Plant Physiol. (1998) 117: 1423-1431

Dedicated Roles of Plastid Transketolases during the Early Onset of Isoprenoid Biogenesis in Pepper Fruits¹

Florence Bouvier, Alain d'Harlingue, Claude Suire, Ralph A. Backhaus, and Bilal Camara^*

Institut de Biologie Moléculaire des Plantes du Centre National de la Recherche Scientifique and Université Louis Pasteur, 12 rue du Général Zimmer, 67084 Strasbourg, France (F.B., B.C.); Laboratoire de Pathologie et Biochimie Végétales, Université Pierre et Marie Curie, 4 Place Jussieu, 75250 Paris, France (A.d.'H.); Laboratoire de Pathologie et Biochimie Végétales, Université Pierre et Marie Curie, 4 Place Jussieu, 75250 Paris, France (A.d.'H.)Institut de Biochimie et Génétique Cellulaire du Centre National de la Recherche Scientifique, 1 rue Camille Saint Saëns, 33077 Bordeaux, France (C.S.); and Department of Botany, P.O. Box 871601, Arizona State University, Tempe, Arizona 85287-1601 (R.A.B.)

	ABSTRACT

Top Abstract Introduction Methods Results Discussion References

Isopentenyl diphosphate (IPP), which is produced from mevalonic acid or other nonmevalonic substrates, is the universal precursor of isoprenoids in nature. Despite the presence of several isoprenoid compounds in plastids, enzymes of the mevalonate pathway leading to IPP formation have never been isolated or identified to our knowledge. We now describe the characterization of two pepper (Capsicum annuum L.) cDNAs, CapTKT1 and CapTKT2, that encode transketolases having distinct and dedicated specificities. CapTKT1 is primarily involved in plastidial pentose phosphate and glycolytic cycle integration, whereas CapTKT2 initiates the synthesis of isoprenoids in plastids via the nonmevalonic acid pathway. From pyruvate and glyceraldehyde-3-phosphate, CapTKT2 catalyzes the formation of 1-deoxy-xylulose-5-phosphate, the IPP precursor. CapTKT1 is almost constitutively expressed during the chloroplast-to-chromoplast transition, whereas CapTKT2 is overexpressed during this period, probably to furnish the IPP necessary for increased carotenoid biosynthesis. Because deoxy-xylulose phosphate is shared by the plastid pathways of isoprenoid, thiamine (vitamin B₁), and pyridoxine (vitamin B₆) biosynthesis, our results may explain why albino phenotypes usually occur in thiamine-deficient plants.

	INTRODUCTION

Top Abstract Introduction Methods Results Discussion References

Because of the combined activities of mevalonate-synthesizing and -activating enzymes, IPP is known as the universal isoprenoid building block. How IPP is synthesized and channeled into plastid isoprenoids to support the production of carotenoids, chlorophylls, prenylquinones, and diterpenes is largely unknown. Two hypotheses have been proposed. One is that plastids operate autonomously, synthesizing plastid isoprenoids directly from carbon dioxide or from plastid glycolytic intermediates such as pyruvate (Goodwin, 1971; Moore and Shephard, 1978; Heintze et al., 1990, 1994; McCaskill and Croteau, 1995). However, the mechanism of carbon flow via a pyruvate intermediate is unknown for plants. A second hypothesis is that IPP is transported from the cytosol (Kleinig, 1989), which is based on the finding that hydroxymethylglutaryl CoA reductase and mevalonate-activating enzymes are absent in plastids (Gray, 1987). This view is reinforced by the fact that mevilonin, a specific inhibitor of 3-hydroxy-3-methylglutaryl-CoA reductase, drastically inhibits cytosolic sterol biosynthesis at moderate concentrations but does not affect isoprenoid synthesis in plastids (Bach and Lichtenthaler, 1983). This led to consideration of an alternative IPP-generation system. In fact, such a pathway is known for prokaryotes, in which IPP is formed via deoxy-xylulose phosphate rather than by mevalonate (Rohmer et al., 1993) in a transketolation reaction between pyruvate and glyceraldehyde-3-phosphate (Rohmer et al., 1996). In vivo precursor labeling indicates that a similar pathway operates for the synthesis of ginkgolides (Schwarz, 1994) and plastid isoprenoids (Schwender et al., 1996; Arigoni et al., 1997; Lichtenthaler et al., 1997a, 1997b).

In this study we identified and characterized from pepper (Capsicum annuum L.) fruits two plastid transketolases, CapTKT1 and CapTKT2, which are dedicated to specific functions. CapTKT1 is primarily engaged in plastid pentose phosphate and glycolytic cycle integration. CapTKT2 irreversibly converts pyruvate and glyceraldehyde-3-phosphate into deoxy-xylulose phosphate, which then behaves as the plastidial IPP precursor via the putative intermediate 2-C-methyl-D-erythritol (Duvold et al., 1997). This pathway has no steps in common with cytoplasmic IPP synthesis, which proceeds via the mevalonic acid pathway. Our data also suggest that plastid isoprenoid biosynthesis is tightly coupled to that of thiamine (vitamin B₁) (David et al., 1981; Julliard and Douce, 1991) and pyridoxine (vitamin B₆) (Hill et al., 1989; Julliard, 1992) biosynthesis.

