Table I), behaving
as previously characterized plastid transketolases (Murphy and Walker,
1982 ; Flechner et al., 1996 ).

View larger version (90K):
[in this window]
[in a new window]
| Figure 4.
Purification of recombinant CapTKT1 and CapTKT2. A
and B, Coomassie blue-stained gel of proteins representative of
recombinant CapTKT1 and CapTKT2 purification after IPTG induction.
Lanes from left to right include: total proteins from E. coli harboring control vector (pKK-Insert); vector plus insert
(pKK+CapTKT1 in A and pKK+CapTKT2 in B); and pooled active fractions
from the Q-Sepharose Fast-Flow (Q Seph) and Mono-Q HR (MonoQ) columns.
For both A and B, molecular mass (MW) markers are shown on the left in
kD.
|
|
View this table:
[in this window]
[in a new window]
|
Table I.
Substrate specificity of CapTKT1 and CapTKT2
Combined C2 acceptors and donors were used as substrates for monitoring
the transketolase activity of CapTKT1 and CapTKT2.
|
|
Additional studies using pyruvic acid (a C2 donor) and
D-glyceraldehyde-3-phosphate (a C2 acceptor), the two
putative substrates predicted for use by the nonmevalonic acid pathway
of IPP synthesis (Rohmer et al., 1996 ; Arigoni et al., 1997 ), revealed
that CapTKT2 alone catalyzed a transketolation condensation (Table I),
yielding 1-deoxy-xylulose-5-phosphate, which after dephosphorylation
migrated with authentic unlabeled 1-deoxy-xylulose to a
RF of 0.45. The Km of
CapTKT1 for D-xylulose-5-phosphate,
D-Rib-5-phosphate, and D-erythrose-4-phosphate
was 95, 750, and 200 µM, respectively. The
Km of CapTKT2 for pyruvate and
D-glyceraldehyde-3-phosphate was 500 and 750 µM, respectively. As shown in Table I, CapTKT1 utilized
preferentially products of the plastid pentose phosphate pathway,
whereas CapTKT2 had a preference for pyruvate as 2-carbon ketol donors.
This confirmed that each enzyme possessed distinctly different roles.
The role of CapTKT2 is reminiscent of a partially purified E. coli pyruvate dehydrogenase (Yokota and Sasajima, 1984 , 1986 ).
As this manuscript was being prepared, a report of a previously
uncharacterized E. coli gene (P77488) was shown to encode a
deoxy-xylulose synthase (Sprenger et al., 1997 ). This likely catalyzes
the aforementioned reactions (Yokota and Sasajima, 1984 , 1986 ), since
other previously characterized E. coli transketolases, A and
B, are not involved in deoxy-xylulose synthesis (Zhao and Winkler,
1994 ). Thus, CapTKT2 could be designated as a deoxy-xylulose synthase,
as shown for E. coli (Sprenger et al., 1997 ).
A mandatory requirement for transketolation is the presence of the
prosthetic group TPP (Lindqvist and Schneider, 1993 ). In fact,
during transketolase catalysis, fission of the ketol group of the donor
is initiated by the C2 atom of the thiazolium ring, which is activated
by deprotonation via an invariant Glu residue that has been
characterized for yeast transketolase (Wikner et al., 1994 ; Kern et
al., 1997 ). The sequence alignment of CapTKT1 and CapTKT2 suggests that
Glu-491 and Glu-449 fulfill this role in CapTKT1 and CapTKT2,
respectively (Fig. 1). When Glu-491 and Glu-449 were mutated into Ala,
the electrophoretic behavior of wild-type and mutant CapTKT1 or CapTKT2
was not modified (results not shown). However, transketolase activity
was nearly abolished in CapTKT1 and CapTKT2 (Table
II).
View this table:
[in this window]
[in a new window]
|
Table II.
Enzymatic activity of wild-type and mutant CapTKT1
and CapTKT2
Mono-Q-purified wild-type and mutant CapTKT1 and CapTKT2 were used for
the different assays. CapTKT1 activity was determined using
D-Rib-5-phosphate and D-xylulose-5-phosphate as
substrates. CapTKT2 activity was determined using
D-glyceraldehyde-3-phosphate and
[2-14C]pyruvate as substrates. The indicated Glu residue
was mutated into Ala as shown by the arrow.
|
|
Collectively, these findings suggest that plastids possess two types of
transketolases with distinct specificities. Further confirmation of
these different roles for CapTKT1 and CapTKT2 is supported by the fact
that during the chloroplast-to-chromoplast transition in pepper,
expression of CapTKT1 gene is nearly constitutive, whereas expression
of CapTKT2 gene is up-regulated when carotenoid accumulation is at its
greatest (Fig. 5). This coincides with the period when plastidial demand for IPP is at its highest level.

View larger version (51K):
[in this window]
[in a new window]
| Figure 5.
