|
Plant Physiol. (1998) 118: 51-58
Expression of the Yeast FRE Genes in Transgenic
Tobacco
Andrew I. Samuelsen2,
Ruth C. Martin,
David W.S. Mok, and
Machteld C. Mok*
Department of Horticulture and Center for Gene Research and
Biotechnology, Oregon State University, Corvallis, Oregon 97331-7304
 |
ABSTRACT |
Two
yeast genes, FRE1 and FRE2 (encoding
Fe(III) reductases) were placed under the
control of the cauliflower mosaic virus 35S promoter and introduced
into tobacco (Nicotiana tabacum L.) via
Agrobacterium tumefaciens-mediated transformation.
Homozygous lines containing FRE1, FRE2,
or FRE1 plus FRE2 were generated. Northern-blot analyses revealed mRNA of two different sizes in FRE1
lines, whereas all FRE2 lines had mRNA only of the expected length.
Fe(III) reduction, chlorophyll contents, and Fe levels were determined
in transgenic and control plants under Fe-sufficient and Fe-deficient
conditions. In a normal growth environment, the highest root Fe(III)
reduction, 4-fold higher than in controls, occurred in the double
transformant (FRE1 + FRE2). Elevated Fe(III) reduction was also
observed in all FRE2 and some FRE1 lines. The increased Fe(III)
reduction occurred along the entire length of the roots and on shoot
sections. FRE2 and double transformants were more tolerant to Fe
deficiency in hydroponic culture, as shown by higher chlorophyll and Fe
concentrations in younger leaves, whereas FRE1 transformants did not
differ from the controls. Overall, the beneficial effects of
FRE2 were consistent, suggesting that FRE2 may be used to improve Fe efficiency in crop
plants.
 |
INTRODUCTION |
Fe uptake and storage are highly regulated processes. Because
soils contain mainly insoluble Fe(III) oxides and hydroxides, plants
have developed adaptive mechanisms to make Fe more available for uptake
(for review, see Römheld, 1987 ; Guerinot and Yi, 1994 ). Two key
mechanisms used by dicots and nongramineous monocots (Strategy I
plants) are proton extrusion by activation of an ATPase-driven proton
pump, thereby promoting solubility of Fe(III), and Fe(III) reduction by
plasma membrane-bound Fe(III) reductases. Under Fe deficiency, elevated
activity of Fe(III) reductases can be detected in specialized zones
near the root tips.
The importance of Fe(III) reductases in Fe acquisition suggests that
manipulation or addition of genes encoding such enzymes in plants may
present an avenue for enhancing Fe uptake. Several Fe(III) reductases
have been identified in plants using techniques that allow separation
of PMs from other membrane fractions (for review, see Moog and
Brüggemann, 1994 ). Recently, plant genes encoding putative
Fe(III) reductases have been identified (Robinson et al., 1997a ).
As in plants using Strategy I, reduction of Fe(III) is also essential
for the utilization of Fe in yeast (Lesuisse et al., 1987 ). An Fe(III)
reductase has been isolated from yeast PM fractions (Lesuisse et al.,
1990 ) and the activity of the enzyme was increased upon Fe depletion.
Two Fe(III) reductase genes, FRE1 and FRE2, have
been isolated from the yeast Saccharomyces cerevisiae
(Dancis et al., 1990 , 1992 ; Georgatsou and Alexandraki, 1994 ) and a
related gene, Frp1, has been isolated from
Saccharomyces pombe (Roman et al., 1993 ). Dancis et al.
(1992) identified FRE1 via complementation of a mutant yeast
lacking externally directed PM reductase activity. The second Fe(III)
reductase gene of S. cerevisiae, FRE2, was identified during sequencing of yeast chromosome XI (Georgatsou and
Alexandraki, 1994 ). The combination of FRE1 and FRE2 was shown to
account for nearly all membrane-associated Fe(III) reductase activity
in this yeast (Georgatsou and Alexandraki, 1994 ). Even though
FRE1 and FRE2 encode enzymes with similar
functions, they do not show significant similarity at the nucleotide
level and their deduced amino acid sequences have only 24.5% identity.