	MATERIALS AND METHODS

Top Abstract Introduction Methods Results Discussion References

Plant Materials and Organelle Isolation

Antibody Preparation

cDNA Isolation and Analysis

First-strand cDNA synthesis used the specific CapTKT1 internal oligonucleotide GST1: CTCAAAGTTTTCAGGGTG. Following C-tailing the CapTKT1-specific oligonucleotide GST2, ATGTCCAGCGGAGAGAAC, was used in combination with the anchor primers (GIBCO-BRL) for PCR (30 cycles) according to the program: 94°C for 1 min, 55°C for 1 min, 72°C for 2 min, and 72°C for 7 min. Purified PCR products were cloned into pBluescript SK vector and both strands were sequenced. For the second transketolase, a BLAST search for transketolase-homologous plant sequences allowed indentification of a cDNA clone, designated CLA1 for "altered chloroplasts" (Mandel et al., 1996), several EST clones from Arabidopsis (W43388), rice (D46713 and D46576), and castor bean (T14878), and an Arabidopsis genomic sequence (Z97339) displaying characteristic transketolase motifs (Hawkins et al., 1989; Schenk et al., 1997) but with a deduced sequence that was very different from CapTKT1.

The sense oligonucleotide CTTTGGGATGTTGGTCATCAG, coding for the sequence LWDVGHQ (Arabidopsis EST, W43388), and the antisense oligonucleotide AACGTGCGAGCCAAAACCTCC, coding for GGFGSHV (Arabidopsis genomic sequence, Z97339), were used to amplify a 1550-bp probe by reverse transcriptase-PCR, using pepper fruit poly(A⁺) mRNA, according to the program described above. After sequence verification, the 1550-bp probe was used to isolate a 600-bp fragment containing the 3-prime end of the cDNA from the pepper cDNA library. The 5-prime end of the cDNA was isolated by 5-RACE, as described above using the gene-specific probe GST1, GTCGTTTAAAATAACAAT. After C-tailing the gene-specific oligonucleotide GST2, GATGGTGGTGGAACTGTGGCC, was used in combination with the anchor primers (GIBCO-BRL) for PCR according to the program described for CapTKT1 5-RACE. The resulting fragment was cloned into plasmid pBluescript SK and both strands were sequenced. Sequence data were analyzed using computer programs of the University of Wisconsin Genetics Computer Group (Madison) (Devereux et al., 1984).

Expression and Purification

Site-directed mutagenesis was carried out as previously described (Bouvier et al., 1997) using a site-directed mutagenesis kit (QuickChange, Stratagene). For CapTKT1 the amino acid change (Glu-491 to Ala) was introduced using the sense mutagenic oligonucleotide TTTGGTGTTCGTGCACATGGTATGGGA and the corresponding antisense oligonucleotide. For CapTKT2 the change (Glu-449 to Ala) was introduced using the sense GTTGGAATAGCAGCACAACATGCAGTA and the corresponding antisense oligonucleotide. Mutants CapTKT1 and CapTKT2 were expressed as shown for the corresponding wild-type enzymes.

To purify the expressed proteins, E. coli harboring CapTKT1 or CapTKT2 open reading frames was grown at 28°C to A = 0.4 in Luria-Bertani medium (1 L) before induction with 0.25 mM IPTG for 4 h. The cells were pelleted by centrifugation at 5,000g for 10 min before resuspension in 50 mM Tris-HCl buffer, pH 7.6, containing 5 mM MgCl₂, 50 µM thiamine diphosphate, and 2 mM DTT. After sonication on ice at 10-s intervals for a total of 2 min, the soluble supernatant obtained after 10,000g centrifugation for 10 min was used for protein purification. To this end, the supernatant was loaded directly to a Q-Sepharose Fast-Flow column (2 × 30 cm, Pharmacia) equilibrated with 50 mM Tris-HCl buffer, pH 7.6, containing 5 mM MgCl₂, 50 µM thiamine diphosphate, and 2 mM DTT (buffer A). After washing with 50 mM NaCl in the same buffer, the column was developed with a linear gradient of 50 to 250 mM NaCl in buffer A. The active fractions were pooled and diluted 5-fold with buffer A before Mono-Q HR (Pharmacia) column chromatography. Active fractions were eluted with the same linear gradient and used for enzymatic assays as described below.