Analysis of CapTKT1 and
CapTKT2 mRNAs during chloroplast-to-chromoplast
differentiation in pepper fruit. Identical amounts of total RNA (20 µg) were blotted onto each lane and hybridized with the specified
probes. Top to bottom, CapTKT1 cDNA,
CapTKT2 cDNA, and pepper fruit probe coding for 25S
rRNAs used as a standard probe. Chloroplast-to-chromoplast
differentiation stages were characterized by the level of the
chromoplast-specific carotenoid capsanthin.
|
|
 |
DISCUSSION |
Dedicated Roles of Plastid Transketolases
It was widely believed that the synthesis of isoprenoids in
plastids involved the formation of mevalonic acid and its conversion into IPP, the building block of all isoprenoids. Despite a long debate,
a conclusive demonstration of mevalonic acid pathway reactions in
plastids was still lacking (Gray, 1987 ). In vivo studies using C-Glc labeling subsequently revealed the
existence of an alternative nonmevalonic acid pathway for IPP synthesis
in prokaryotes (Flesch and Rohmer, 1988 ; Rohmer et al., 1993 , 1996 ) and
in plants (Schwender et al., 1996 ; Arigoni et al., 1997 ; Knöss et
al., 1997 ; Lichtenthaler et al., 1997a , 1997b ), which is initiated
by a transketolation mechanism. We have characterized two pepper
plastid transketolases, CapTKT1 and CapTKT2, and showed that they
possess distinct specificities.
CapTKT1, like previously characterized plastid transketolases (Murphy
and Walker, 1982 ; Bernacchia et al., 1995 ), links the plastidial
pentose phosphate and the glycolytic cycles under physiological conditions. In contrast, CapTKT2 catalyzes an irreversible
reaction between glyceraldehyde phosphate and pyruvate to yield
deoxy-xylulose phosphate, the IPP precursor (Fig.
6). As a consequence, CapTKT2 probably initiates the nonmevalonic acid pathway for isoprenoid synthesis in plastids. The fact that similar open reading frames exist
in E. coli, Rhodobacter, and
Synechocystis also reinforces the cyanobacterial
endosymbiotic origin of plastids.

View larger version (15K):
[in this window]
[in a new window]
| Figure 6.
Metabolic specificities of plastid CapTKT1 and
CapTKT2. Due to its flexibility, CapTKT1 integrates the plastid stroma
pentose phosphate and glycolytic cycles, whereas CapTKT2 catalyzes an
irreversible condensation between
D-glyceraldehyde-3-phosphate and pyruvate to yield
1-deoxy-xylulose-5-phosphate. The latter is further channeled to the
formation of IPP, thiamine, or pyridoxine. P, Phosphate.
|
|
Interaction between Plastid Isoprenoid and Vitamin Biosynthesis
As deoxy-xylulose phosphate, an IPP precursor (Schwarz, 1994 ;
Schwender et al., 1996 ; Arigoni et al., 1997 ), is involved in thiamine
(David et al., 1981 ; Julliard and Douce, 1991 ) and pyrydoxine (Hill et
al., 1989 ; Julliard, 1992 ) synthesis, CapTKT2 appears to play a key
role in the previously unexpected pathways that link isoprenoid and
thiamine and pyridoxine synthesis in plastids (Fig. 6). Several
indirect lines of evidence support this. Thiamine deficiency generally
leads to the development of albino phenotypes in Arabidopsis (Li and
Redei, 1969 ; Komeda et al., 1988 ), tobacco (McHale et al., 1988 ), pea
(Proebsting et al., 1990 ), tomato (Boynton, 1966 ), and Plantago
insularis (Murr and Stebbins, 1971 ). Although albinism in these
plants could be caused by impairment of other thiamine-dependent
enzymes, it is noteworthy that most of these mutants are rescued
following the addition of thiamine or its precursors. Furthermore, it
has been recently observed that in ripening citrus the
thiamine-biosynthesis gene c-thi1, which is homologous to
the yeast thi4 gene (Praekelt et al., 1994 ), is strongly
induced during carotenoid accumulation (Jacob-Wilk et al., 1997 ).
Finally, the albino phenotype of an Arabidopsis mutant altered in the
cla1 gene (Mandel et al., 1996 ), which is highly homologous
to CapTKT2, points to a similar conclusion, that the CapTKT2 is
involved in isoprenoid, thiamine, and pyridoxine biosynthesis.