Because yeast genes can be successfully expressed in plants (Colau et
al., 1987 ; Von Schaewen et al., 1990 ), incorporation of the
FRE genes into the plant genome may lead to the formation of
functional proteins and, consequently, enhanced Fe(III) reduction. Here
we report on the genetic transformation of tobacco (Nicotiana tabacum L.) with FRE1 and FRE2 and the
characterization of transformed plants with regard to Fe(III)
reduction, chlorophyll content (SPAD reading), and Fe
accumulation under Fe-sufficient and Fe-deficient conditions.
 |
MATERIALS AND METHODS |
Cloning of FRE1 and FRE2 into Plasmids
FRE1 was obtained from high-Mr
Saccharomyces cerevisiae genomic DNA (provided by S. Johnston, The University of Texas Southwestern Medical School, Dallas)
by PCR (92°C, 2 min; 52°C, 2 min; 72°C, 3 min; 40 cycles) using a
5 primer with added BamHI and NcoI sites
(CCGGGGATCCATGGTTAGAACCCGTGTATTATTCTGC) and a 3 primer with an added
EcoRI site (TTATGAATTCGGGGCCTTACCATGTAAAACTTTCTTC). The PCR
product (2.1 kb) was cloned into the SmaI site of pUC18. Plasmid was digested with NcoI and HindIII to
release the insert, which was then cloned into PTC:MT-1 (Carrington et
al., 1987 ) to gain a 5 Kozak sequence (Kozak, 1986 ). PTC:MT-1 plasmid
with the FRE1 insert was digested with BamHI to
release the FRE1-Kozak cassette, which was then cloned into
pPEV containing the enhanced cauliflower mosaic virus 35S promoter and
the NptII gene conferring kanamycin resistance (Lindbo and
Dougherty, 1992 ).
FRE2 was obtained from the yeast genomic DNA by the same PCR
procedures used to obtain FRE1. The 5 primer
CCAACGGGATCCATGCATTGGACGTCCATCTTGAGCGC and 3 primer
AAGTGGATCCTGATCACCAGCATTGATACTCTTCAAAG both contained BamHI
sites. The PCR product was cut with BamHI and cloned into BamHI-cut pUC18. The 2.1-kb fragment was then cloned into
dephosphorylated BamHI-cut pPEV. This plasmid was digested
with XbaI and EcoRI and the insert, with the
cauliflower mosaic virus 35S promoter, was cloned into the plant
expression vector pGPTV-BAR, conferring bialaphos resistance (Becker et
al., 1992 ).
Transformation of Tobacco
Agrobacterium tumefaciens EHA105 (Hood et al., 1993 )
was transformed with pPEV containing FRE1 and pGPTV-BAR
containing FRE2 by the procedures of Hofgen and Willmitzer
(1988) . These EHA105/FRE1 and EHA105/FRE2
combinations were used for transformation of leaf discs of tobacco
(Nicotiana tabacum L. cv Wisc. 38) by the methods described
by Horsch et al. (1988) . Shoots were selected on Murashige and Skoog
medium (Murashige and Skoog, 1962 ) with 1 mg L 1
N6-BA, 0.1 mg L 1
-naphthalene acetic acid, 400 mg L 1 Timentin
(SmithKline-Beecham), and either 400 mg L 1
kanamycin for transformation with FRE1 or 5 mg
L 1 bialaphos for transformation with
FRE2. Resistant shoots were transferred to Murashige and
Skoog medium with 400 mg L 1 Timentin plus 400 mg L 1 kanamycin (or 10 mg
L 1 bialaphos) for rooting. Twenty-one
independent putative FRE1 transformants were selected for
production of T1 seed. As expected, T1 populations segregated for kanamycin
resistance. Some fit a 3:1
(kanr:kans) segregation
ratio; others had higher proportions of kanr
plants likely due to two or more independent insertions. Plants from
three independent families showing 3:1 segregation ratios (kanr:kans) (Table
I) were selfed to generate
T2 lines uniformly resistant to kanamycin. These
were designated FRE1-A, FRE1-B, and FRE1-C. Eighteen independent
FRE2 transformants were selected. Plants from three
T1 families with 3:1 segregation ratios
(bialaphosr:bialaphoss)
(Table I) were selfed to give rise to T2 lines
homozygous for bialaphos resistance, designated FRE2-A, FRE2-B, and
FRE2-C. FRE1-C was used for retransformation with FRE2, and
16 T1 lines were generated. One of the
T1 lines with a single FRE2 locus
(Table I), FRE1+2-A, was selfed to obtain a transformed line with
homozygous FRE1 and FRE2 loci. In addition,
homozygous kanamycin-resistant (NI-1) and bialaphos-resistant (NI-2)
control lines without FRE inserts were generated.
View this table:
[in this window]
[in a new window]
|
Table I.