Enzyme Assay and Analysis of Products

For the second procedure, transketolase activity was assayed by monitoring the C2 transfer of [2-¹⁴C] pyruvate (26 mCi mol¹, New England Nuclear) to D-glyceraldehyde-3-phosphate. The reaction was performed in a volume of 100 µL, and contained 50 mM Tris-HCl buffer, pH 7.6, 5 mM pyruvic acid (2 µCi), 5 mM D-glyceraldehyde-3-phosphate, 500 µM thiamine diphosphate, 10 mM MgCl₂, and a definite amount of enzyme. Following incubation at 30°C, the reaction was stopped by the addition of 5% TCA. Insoluble proteins were removed by centrifugation for 5 min in a microfuge at 4°C. The supernatant was adjusted to pH 9.0 and treated with 10 units of bovine alkaline phosphatase before further incubation for 1 h at 37°C. Reactions were stopped by the addition of 4 volumes of cold acetone followed by centrifugation. After addition of authentic unlabeled deoxy-xylulose synthesized as described previously (Yokota and Sasajima, 1984, 1986) or kindly provided by Ian D. Spenser (MacMaster University, Hamilton, Ontario, Canada), the supernatant was spotted onto Silicagel 60 plates developed with the solvent system (acetone:ethylacetate; 1:1, v/v). Reaction products were identified by autoradiography and by spraying the plates with vanillin-perchloric reagent (MacLennan et al., 1959). Alternatively, disposable Silicagel 60 microcolumns eluted with the same solvent system were used to monitor the radioactivity incorporated into deoxy-xylulose. Incorporated radioactivity was determined by liquid-scintillation counting.

Other Methods

	RESULTS

Top Abstract Introduction Methods Results Discussion References

The Role of Transketolase in Generating Carbon-Carbon Condensations

The above proposed pathway of carbon-carbon condensations is reminiscent of a transketolation reaction catalyzed by several enzymes from microorganisms (Yokota and Sasajima, 1984). This mechanism has been used to generate several classes of compounds (Villafranca and Axelrod, 1971; Bolte et al., 1987; Kobori et al., 1992; Hobbs et al., 1993). To identify putative transketolases involved in plastid isoprenoid biosynthesis we first raised antibodies against partially purified chromoplast transketolase from pepper, and selected from the National Center for Biotechnology Information (Bethesda, MD) appropriate ESTs encoding characteristic transketolase motifs (Hawkins et al., 1989; Reizer et al., 1993; Schenk et al., 1997).

Two strategies, immunoscreening and DNA hybridization, were used to isolate two partial cDNAs, respectively designated CapTKT1 and CapTKT2, from a pepper fruit library. The longest CapTKT1 and CapTKT2 clones with ATG start codons isolated by the RACE procedure were 2232 and 2157 bp, respectively. CapTKT1 and CapTKT2 encode for 744 and 719 amino acid proteins with respective molecular masses of 80.1 and 77.5 kD. The predicted primary structure contains domains with potential functional significance, including a transketolase motif (Schenk et al., 1997) and a thiamine diphosphate-binding domain (Hawkins et al., 1989) (Fig. 1). Hydropathy plots of CapTKT1 and CapTKT2 did not reveal significant transmembrane-spanning domains, suggesting that both proteins are hydrophilic (results not shown).

View larger version (121K): [in this window] [in a new window]   Figure 1. Sequence alignment of CapTKT1 and CapTKT2 proteins with related gene products. Black boxes indicate identity between CapTKT1 (Captkt1) (accession no. Y15781) and CapTKT2 (Captkt2) (accession no. Y15782) with ClaI protein from Arabidopsis (Cla1) (Mandel et al., 1996), putative Rhodobacter (Rhotkt2) (accession no. P26242), Synechocystis (Syntkt2) (accession no. D90903), and E. coli (Ecotkt2) (accession no. P77488) transketolases. The underlined domain fits to the consensus thiamin diphosphate-binding site (striped bar), which is well conserved among various thiamine-dependent enzymes (Hawkins et al., 1989; Schenk et al., 1997), and the transketolase motifs (Schenk et al., 1997) are indicated by the striped and solid bars. The invariant Glu residue thought to be specific for transketolase activity is indicated by a star. The arrowheads indicate the amino terminus of the recombinant proteins expressed in E. coli.

CapTKT1 and CapTKT2 displayed 21.6% amino acid identity with each other. However, CapTKT1 shared 89%, 87%, and 82.7% amino acid identity with potato (accession no. Q43848), Craterostigma plantagineum (Bernacchia et al., 1995), and spinach chloroplast (Flechner et al., 1996) transketolases, respectively. In addition, the identity with E. coli and yeast transketolase varied from 52.3% to 53.7%. CapTKT2 also showed at least 80% amino acid identity with Arabidopsis CLA1 (Mandel et al., 1996) (Fig. 1), the Arabidopsis cDNA clone (Y14333), Arabidopsis genomic clone sequence (Z97339), and several EST clones from Arabidopsis (W43388), pine (H75224), rice (D46713 and D46576), and castor bean (T14878). In addition, CapTKT2 showed 45.6% to 54.4% amino acid sequence identity with the gene product encoded by Synechocystis (D90903), E. coli (P77488), and Rhodobacter (P26242) open reading frames (Fig. 1).

To localize CapTKT1 and CapTKT2 in pepper cells, antibodies raised against recombinant CapTKT1 and CapTKT2 were used to detect their presence in plastids and mitochondria. Intact and pure chloroplasts, chromoplasts, and mitochondria were prepared from pepper fruits (Fig. 2) and their total proteins were subjected to western blotting against anti-CapTKT1 and anti-CapTKT2 antibodies. Data displayed in Figure 3 reveal that CapTKT2 antibodies specifically react with plastidial polypeptides having approximatively a molecular mass of 67 to 70 kD, in good agreement with the mature size predicted from CapTKT2 cDNA. No reactive polypeptide bands were detected in mitochondria (Fig. 3). Similar results were obtained with CapTKT1 (results not shown). Thus, CapTKT1 and CapTKT2 exclusively colocalize in plastids, as suggested by the putative plastid-targeting signal (Von Heijne et al., 1991) observed at the amino terminus of CapTKT1 and CapTKT2 cDNAs (Fig. 1).