Interaction between Plastid and Cytosol Compartments during
Isoprenoid Biosynthesis
One may postulate that plants possess at least two pathways for
IPP synthesis. This is supported by in vivo studies of
mevalonate-synthesis inhibitors (Bach and Lichtenthaler, 1983 ) and by
newly characterized substrate precursors that contribute to IPP
formation (Rohmer et al., 1996 ; Schwender et al., 1996 ; Arigoni et
al., 1997 ). From previous in vivo data (Schwender et al., 1996 ; Arigoni
et al., 1997 ) and our enzymatic analysis, one may suggest that the
deoxy-xylulose pathway operates within plastids to yield carotenoids
and geranylgeranyl derivatives, whereas the "classical" mevalonic
acid pathway operates in the cytosol and is primarily responsible for
the synthesis of IPP units that form sesquiterpenes, sterols, and
various polyprenols in addition to mitochondrial ubiquinones (Disch et
al., 1998 ). However, a general conclusion as to the metabolic
compartmentation of plant isoprenoid synthesis is still unclear.
In unicellular alga the nonmevalonic acid pathway of IPP synthesis is
known to be involved in sterol synthesis (Schwender et al., 1996 );
however, in higher plants IPP for sterol synthesis is prominently
formed by the mevalonic pathway. One intriguing feature is that despite
the fact that parallel pathways appear to occur in different
compartments, isoprenoid substrates formed in the cytosol can still
apparently also be transported into the plastid and vice versa
(Schwarz, 1994 ; Nabeta et al., 1995 ; Arigoni et al., 1997 ). It has also
been suggested that two mevalonic acid pathways can operate in cell
cultures of mulberry tree cells, one that is sensitive to mevinolin and
another that is not (Hano and Nomura, 1995 ). Obviously, plant cells
possess complex features with regard to IPP synthesis, and additional
studies are needed to clarify the steps leading from deoxy-xylulose to
IPP formation to determine how the metabolic flux of isoprenoid
precursors is regulated at the molecular level.
 |
FOOTNOTES |
*
Corresponding author; e-mail camara{at}medoc.u-strasbg.fr; fax
33-38-86-14-442.
Received February 23, 1998;
accepted May 11, 1998.
The accession numbers for the sequences reported in this article are
Y15781 (CapTKT1) and Y15782 (CapTKT2).
1
Research support was partly provided by the
European Community Program (FAIR CT no. 96.1633).
 |
ABBREVIATIONS |
Abbreviations:
EST, expressed sequence tag.
IPP, isopentenyl
diphosphate.
IPTG, isopropylthio- -galactoside.
RACE, rapid
amplification of cDNA ends.
 |
ACKNOWLEDGMENTS |
We thank Dr. J. Schäeffer for electron microscopy and
Professor Ian D. Spenser for the kind gift of deoxypentulose. We also thank Professor M. Rohmer for critical reading of the manuscript.
 |
LITERATURE CITED |
Arigoni D,
Sagner S,
Latzel C,
Eisenreich W,
Bacher A,
Zenk MH
(1997)
Terpenoid biosynthesis from 1-deoxy-D-xylulose in higher plants by intramolecular skeletal rearrangement.
Proc Natl Acad Sci USA
94:
10600-10605
[Abstract/Free Full Text]
Bach TJ,
Lichtenthaler HK
(1983)
Inhibition by mevilonin of plant growth, sterol formation and pigment accumulation.
Physiol Plant
59:
50-60
[CrossRef]
Bernacchia G,
Schwall G,
Lottspeich F,
Salamini F,
Bartels D
(1995)
The transketolase gene family of the resurrection plant Craterostigma plantagineum: differential expression during the rehydratation phase.
EMBO J
14:
610-618
[Web of Science][Medline]
Bolte J,
Demuynck C,
Samaki H
(1987)
Utilization of enzymes in organic chemistry: transketolase catalyzed synthesis of ketoses.
Tetrahedron Lett
28:
5525-5528
[CrossRef]
Bouvier F,
d'Harlingue A,
Camara B
(1997)
Molecular analysis of carotenoid cyclase inhibition.
Arch Biochem Biophys
346:
53-64
[CrossRef][Web of Science][Medline]
Bouvier F,
d'Harlingue A,
Hugueney P,
Marin E,
Marion-Poll A,
Camara B
(1996)
Xanthophyll biosynthesis: cloning, expression, functional reconstitution, and regulation of -cyclohexenyl carotenoid epoxidase from pepper (Capsicum annuum).
J Biol Chem
271:
28861-28867
[Abstract/Free Full Text]
Boynton JE
(1966)
Chlorophyll-deficient mutants in tomato requiring vitamin B1. I. Genetics and physiology.
Hereditas
56:
171-199
Bradford MM
(1976)
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72:
248-254
[CrossRef][Web of Science][Medline]
Camara B
(1993)
Plant phytoene synthase complex: component enzymes, immunology, and biogenesis.
Methods Enzymol
214:
352-365
Camara B,
Hugueney P,
Bouvier F,
Kuntz M,
Monéger R
(1995)
Biochemistry and molecular biology of chromoplast development.
Int Rev Cytol
163:
175-247
[Web of Science][Medline]
David S,
Estramareix B,
Fischer JC,
Thérisod M
(1981)
1-deoxy-D-threo-2-pentulose: the precursor of the five carbon chain of the thiazole of thiamine.