Segregation (resistance:sensitivity) of
FRE-transformed T1 populations and 2 and P
values based on 3:1 segregation ratios
|
|
PCR, Southern-Blot Analyses, and Northern-Blot Analyses of
Transformed Plants
Genomic DNA was isolated from individual T2
seedlings using a modified hexadecyltrimethylammonium bromide procedure
(Doyle and Doyle, 1990 ). Primers were designed to amplify a 1-kb region of DNA within the FRE1 gene (CAACTCGAGGCAAGGGTCTC and
CAAACCAGCGGCTACACCTAC). PCR amplification was performed using 100 ng of
DNA, 0.4 µM primers, 0.6 mM
deoxyribonucleotide triphosphate, 2.5 mM
MgCl2, and 2 to 3 units of Taq DNA
polymerase in buffer supplied by the manufacturer (Promega). PCR
conditions included one cycle of 5 min at 95°C, 1 min at 67°C, and
1.5 min at 72°C; and 30 cycles of 1 min at 94°C, 1.5 min at 67°C,
and 1 min at 72°C. PCR products were analyzed on a 1.2% agarose gel.
For Southern-blot analyses, genomic DNA was extracted from 2 g of
tobacco leaf tissue using the hexadecyltrimethylammonium bromide
protocol (Doyle and Doyle, 1990 ). DNA (20 µg) was digested with a
restriction enzyme, EcoRV for FRE1-containing
lines and XbaI for FRE2-containing lines,
separated on a 1.1% gel, and transferred by capillary transfer to a
Zeta-Probe GT membrane following the manufacturer's instructions
(Bio-Rad). (It should be noted that there is no EcoRV site
in FRE1 and no XbaI site in FRE2.) The [ -32P]dCTP-labeled probe, covering the
entire FRE1 or FRE2 gene, was synthesized using
Ready-To-Go DNA-labeling beads (Pharmacia) following the
manufacturer's protocol and purified on a Biospin 6 chromatography column (Bio-Rad). Membranes were incubated in 0.25 M
Na2HPO4, pH 7.2, 7% SDS,
and 1 mM EDTA at 65° for 30 min. Using fresh solution, membranes were hybridized with the labeled probe for 24 h.
Membranes were washed for 45 min at 65°C in 0.04 M
Na2HPO4, pH 7.2, 5% SDS, and 1 mM EDTA and then twice in 1% SDS, 40 mM
NaHPO4, and 1 mM EDTA. Finally, they
were exposed to x-ray film (Hyperfilm-MP, Amersham) at 80°C.
For northern-blot analyses, total RNA was isolated from 1 g of
leaf tissue according to the TRIzol reagent protocol (GIBCO-BRL). RNA
(30 µg) was separated on a formaldehyde gel (Davis et al., 1986 ). The
suggested protocol (Bio-Rad) was used for capillary transfer to a
Zeta-Probe membrane, and hybridization was performed as for the
Southern blot.
Hydroponic Culture
Seeds were surface sterilized with 70% ethanol (1 min) and 20%
commercial bleach (15 min), and germinated on one-half-strength Murashige and Skoog mineral medium with 1.6 g
L 1 Gelrite (Scott Laboratories, Carson,
CA) in Magenta (Chicago, IL) boxes. After 3 weeks, seedlings
were transferred to a hydroponic culture system, with one seedling per
Magenta box filled with Hoagland nutrient solution containing 10 µM Fe-EDTA. During the first week in hydroponics, the
seedlings were covered with glass jars to prevent desiccation. After 2 weeks in hydroponics, the Hoagland solution was replaced either with
fresh Hoagland solution or with the nutrient solution devised by Chaney
et al. (1992) containing 10 mM NaHCO3 and 2 µM Fe(III)-DTPA (Fe-deficient condition). Air enriched
with 3% CO2 was used for aeration of the
nutrient solution and stabilization of the pH (Chaney et al., 1992 ).
The solution was replaced after 7 d; on the other days the level
was adjusted with double-distilled water. Nutrient solution containing K2HPO4,
NH4NO3, and
H3BO3 was added daily to
maintain proper nutrient levels as described by Chaney et al. (1992) .
Relative leaf chlorophyll concentrations were determined for the upper
leaves on d 6 and 10 with a chlorophyll meter (model SPAD-502, Minolta,
Ramsey, NJ). SPAD readings (on a scale of 0-50) determined by
light reflection from two different light sources are linearly
related to extractable chlorophyll (Marquard and Tipton, 1987 ). The
upper, expanded leaf was designated leaf 1 at the beginning of the
experiment, and the leaves formed next were designated leaves 2, 3, and
4, respectively. Fe(III) reduction and Fe content of leaves were
determined after 10 d.
Fe(III) Reduction Assay
Fe(III) reduction was quantitatively determined using a liquid
assay and qualitatively visualized on agarose plates (semisolid medium). The assay solution consisted of 0.3 mM BPDS, 0.1 mM Fe(III)-EDTA, 5 mM Mes buffer, and
one-half-strength Murashige and Skoog mineral medium (Murashige and
Skoog, 1962 ) in the dark. Because Co2+,
Mn2+, Zn2+, and
Cu2+ interfere with Fe(III) reduction
(Römheld and Marschner, 1983 ), they were omitted from the assay
medium. Experiments were performed on 8- to 10-week-old plants grown in
flats with potting soil (Fe-sufficient conditions) in the greenhouse
(22°C day, 18°C night) and on plants grown hydroponically. Roots
were rinsed in double-distilled water and placed in assay solution.