View larger version (120K): [in this window] [in a new window]   Figure 2. Electron micrograph showing the purity of pepper cell organelles used for CapTKT2 localization in chloroplasts (A), chromoplasts (B), and mitochondria (C). Bars, 1 µm.

View larger version (70K): [in this window] [in a new window]   Figure 3. SDS-PAGE and immunoblot analysis of CapTKT. A, Coomassie blue-stained gel of proteins isolated from chloroplasts (Chl), chromoplasts (Chr), and mitochondria (Mit). B, Immunoblot analysis of organelle proteins shown in A with anti-CapTKT2. For both A and B, molecular mass (MW) markers are shown on the left in kD.

To determine the biological function of CapTKT1 and CapTKT2, the coding regions of both cDNAs were ligated to the bacterial vector pKK223-3 for expression in E. coli. Following IPTG induction and SDS-PAGE analysis of samples of bacterial cultures, prominent polypeptide bands having molecular masses of 74 kD (CapTKT1) and 71 kD (CapTKT2) were observed in extracts of transformed but not in nontransformed E. coli cells (Fig. 4). Following lysis of bacterial cells and centrifugation, recombinant CapTKT1 and CapTKT2 proteins recovered in the supernatant were subjected to two chromatographic purification steps using Q-Sepharose and Mono-Q columns (Fig. 4) before analyzing their transketolase activity according to the two enzymatic procedures described in the experimental section. Preliminary enzyme tests were performed on purified CapTKT1 and CapTKT2 by incubating each with D-xylulose-5-phosphate (a C2 donor) and D-Rib-5-phosphate (a C2 acceptor), the two usual substrates of transketolases. Under these conditions only CapTKT1 showed significant activity (Table I), behaving as previously characterized plastid transketolases (Murphy and Walker, 1982; Flechner et al., 1996).

View larger version (90K): [in this window] [in a new window]   Figure 4. Purification of recombinant CapTKT1 and CapTKT2. A and B, Coomassie blue-stained gel of proteins representative of recombinant CapTKT1 and CapTKT2 purification after IPTG induction. Lanes from left to right include: total proteins from E. coli harboring control vector (pKK-Insert); vector plus insert (pKK+CapTKT1 in A and pKK+CapTKT2 in B); and pooled active fractions from the Q-Sepharose Fast-Flow (Q Seph) and Mono-Q HR (MonoQ) columns. For both A and B, molecular mass (MW) markers are shown on the left in kD.

Additional studies using pyruvic acid (a C2 donor) and D-glyceraldehyde-3-phosphate (a C2 acceptor), the two putative substrates predicted for use by the nonmevalonic acid pathway of IPP synthesis (Rohmer et al., 1996; Arigoni et al., 1997), revealed that CapTKT2 alone catalyzed a transketolation condensation (Table I), yielding 1-deoxy-xylulose-5-phosphate, which after dephosphorylation migrated with authentic unlabeled 1-deoxy-xylulose to a R_F of 0.45. The K_m of CapTKT1 for D-xylulose-5-phosphate, D-Rib-5-phosphate, and D-erythrose-4-phosphate was 95, 750, and 200 µM, respectively. The K_m of CapTKT2 for pyruvate and D-glyceraldehyde-3-phosphate was 500 and 750 µM, respectively. As shown in Table I, CapTKT1 utilized preferentially products of the plastid pentose phosphate pathway, whereas CapTKT2 had a preference for pyruvate as 2-carbon ketol donors. This confirmed that each enzyme possessed distinctly different roles. The role of CapTKT2 is reminiscent of a partially purified E. coli pyruvate dehydrogenase (Yokota and Sasajima, 1984, 1986).

As this manuscript was being prepared, a report of a previously uncharacterized E. coli gene (P77488) was shown to encode a deoxy-xylulose synthase (Sprenger et al., 1997). This likely catalyzes the aforementioned reactions (Yokota and Sasajima, 1984, 1986), since other previously characterized E. coli transketolases, A and B, are not involved in deoxy-xylulose synthesis (Zhao and Winkler, 1994). Thus, CapTKT2 could be designated as a deoxy-xylulose synthase, as shown for E. coli (Sprenger et al., 1997).

A mandatory requirement for transketolation is the presence of the prosthetic group TPP (Lindqvist and Schneider, 1993). In fact, during transketolase catalysis, fission of the ketol group of the donor is initiated by the C2 atom of the thiazolium ring, which is activated by deprotonation via an invariant Glu residue that has been characterized for yeast transketolase (Wikner et al., 1994; Kern et al., 1997). The sequence alignment of CapTKT1 and CapTKT2 suggests that Glu-491 and Glu-449 fulfill this role in CapTKT1 and CapTKT2, respectively (Fig. 1). When Glu-491 and Glu-449 were mutated into Ala, the electrophoretic behavior of wild-type and mutant CapTKT1 or CapTKT2 was not modified (results not shown). However, transketolase activity was nearly abolished in CapTKT1 and CapTKT2 (Table II).