J Am Chem Soc
103:
7341-7342
[CrossRef]
Deruère J,
Römer S,
d'Harlingue A,
Backhaus RA,
Kuntz M,
Camara B
(1994)
Fibril assembly and carotenoid over accumulation: a model for supramolecular lipoprotein structures.
Plant Cell
6:
119-133
[Abstract]
Devereux J,
Haeberli P,
Smithies O
(1984)
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res
12:
387-395
Disch A,
Hemmerlin A,
Bach TJ,
Rohmer M
(1998)
Mevalonate-derived isopentenyl diphosphate is the biosynthetic precursor of ubiquinone prenyl side chain in tobacco BY-2 cells.
Biochem J
331:
615-621
Duvold T,
Bravo JM,
Pale-Grosdemange C,
Rohmer M
(1997)
Biosynthesis of 2-C-methyl-D-erythritol, a putative C5 intermediate in the mevalonate independent pathway for isoprenoid biosynthesis.
Tetrahedron Lett
33:
4769-4772
[CrossRef]
Eisenreich W,
Menhard B,
Hylands P,
Zenk MH,
Bacher A
(1996)
Studies on the biosynthesis of taxol: the taxane carbon skeleton is not of mevalonoid origin.
Proc Natl Acad Sci USA
93:
6431-6436
[Abstract/Free Full Text]
Flechner A,
Dressen U,
Westhoff P,
Henze K,
Schnarrenberger C,
Martin W
(1996)
Molecular characterization of transketolase (EC 2.2.1.1) active in the Calvin cycle of spinach chloroplasts.
Plant Mol Biol
32:
475-484
[CrossRef][Web of Science][Medline]
Flesch G,
Rohmer M
(1988)
Prokaryotic hopanoids: the biosynthesis of the bacteriohopane skeleton formation of isoprene units from two distinct acetate pools and a novel type of carbon/carbon linkage between a triterpene and D-ribose.
Eur J Biochem
175:
405-411
[Web of Science][Medline]
Goodwin TW (1971) Biosynthesis. In O Isler, ed,
Carotenoids. Birkhäuser Verlag, Basel, Switzerland, pp 577-636
Gray JC
(1987)
Control of isoprenoid biosynthesis in higher plants.
Adv Bot Res
14:
25-91
Hano Y,
Nomura T
(1995)
Alternative response of two isoprenoid biosynthetic pathways to compactin in Morus alba cell cultures.
Naturwissenchaften
82:
376-378
[CrossRef]
Harboe N,
Ingild A
(1977)
Immunization, isolation of immunoglobulins, estimation of antibody titre.
In
HH Axelsen,
NH Kroll,
B Weeks,
eds, Quantitative Immunoelectrophoresis.
Blackwell Scientific Publications, Oxford, UK, pp 161-164
Hawkins CF,
Borges A,
Perham RN
(1989)
A common structural motif in thiamin pyrophosphate-binding enzymes.
FEBS Lett
255:
77-82
[CrossRef][Web of Science][Medline]
Heintze A,
Görlach J,
Leuschner C,
Hoppe P,
Hagelstein P,
Schulze-Siebert D,
Schultz G
(1990)
Plastidic isoprenoid synthesis during chloroplast development. Change from metabolic autonomy to a division-of-labor stage.
Plant Physiol
93:
1121-1127
[Abstract/Free Full Text]
Heintze A,
Riedel A,
Aydogdu S,
Schultz G
(1994)
Formation of chloroplast isoprenoids from pyruvate and acetate by chloroplasts from young spinach plants: evidence for a mevalonate pathway in immature chloroplasts.
Plant Physiol Biochem
32:
791-797
Hill RE,
Sayer BG,
Spenser ID
(1989)
Biosynthesis of vitamin B6: incorporation of D-1-deoxyxylulose.
J Am Chem Soc
111:
1916-1917
[CrossRef]
Hobbs GR,
Lilly MD,
Turner NJ,
Ward JM,
Willets AJ,
Woodley JM
(1993)
Enzyme-catalysed carbon-carbon bond formation: use of transketolase from Escherichia coli.
J Chem Soc Perkin Trans
I:
165-166
Huynh TV,
Young RA,
Davies RW
(1985)
Construction and screening cDNA libraries in gt10 and gt11.
In
DM Glover,
eds, DNA Cloning: a Practical Approach.
IRL Press, Oxford, UK, pp 49-78
Jacob-Wilk D,
Goldschmidt EE,
Riov J,
Sadka A,
Holland D
(1997)
Induction of a Citrus gene highly homologous to plant and yeast thi genes involved in thiamine biosynthesis during natural and ethylene-induced fruit maturation.