Collectively, these findings suggest that plastids possess two types of transketolases with distinct specificities. Further confirmation of these different roles for CapTKT1 and CapTKT2 is supported by the fact that during the chloroplast-to-chromoplast transition in pepper, expression of CapTKT1 gene is nearly constitutive, whereas expression of CapTKT2 gene is up-regulated when carotenoid accumulation is at its greatest (Fig. 5). This coincides with the period when plastidial demand for IPP is at its highest level.

View larger version (51K): [in this window] [in a new window]   Figure 5. Analysis of CapTKT1 and CapTKT2 mRNAs during chloroplast-to-chromoplast differentiation in pepper fruit. Identical amounts of total RNA (20 µg) were blotted onto each lane and hybridized with the specified probes. Top to bottom, CapTKT1 cDNA, CapTKT2 cDNA, and pepper fruit probe coding for 25S rRNAs used as a standard probe. Chloroplast-to-chromoplast differentiation stages were characterized by the level of the chromoplast-specific carotenoid capsanthin.

	DISCUSSION

Top Abstract Introduction Methods Results Discussion References

Dedicated Roles of Plastid Transketolases

CapTKT1, like previously characterized plastid transketolases (Murphy and Walker, 1982; Bernacchia et al., 1995), links the plastidial pentose phosphate and the glycolytic cycles under physiological conditions. In contrast, CapTKT2 catalyzes an irreversible reaction between glyceraldehyde phosphate and pyruvate to yield deoxy-xylulose phosphate, the IPP precursor (Fig. 6). As a consequence, CapTKT2 probably initiates the nonmevalonic acid pathway for isoprenoid synthesis in plastids. The fact that similar open reading frames exist in E. coli, Rhodobacter, and Synechocystis also reinforces the cyanobacterial endosymbiotic origin of plastids.

View larger version (15K): [in this window] [in a new window]   Figure 6. Metabolic specificities of plastid CapTKT1 and CapTKT2. Due to its flexibility, CapTKT1 integrates the plastid stroma pentose phosphate and glycolytic cycles, whereas CapTKT2 catalyzes an irreversible condensation between D-glyceraldehyde-3-phosphate and pyruvate to yield 1-deoxy-xylulose-5-phosphate. The latter is further channeled to the formation of IPP, thiamine, or pyridoxine. P, Phosphate.

Interaction between Plastid Isoprenoid and Vitamin Biosynthesis

Interaction between Plastid and Cytosol Compartments during Isoprenoid Biosynthesis

In unicellular alga the nonmevalonic acid pathway of IPP synthesis is known to be involved in sterol synthesis (Schwender et al., 1996); however, in higher plants IPP for sterol synthesis is prominently formed by the mevalonic pathway. One intriguing feature is that despite the fact that parallel pathways appear to occur in different compartments, isoprenoid substrates formed in the cytosol can still apparently also be transported into the plastid and vice versa (Schwarz, 1994; Nabeta et al., 1995; Arigoni et al., 1997). It has also been suggested that two mevalonic acid pathways can operate in cell cultures of mulberry tree cells, one that is sensitive to mevinolin and another that is not (Hano and Nomura, 1995). Obviously, plant cells possess complex features with regard to IPP synthesis, and additional studies are needed to clarify the steps leading from deoxy-xylulose to IPP formation to determine how the metabolic flux of isoprenoid precursors is regulated at the molecular level.

	FOOTNOTES

   Received February 23, 1998; accepted May 11, 1998.
   The accession numbers for the sequences reported in this article are Y15781 (CapTKT1) and Y15782 (CapTKT2).
¹   Research support was partly provided by the European Community Program (FAIR CT no. 96.1633).

	ABBREVIATIONS

Abbreviations: EST, expressed sequence tag. IPP, isopentenyl diphosphate. IPTG, isopropylthio--galactoside. RACE, rapid amplification of cDNA ends.

	ACKNOWLEDGMENTS

We thank Dr. J. Schäeffer for electron microscopy and Professor Ian D. Spenser for the kind gift of deoxypentulose. We also thank Professor M. Rohmer for critical reading of the manuscript.

	LITERATURE  CITED

Top Abstract Introduction Methods Results Discussion References

Arigoni D, Sagner S, Latzel C, Eisenreich W, Bacher A, Zenk MH (1997) Terpenoid biosynthesis from 1-deoxy-D-xylulose in higher plants by intramolecular skeletal rearrangement. Proc Natl Acad Sci USA 94: 10600-10605 [Abstract/Free Full Text]

Bach TJ, Lichtenthaler HK (1983) Inhibition by mevilonin of plant growth, sterol formation and pigment accumulation. Physiol Plant 59: 50-60 [CrossRef]

Bernacchia G, Schwall G, Lottspeich F, Salamini F, Bartels D (1995) The transketolase gene family of the resurrection plant Craterostigma plantagineum: differential expression during the rehydratation phase. EMBO J 14: 610-618 [ISI][Medline]

Bolte J, Demuynck C, Samaki H (1987) Utilization of enzymes in organic chemistry: transketolase catalyzed synthesis of ketoses. Tetrahedron Lett 28: 5525-5528 [CrossRef]

Bouvier F, d'Harlingue A, Camara B (1997) Molecular analysis of carotenoid cyclase inhibition. Arch Biochem Biophys 346: 53-64 [CrossRef][Medline]

Bouvier F, d'Harlingue A, Hugueney P, Marin E, Marion-Poll A, Camara B (1996) Xanthophyll biosynthesis: cloning, expression, functional reconstitution, and regulation of -cyclohexenyl carotenoid epoxidase from pepper (Capsicum annuum). J Biol Chem 271: 28861-28867 [Abstract/Free Full Text]

Boynton JE (1966) Chlorophyll-deficient mutants in tomato requiring vitamin B1. I. Genetics and physiology. Hereditas 56: 171-199

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254 [CrossRef][ISI][Medline]

Camara B (1993) Plant phytoene synthase complex: component enzymes, immunology, and biogenesis. Methods Enzymol 214: 352-365

Camara B, Hugueney P, Bouvier F, Kuntz M, Monéger R (1995) Biochemistry and molecular biology of chromoplast development. Int Rev Cytol 163: 175-247 [ISI][Medline]

David S, Estramareix B, Fischer JC, Thérisod M (1981) 1-deoxy-D-threo-2-pentulose: the precursor of the five carbon chain of the thiazole of thiamine. J Am Chem Soc 103: 7341-7342 [CrossRef]

Deruère J, Römer S, d'Harlingue A, Backhaus RA, Kuntz M, Camara B (1994) Fibril assembly and carotenoid over accumulation: a model for supramolecular lipoprotein structures. Plant Cell 6: 119-133 [Abstract]

Devereux J, Haeberli P, Smithies O (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12: 387-395

Disch A, Hemmerlin A, Bach TJ, Rohmer M (1998) Mevalonate-derived isopentenyl diphosphate is the biosynthetic precursor of ubiquinone prenyl side chain in tobacco BY-2 cells. Biochem J 331: 615-621

Duvold T, Bravo JM, Pale-Grosdemange C, Rohmer M (1997) Biosynthesis of 2-C-methyl-D-erythritol, a putative C₅ intermediate in the mevalonate independent pathway for isoprenoid biosynthesis. Tetrahedron Lett 33: 4769-4772 [CrossRef]

Eisenreich W, Menhard B, Hylands P, Zenk MH, Bacher A (1996) Studies on the biosynthesis of taxol: the taxane carbon skeleton is not of mevalonoid origin. Proc Natl Acad Sci USA 93: 6431-6436 [Abstract/Free Full Text]

Flechner A, Dressen U, Westhoff P, Henze K, Schnarrenberger C, Martin W (1996) Molecular characterization of transketolase (EC 2.2.1.1) active in the Calvin cycle of spinach chloroplasts. Plant Mol Biol 32: 475-484 [CrossRef][ISI][Medline]

Flesch G, Rohmer M (1988) Prokaryotic hopanoids: the biosynthesis of the bacteriohopane skeletonformation of isoprene units from two distinct acetate pools and a novel type of carbon/carbon linkage between a triterpene and D-ribose. Eur J Biochem 175: 405-411 [Medline]

Goodwin TW (1971) Biosynthesis. In O Isler, ed, Carotenoids. Birkhäuser Verlag, Basel, Switzerland, pp 577-636

Gray JC (1987) Control of isoprenoid biosynthesis in higher plants. Adv Bot Res 14: 25-91

Hano Y, Nomura T (1995) Alternative response of two isoprenoid biosynthetic pathways to compactin in Morus alba cell cultures. Naturwissenchaften 82: 376-378 [CrossRef]

Harboe N, Ingild A (1977) Immunization, isolation of immunoglobulins, estimation of antibody titre. In HH Axelsen, NH Kroll, B Weeks, eds, Quantitative Immunoelectrophoresis. Blackwell Scientific Publications, Oxford, UK, pp 161-164

Hawkins CF, Borges A, Perham RN (1989) A common structural motif in thiamin pyrophosphate-binding enzymes. FEBS Lett 255: 77-82 [CrossRef][ISI][Medline]

Heintze A, Görlach J, Leuschner C, Hoppe P, Hagelstein P, Schulze-Siebert D, Schultz G (1990) Plastidic isoprenoid synthesis during chloroplast development. Change from metabolic autonomy to a division-of-labor stage. Plant Physiol 93: 1121-1127 [Abstract/Free Full Text]

Heintze A, Riedel A, Aydogdu S, Schultz G (1994) Formation of chloroplast isoprenoids from pyruvate and acetate by chloroplasts from young spinach plants: evidence for a mevalonate pathway in immature chloroplasts. Plant Physiol Biochem 32: 791-797

Hill RE, Sayer BG, Spenser ID (1989) Biosynthesis of vitamin B₆: incorporation of D-1-deoxyxylulose. J Am Chem Soc 111: 1916-1917 [CrossRef]