Plant Mol Biol
35:
661-666
[CrossRef][Web of Science][Medline]
Julliard JH
(1992)
Biosynthesis of the pyridoxal ring (vitamin B6) in higher plant chloroplasts and its relationship with the biosynthesis of the thiazole ring (vitamin B1).
C R Acad Sci Ser III
314:
285-290
Julliard JH,
Douce R
(1991)
Biosynthesis of the thiazole moiety of thiamin (vitamin B1) in higher plant chloroplasts.
Proc Natl Acad Sci USA
88:
2042-2045
[Abstract/Free Full Text]
Kern D,
Kern G,
Neef H,
Tittmann K,
Killenberg-Jabs M,
Wilner C,
Schneider G,
Hübner G
(1997)
How thiamine diphosphate is activated in enzymes.
Science
275:
67-70
[Abstract/Free Full Text]
Kleinig H
(1989)
The role of plastids in isoprenoid biosynthesis.
Annu Rev Plant Physiol Plant Mol Biol
40:
39-59
[CrossRef][Web of Science]
Knöss W,
Reuter B,
Zapp J
(1997)
Biosynthesis of the labdane diterpene marrubium in Marrubium vulgare via a non-mevalonate pathway.
Biochem J
326:
449-454
Kobori Y,
Myles DC,
Whitesides GM
(1992)
Substrate specificity and carbohydrate synthesis using transketolase.
J Org Chem
57:
5899-5907
[CrossRef]
Komeda Y,
Tanaka M,
Nishimune T
(1988)
A th-1 mutant of Arabidopsis thaliana is defective for a thiamine-phosphate-synthesizing enzyme: thiamine phosphate pyrophosphorylase.
Plant Physiol
88:
248-250
[Abstract/Free Full Text]
Lange BM,
Wildung MR,
McCaskill D,
Croteau R
(1998)
A family of transketolases that directs isoprenoid biosynthesis via a mevalonate-independent pathway.
Proc Natl Acad Sci USA
95:
2100-2104
[Abstract/Free Full Text]
Li SL,
Redei GP
(1969)
Thiamine mutants of the crucifer, Arabidopsis.
Biochem Genet
3:
163-170
[CrossRef][Web of Science][Medline]
Lichtenthaler HK,
Rohmer M,
Schwender J
(1997a)
Two independent biochemical pathways for isopentenyl diphosphate and isoprenoid biosynthesis in higher plants.
Physiol Plant
101:
643-652
[CrossRef]
Lichtenthaler HK,
Schwender J,
Disch A,
Rohmer M
(1997b)
Biosynthesis of isoprenoids in higher plant chloroplasts proceeds via a mevalonate-independent pathway.
FEBS Lett
400:
271-274
[CrossRef][Web of Science][Medline]
Lindqvist Y,
Schneider G
(1993)
Thiamin diphosphate dependent enzymes: transketolase, pyruvate oxidase and pyruvate decarboxylase.
Curr Opin Struct Biol
3:
896-901
[CrossRef]
MacLennan AP, Randall HM, Smith DW (1959) Detection and
identification of deoxysugars on paper chromatograms. Analyt Chem
31, 2020-2022
Mandel MA,
Feldmann KA,
Herrera-Estrella L,
Rocha-Sosa M,
Léon P
(1996)
CLA1, a novel gene required for chloroplast development, is highly conserved in evolution.
Plant J
9:
649-658
[CrossRef][Web of Science][Medline]
McCaskill D,
Croteau R
(1995)
Monoterpene and sesquiterpene biosynthesis in glandular trichomes of peppermint (Mentha × piperita) rely exclusively on plastid-derived isopentenyl diphosphate.
Planta
197:
49-56
McHale NA,
Hanson KR,
Zelitch I
(1988)
A nuclear mutation in Nicotiana sylvestris causing a thiamine reversible defect in synthesis of chloroplast pigments.
Plant Physiol
88:
930-935
[Abstract/Free Full Text]
Moore FD,
Shephard DC
(1978)
Chloroplast autonomy in pigment synthesis.
Protoplasma
94:
1-17
Murphy DJ, Walker DA (1982) The properties of transketolase from
photosynthetic tissue. Planta 155, 316-320
Murr SM,
Stebbins GL
(1971)
An albino mutant in Plantago insularis requiring thiamine pyrophosphate. I.
Genetics
68:
231-243
[Free Full Text]
Nabeta K,
Ishikawa T,
Okuyama H
(1995)
Sesqui- and di-terpene biosynthesis from 13C-labelled acetate and mevalonate in cultured cells of Heteroscyphus planus.
J Chem Soc Perkin Trans
I:
3111-3115
Neuburger M,
Journet EP,
Bligny R,
Carde JP,
Douce R
(1982)
Purification of plant mitochondria by isopycnic centrifugation in density gradients of percoll.