Hobbs GR, Lilly MD, Turner NJ, Ward JM, Willets AJ, Woodley JM (1993) Enzyme-catalysed carbon-carbon bond formation: use of transketolase from Escherichia coli. J Chem Soc Perkin Trans I: 165-166

Huynh TV, Young RA, Davies RW (1985) Construction and screening cDNA libraries in gt10 and gt11. In DM Glover, eds, DNA Cloning: a Practical Approach. IRL Press, Oxford, UK, pp 49-78

Jacob-Wilk D, Goldschmidt EE, Riov J, Sadka A, Holland D (1997) Induction of a Citrus gene highly homologous to plant and yeast thi genes involved in thiamine biosynthesis during natural and ethylene-induced fruit maturation. Plant Mol Biol 35: 661-666 [CrossRef][ISI][Medline]

Julliard JH (1992) Biosynthesis of the pyridoxal ring (vitamin B₆) in higher plant chloroplasts and its relationship with the biosynthesis of the thiazole ring (vitamin B₁). C R Acad Sci Ser III 314: 285-290

Julliard JH, Douce R (1991) Biosynthesis of the thiazole moiety of thiamin (vitamin B₁) in higher plant chloroplasts. Proc Natl Acad Sci USA 88: 2042-2045 [Abstract/Free Full Text]

Kern D, Kern G, Neef H, Tittmann K, Killenberg-Jabs M, Wilner C, Schneider G, Hübner G (1997) How thiamine diphosphate is activated in enzymes. Science 275: 67-70 [Abstract/Free Full Text]

Kleinig H (1989) The role of plastids in isoprenoid biosynthesis. Annu Rev Plant Physiol Plant Mol Biol 40: 39-59 [CrossRef][ISI]

Knöss W, Reuter B, Zapp J (1997) Biosynthesis of the labdane diterpene marrubium in Marrubium vulgare via a non-mevalonate pathway. Biochem J 326: 449-454

Kobori Y, Myles DC, Whitesides GM (1992) Substrate specificity and carbohydrate synthesis using transketolase. J Org Chem 57: 5899-5907 [CrossRef]

Komeda Y, Tanaka M, Nishimune T (1988) A th-1 mutant of Arabidopsis thaliana is defective for a thiamine-phosphate-synthesizing enzyme: thiamine phosphate pyrophosphorylase. Plant Physiol 88: 248-250 [Abstract/Free Full Text]

Lange BM, Wildung MR, McCaskill D, Croteau R (1998) A family of transketolases that directs isoprenoid biosynthesis via a mevalonate-independent pathway. Proc Natl Acad Sci USA 95: 2100-2104 [Abstract/Free Full Text]

Li SL, Redei GP (1969) Thiamine mutants of the crucifer, Arabidopsis. Biochem Genet 3: 163-170 [CrossRef][ISI][Medline]

Lichtenthaler HK, Rohmer M, Schwender J (1997a) Two independent biochemical pathways for isopentenyl diphosphate and isoprenoid biosynthesis in higher plants. Physiol Plant 101: 643-652 [CrossRef]

Lichtenthaler HK, Schwender J, Disch A, Rohmer M (1997b) Biosynthesis of isoprenoids in higher plant chloroplasts proceeds via a mevalonate-independent pathway. FEBS Lett 400: 271-274 [CrossRef][ISI][Medline]

Lindqvist Y, Schneider G (1993) Thiamin diphosphate dependent enzymes: transketolase, pyruvate oxidase and pyruvate decarboxylase. Curr Opin Struct Biol 3: 896-901 [CrossRef]

MacLennan AP, Randall HM, Smith DW (1959) Detection and identification of deoxysugars on paper chromatograms. Analyt Chem 31, 2020-2022

Mandel MA, Feldmann KA, Herrera-Estrella L, Rocha-Sosa M, Léon P (1996) CLA1, a novel gene required for chloroplast development, is highly conserved in evolution. Plant J 9: 649-658 [CrossRef][ISI][Medline]

McCaskill D, Croteau R (1995) Monoterpene and sesquiterpene biosynthesis in glandular trichomes of peppermint (Mentha × piperita) rely exclusively on plastid-derived isopentenyl diphosphate. Planta 197: 49-56

McHale NA, Hanson KR, Zelitch I (1988) A nuclear mutation in Nicotiana sylvestris causing a thiamine reversible defect in synthesis of chloroplast pigments. Plant Physiol 88: 930-935 [Abstract/Free Full Text]

Moore FD, Shephard DC (1978) Chloroplast autonomy in pigment synthesis. Protoplasma 94: 1-17

Murphy DJ, Walker DA (1982) The properties of transketolase from photosynthetic tissue. Planta 155, 316-320

Murr SM, Stebbins GL (1971) An albino mutant in Plantago insularis requiring thiamine pyrophosphate. I. Genetics 68: 231-243 [Free Full Text]

Nabeta K, Ishikawa T, Okuyama H (1995) Sesqui- and di-terpene biosynthesis from ¹³C-labelled acetate and mevalonate in cultured cells of Heteroscyphus planus. J Chem Soc Perkin Trans I: 3111-3115