Arch Biochem Biophys
217:
312-323
[CrossRef][Web of Science][Medline]
Praekelt UM,
Byrne KL,
Meacock PA
(1994)
Regulation of thi4 (mol1), a thiamine-biosynthetic gene of Saccharomyces cerevisiae.
Yeast
10:
481-490
[CrossRef][Web of Science][Medline]
Proebsting WM,
Maggard SP,
Guo WW
(1990)
The relationship of thiamine to the Alt locus of Pisum sativum L.
J Plant Physiol
13:
231-235
Reizer J,
Reizer A,
Bairoch A,
Saier JMH
(1993)
A diverse transketolase family that includes the RecP protein of Streptococcus pneumoniae, a protein implicated in genetic recombination.
Res Microbiol
144:
341-347
[Medline]
Rohmer M,
Knanni M,
Simonin P,
Sutter B,
Sahm H
(1993)
Isoprenoid biosynthesis in bacteria: a novel pathway for the early steps leading to isopentenyl diphosphate.
Biochem J
295:
517-524
Rohmer M,
Seemann M,
Horbach S,
Bringer-Meyer S,
Sahm H
(1996)
Glyceraldehyde 3-phosphate and pyruvate as precursors of isoprenic units in an alternative non-mevalonate pathway for terpenoid biosynthesis.
J Am Chem Soc
118:
2564-2566
[CrossRef]
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Schenk G,
Layfield R,
Candy JM,
Duggleby RG,
Nixon PF
(1997)
Molecular evolutionary analysis of the thiamine-diphosphate-dependent enzyme, transketolase.
J Mol Evol
44:
552-572
[CrossRef][Medline]
Schwarz MK (1994) Terpen-Biosynthese in Ginkgo
biloba:eine überraschende Geschichte. PhD thesis.
Eidgenössische Technische Hochschule, Zürich
Schwender J,
Seemann M,
Lichtenthaler HK,
Rohmer M
(1996)
Biosynthesis of isoprenoids (carotenoids, sterols, prenyl side chain of chlorophylls and plastoquinone) via a novel pyruvate/glyceraldehyde 3-phosphate non-mevalonate pathway in the green Scenedesmus obliquus.
Biochem J
316:
73-80
Smith DE,
Fisher PA
(1984)
Identification, developmental regulation, and response to heat shock of two antigenically related forms of a major nuclear envelope protein in Drosophila embryos: application of an improved method for affinity purification of antibodies using polypeptides immobilized on nitrocellulose blots.
J Cell Biol
99:
20-28
[Abstract/Free Full Text]
Sprenger GA,
Schörken U,
Wiegert T,
Grolle S,
de Graaf AA,
Taylor SV,
Begley TP,
Bringer-Meyer S,
Sahm H
(1997)
Identification of a thiamin-dependent synthase in Escherichia coli required for the formation of the 1-deoxy-D-xylulose 5-phosphate precursor to isoprenoids, thiamin, and pyridoxol.
Proc Natl Acad Sci USA
94:
12857-12862
[Abstract/Free Full Text]
Thom E,
Möhlmann T,
Quick WP,
Camara B,
Neuhaus E
(1998)
Enzymic components of plastids from sweet pepper fruits, characterisation of the plastidic oxidative pentose phosphate pathway and transport processes across the envelope membrane.
Planta
204:
226-233
[CrossRef][Web of Science]
Verwoerd TC,
Dekker BMM,
Hoekema A
(1989)
A small-scale procedure for the rapid isolation of plant RNAs.
Nucleic Acids Res
17:
2362
[Free Full Text]
Villafranca JJ,
Axelrod B
(1971)
Heptulose synthesis from nonphosphorylated aldoses and ketoses by spinach transketolase.
J Biol Chem
246:
3126-3131
[Abstract/Free Full Text]
Von Heijne G,
Hirai T,
Klösgen RB,
Steppuhn J,
Bruce B,
Keegstra K,
Herrmann RG
(1991)
CHLPEP: a database of chloroplast transit peptides.
Plant Mol Biol
9:
104-126
Wikner C,
Meshalkina L,
Nilsson U,
Nikkola M,
Lindqvist Y,
Sundström M,
Schneider G
(1994)
Analysis of an invariant cofactor-protein interaction in thiamin diphosphate-dependent enzymes by site-directed mutagenesis-glutamic acid 418 in transketolase is essential for catalysis.
J Biol Chem
269:
32144-32150
[Abstract/Free Full Text]
Yokota A,
Sasajima K
(1984)
Formation of 1-deoxy-D-threo-pentulose and 1-deoxy-L-threo-pentulose by cell-free extracts of microorganisms.
Agric Biol Chem
149:
149-158
Yokota A,
Sasajima KI
(1986)
Formation of 1-deoxy-ketoses by pyruvate dehydrogenase and acetoin dehydrogenase.
Agric Biol Chem
50:
2517-2524
Zhao G,
Winkler ME
(1994)
An Escherichia coli K-12 tktA tktB mutant deficient in transketolase activity requires pyridoxine (vitamin B6) as well as the aromatic amino acids and vitamins for growth.
J Bacteriol
176:
6134-6138
[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. Xiang, G. Usunow, G. Lange, M. Busch, and L. Tong
Crystal Structure of 1-Deoxy-D-xylulose 5-Phosphate Synthase, a Crucial Enzyme for Isoprenoids Biosynthesis
J. Biol. Chem.,
January 26, 2007;
282(4):
2676 - 2682.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Bouvier, N. Linka, J.-C. Isner, J. Mutterer, A. P.M. Weber, and B. Camara
Arabidopsis SAMT1 Defines a Plastid Transporter Regulating Plastid Biogenesis and Plant Development
PLANT CELL,
November 1, 2006;
18(11):
3088 - 3105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hemmerlin, D. Tritsch, M. Hartmann, K. Pacaud, J.-F. Hoeffler, A. van Dorsselaer, M. Rohmer, and T. J. Bach
A Cytosolic Arabidopsis D-Xylulose Kinase Catalyzes the Phosphorylation of 1-Deoxy-D-Xylulose into a Precursor of the Plastidial Isoprenoid Pathway
Plant Physiology,
October 1, 2006;
142(2):
441 - 457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Satoh, N. Kurano, S. Harayama, and S. Miyachi
Effects of Chloramphenicol on Photosynthesis, Protein Profiles and Transketolase Activity under Extremely High CO2 Concentration in an Extremely-high-CO2-tolerant Green Microalga, Chlorococcum littorale
Plant Cell Physiol.,
December 15, 2004;
45(12):
1857 - 1862.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Cassera, F. C. Gozzo, F. L. D'Alexandri, E. F. Merino, H. A. del Portillo, V. J. Peres, I. C. Almeida, M. N. Eberlin, G. Wunderlich, J. Wiesner, et al.
The Methylerythritol Phosphate Pathway Is Functionally Active in All Intraerythrocytic Stages of Plasmodium falciparum
J. Biol. Chem.,
December 10, 2004;
279(50):
51749 - 51759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gerhardt, S. Echt, M. Busch, J. Freigang, G. Auerbach, G. Bader, W. F. Martin, A. Bacher, R. Huber, and M. Fischer
Structure and Properties of an Engineered Transketolase from Maize
Plant Physiology,
August 1, 2003;
132(4):
1941 - 1949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Bouvier, C. Suire, J. Mutterer, and B. Camara
Oxidative Remodeling of Chromoplast Carotenoids: Identification of the Carotenoid Dioxygenase CsCCD and CsZCD Genes Involved in Crocus Secondary Metabolite Biogenesis
PLANT CELL,
January 1, 2003;
15(1):
47 - 62.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Bailey, S. Mahapatra, P. J. Brennan, and D. C. Crick
Identification, cloning, purification, and enzymatic characterization of Mycobacterium tuberculosis 1-deoxy-D-xylulose 5-phosphate synthase
Glycobiology,
December 1, 2002;
12(12):
813 - 820.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Rodriguez-Concepcion and A. Boronat
Elucidation of the Methylerythritol Phosphate Pathway for Isoprenoid Biosynthesis in Bacteria and Plastids. A Metabolic Milestone Achieved through Genomics
Plant Physiology,
November 1, 2002;
130(3):
1079 - 1089.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Carretero-Paulet, I. Ahumada, N. Cunillera, M. Rodriguez-Concepcion, A. Ferrer, A. Boronat, and N. Campos
Expression and Molecular Analysis of the Arabidopsis DXR Gene Encoding 1-Deoxy-D-Xylulose 5-Phosphate Reductoisomerase, the First Committed Enzyme of the 2-C-Methyl-D-Erythritol 4-Phosphate Pathway
Plant Physiology,
August 1, 2002;
129(4):
1581 - 1591.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Mahmoud and R. B. Croteau
Metabolic engineering of essential oil yield and composition in mint by altering expression of deoxyxylulose phosphate reductoisomerase and menthofuran synthase
PNAS,
June 20, 2001;
(2001)
141237298.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Altincicek, A.-K. Kollas, S. Sanderbrand, J. Wiesner, M. Hintz, E. Beck, and H. Jomaa
GcpE Is Involved in the 2-C-Methyl-D-Erythritol 4-Phosphate Pathway of Isoprenoid Biosynthesis in Escherichia coli
J. Bacteriol.,
April 15, 2001;
183(8):
2411 - 2416.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. M. Lange, T. Rujan, W. Martin, and R. Croteau
Isoprenoid biosynthesis: The evolution of two ancient and distinct pathways across genomes
PNAS,
November 8, 2000;
(2000)