Neuburger M, Journet EP, Bligny R, Carde JP, Douce R (1982) Purification of plant mitochondria by isopycnic centrifugation in density gradients of percoll. Arch Biochem Biophys 217: 312-323 [CrossRef][ISI][Medline]

Praekelt UM, Byrne KL, Meacock PA (1994) Regulation of thi4 (mol1), a thiamine-biosynthetic gene of Saccharomyces cerevisiae. Yeast 10: 481-490 [CrossRef][ISI][Medline]

Proebsting WM, Maggard SP, Guo WW (1990) The relationship of thiamine to the Alt locus of Pisum sativum L. J Plant Physiol 13: 231-235

Reizer J, Reizer A, Bairoch A, Saier JMH (1993) A diverse transketolase family that includes the RecP protein of Streptococcus pneumoniae, a protein implicated in genetic recombination. Res Microbiol 144: 341-347 [Medline]

Rohmer M, Knanni M, Simonin P, Sutter B, Sahm H (1993) Isoprenoid biosynthesis in bacteria: a novel pathway for the early steps leading to isopentenyl diphosphate. Biochem J 295: 517-524

Rohmer M, Seemann M, Horbach S, Bringer-Meyer S, Sahm H (1996) Glyceraldehyde 3-phosphate and pyruvate as precursors of isoprenic units in an alternative non-mevalonate pathway for terpenoid biosynthesis. J Am Chem Soc 118: 2564-2566 [CrossRef]

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Schenk G, Layfield R, Candy JM, Duggleby RG, Nixon PF (1997) Molecular evolutionary analysis of the thiamine-diphosphate-dependent enzyme, transketolase. J Mol Evol 44: 552-572 [CrossRef][Medline]

Schwarz MK (1994) Terpen-Biosynthese in Ginkgo biloba:eine überraschende Geschichte. PhD thesis. Eidgenössische Technische Hochschule, Zürich

Schwender J, Seemann M, Lichtenthaler HK, Rohmer M (1996) Biosynthesis of isoprenoids (carotenoids, sterols, prenyl side chain of chlorophylls and plastoquinone) via a novel pyruvate/glyceraldehyde 3-phosphate non-mevalonate pathway in the green Scenedesmus obliquus. Biochem J 316: 73-80

Smith DE, Fisher PA (1984) Identification, developmental regulation, and response to heat shock of two antigenically related forms of a major nuclear envelope protein in Drosophila embryos: application of an improved method for affinity purification of antibodies using polypeptides immobilized on nitrocellulose blots. J Cell Biol 99: 20-28 [Abstract/Free Full Text]

Sprenger GA, Schörken U, Wiegert T, Grolle S, de Graaf AA, Taylor SV, Begley TP, Bringer-Meyer S, Sahm H (1997) Identification of a thiamin-dependent synthase in Escherichia coli required for the formation of the 1-deoxy-D-xylulose 5-phosphate precursor to isoprenoids, thiamin, and pyridoxol. Proc Natl Acad Sci USA 94: 12857-12862 [Abstract/Free Full Text]

Thom E, Möhlmann T, Quick WP, Camara B, Neuhaus E (1998) Enzymic components of plastids from sweet pepper fruits, characterisation of the plastidic oxidative pentose phosphate pathway and transport processes across the envelope membrane. Planta 204: 226-233 [CrossRef]

Verwoerd TC, Dekker BMM, Hoekema A (1989) A small-scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Res 17: 2362 [Free Full Text]

Villafranca JJ, Axelrod B (1971) Heptulose synthesis from nonphosphorylated aldoses and ketoses by spinach transketolase. J Biol Chem 246: 3126-3131 [Abstract/Free Full Text]

Von Heijne G, Hirai T, Klösgen RB, Steppuhn J, Bruce B, Keegstra K, Herrmann RG (1991) CHLPEP: a database of chloroplast transit peptides. Plant Mol Biol 9: 104-126

Wikner C, Meshalkina L, Nilsson U, Nikkola M, Lindqvist Y, Sundström M, Schneider G (1994) Analysis of an invariant cofactor-protein interaction in thiamin diphosphate-dependent enzymes by site-directed mutagenesis-glutamic acid 418 in transketolase is essential for catalysis. J Biol Chem 269: 32144-32150 [Abstract/Free Full Text]

Yokota A, Sasajima K (1984) Formation of 1-deoxy-D-threo-pentulose and 1-deoxy-L-threo-pentulose by cell-free extracts of microorganisms. Agric Biol Chem 149: 149-158

Yokota A, Sasajima KI (1986) Formation of 1-deoxy-ketoses by pyruvate dehydrogenase and acetoin dehydrogenase. Agric Biol Chem 50: 2517-2524

Zhao G, Winkler ME (1994) An Escherichia coli K-12 tktA tktB mutant deficient in transketolase activity requires pyridoxine (vitamin B₆) as well as the aromatic amino acids and vitamins for growth. J Bacteriol 176: 6134-6138 [Abstract/Free Full Text]

Copyright Clearance Center:   0032-0889/98/117//09
 
© 1998 American Society of Plant Physiologists