240454797.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Suire, F. Bouvier, R. A. Backhaus, D. Bégu, M. Bonneu, and B. Camara
Cellular Localization of Isoprenoid Biosynthetic Enzymes in Marchantia polymorpha. Uncovering a New Role of Oil Bodies
Plant Physiology,
November 1, 2000;
124(3):
971 - 978.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. M. Estévez, A. Cantero, C. Romero, H. Kawaide, L. F. Jiménez, T. Kuzuyama, H. Seto, Y. Kamiya, and P. León
Analysis of the Expression of CLA1, a Gene That Encodes the 1-Deoxyxylulose 5-Phosphate Synthase of the 2-C-Methyl-D-Erythritol-4-Phosphate Pathway in Arabidopsis
Plant Physiology,
September 1, 2000;
124(1):
95 - 104.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Takagi, T. Kuzuyama, S. Takahashi, and H. Seto
A Gene Cluster for the Mevalonate Pathway from Streptomyces sp. Strain CL190
J. Bacteriol.,
August 1, 2000;
182(15):
4153 - 4157.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
F. Rohdich, J. Wungsintaweekul, H. Lüttgen, M. Fischer, W. Eisenreich, C. A. Schuhr, M. Fellermeier, N. Schramek, M. H. Zenk, and A. Bacher
Biosynthesis of terpenoids: 4-Diphosphocytidyl-2-C-methyl-D-erythritol kinase from tomato
PNAS,
June 30, 2000;
(2000)
140209197.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
F. Rohdich, J. Wungsintaweekul, W. Eisenreich, G. Richter, C. A. Schuhr, S. Hecht, M. H. Zenk, and A. Bacher
Biosynthesis of terpenoids: 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase of Arabidopsis thaliana
PNAS,
June 6, 2000;
97(12):
6451 - 6456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kuzuyama, M. Takagi, S. Takahashi, and H. Seto
Cloning and Characterization of 1-Deoxy-D-Xylulose 5-Phosphate Synthase from Streptomyces sp. Strain CL190, Which Uses both the Mevalonate and Nonmevalonate Pathways for Isopentenyl Diphosphate Biosynthesis
J. Bacteriol.,
February 15, 2000;
182(4):
891 - 897.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Luttgen, F. Rohdich, S. Herz, J. Wungsintaweekul, S. Hecht, C. A. Schuhr, M. Fellermeier, S. Sagner, M. H. Zenk, A. Bacher, et al.
Biosynthesis of terpenoids: YchB protein of Escherichia coli phosphorylates the 2-hydroxy group of 4-diphosphocytidyl-2C-methyl-D-erythritol
PNAS,
February 1, 2000;
97(3):
1062 - 1067.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Lange and R. Croteau
Isopentenyl diphosphate biosynthesis via a mevalonate-independent pathway: Isopentenyl monophosphate kinase catalyzes the terminal enzymatic step
PNAS,
November 23, 1999;
96(24):
13714 - 13719.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kuzuyama, S. Takahashi, M. Takagi, and H. Seto
Characterization of 1-Deoxy-D-xylulose 5-Phosphate Reductoisomerase, an Enzyme Involved in Isopentenyl Diphosphate Biosynthesis, and Identification of Its Catalytic Amino Acid Residues
J. Biol. Chem.,
June 23, 2000;
275(26):
19928 - 19932.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Estevez, A. Cantero, A. Reindl, S. Reichler, and P. Leon
1-Deoxy-D-xylulose-5-phosphate Synthase, a Limiting Enzyme for Plastidic Isoprenoid Biosynthesis in Plants
J. Biol. Chem.,
June 15, 2001;
276(25):
22901 - 22909.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Herz, J. Wungsintaweekul, C. A. Schuhr, S. Hecht, H. Luttgen, S. Sagner, M. Fellermeier, W. Eisenreich, M. H. Zenk, A. Bacher, et al.
Biosynthesis of terpenoids: YgbB protein converts 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate to 2C-methyl-D-erythritol 2,4-cyclodiphosphate
PNAS,
March 14, 2000;
97(6):
2486 - 2490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Rohdich, J. Wungsintaweekul, H. Luttgen, M. Fischer, W. Eisenreich, C. A. Schuhr, M. Fellermeier, N. Schramek, M. H. Zenk, and A. Bacher
Biosynthesis of terpenoids: 4-Diphosphocytidyl-2-C-methyl-D-erythritol kinase from tomato
PNAS,
July 18, 2000;
97(15):
8251 - 8256.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Mahmoud and R. B. Croteau
From the Cover: Metabolic engineering of essential oil yield and composition in mint by altering expression of deoxyxylulose phosphate reductoisomerase and menthofuran synthase
PNAS,
July 17, 2001;
98(15):
8915 - 8920.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Lange, T. Rujan, W. Martin, and R. Croteau
Isoprenoid biosynthesis: The evolution of two ancient and distinct pathways across genomes
PNAS,
November 21, 2000;
97(24):
13172 - 13177.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|