Shoot pieces (100 mg) from the greenhouse-grown plants were cut into
eight slices and placed into assay medium. After 0.5 or 1 h, Fe
reduction was determined spectrophotometrically from the
A535 minus the blank (containing no tissue).
Fe(II)-BPDS was quantified using a molar extinction coefficient of
22.14 mM 1
cm 1. Roots were blotted dry and weighed. Data
were obtained from two replicate experiments each with four samples
(greenhouse plants) or three samples (hydroponics).
For embedding in semisolid medium, roots or stem sections were placed
on Whatman no. 1 filter paper in 90- × 90- × 15-mm Petri dishes.
Assay medium (see above) containing 0.25% agarose (type I, Sigma) was
cooled to 35°C and pipetted into the Petri plates (50 mL/plate).
To determine reduction by exudates, roots were incubated in assay
solution without BPDS and Fe(III)-EDTA for 0.5 h, after which they
were removed and the two compounds were added to the solution. Fe(III)
reduction was determined as described above.
Fe Concentration of Leaves
Plants from two hydroponic experiments were pooled. The upper four
leaves of all plants of a line were included. The samples were dried
and mineral contents were determined with an Optima 3000 dual view
inductively coupled plasma optical emission spectroscopy (Perkin-Elmer)
at the Crop and Soil Science Analytical Laboratory at Oregon State
University.
 |
RESULTS |
Genetic Characterization
The presence of transgenes was confirmed by Southern blots of DNA
digested with EcoRV and XbaI probed with
FRE1 (Fig. 1A) and
FRE2 (Fig. 1B), respectively. Five clear bands were visible in FRE1-A, one in FRE1-B, and three in FRE1-C when FRE1 was
used as the probe (Fig. 1A). As expected, FRE1+2-A, a derivative of FRE1-C, also had three clear bands. When FRE2 was used as a
probe, a single complementary fragment was detected in FRE2-A, FRE2-C (Fig. 1B), and FRE2-B (not shown). FRE1+2-A had two
FRE2-positive bands. All 10 plants of each line analyzed had
the same banding patterns, supporting the evidence from data on
resistance to drugs that these progeny are homozygous. The control
lines did not show any hybridizing bands with FRE1 or
FRE2 as a probe (not shown).

View larger version (85K):
[in this window]
[in a new window]
| Figure 1.
Southern blot of FRE-transformed
lines of tobacco. A, Probed with FRE1. Lane 1, FRE1-A;
lane 2, FRE1-B; lane 3, FRE1-C; and lane 4, FRE1+2-A. B, Probed with
FRE2. Lane 1, FRE2-C; lane 2, FRE2-A; and lane 3, FRE1+2-A. DNA marker sizes (kilobases) are indicated at the right of
each gel.
|
|
Northern blots of mRNA from transformed plants probed with
FRE1 or FRE2 indicated that the corresponding
messages were made in transformants (Fig.
2). In addition to the full-length mRNA, a lower band was clearly visible in the FRE1-containing
lines. The relative abundance of this shorter message differed between lines and was highest in FRE1-A. No bands could be detected in wild-type and NI control lines after hybridization under stringent conditions.

View larger version (64K):
[in this window]
[in a new window]
| Figure 2.
Northern blot of FRE-transformed
lines of tobacco. A, Probed with FRE1. Lane 1, NI-1;
lane 2, FRE1-A; lane 3, FRE1-B; lane 4, FRE1-C; lane 5, FRE1+2-A; and
lane 6, wild type. B, Probed with FRE2. Lane 1, NI-2;
lane 2, FRE2-A; lane 3, FRE2-B; lane 4, FRE2-C; lane 5, FRE1+2-A; and
lane 6, wild type. RNA marker sizes (kilobases) are indicated at the
right of each gel.
|
|
Fe(III) Reduction in Fe-Sufficient Conditions
The presence of FRE1 and FRE2 resulted in
increased Fe(III) reduction as determined both by visual inspection and
quantitative measurement. When roots of greenhouse-grown plantlets were
embedded in semisolid assay medium containing 25 µM
Fe(III), the transformants started showing red color within 1 h
and were bright red after 6 h (Fig.
3, A and B), at which time the controls
were only slightly tinged. FRE1+2-A roots consistently had the
most-intense red color development on and around the roots (Fig. 3B).

View larger version (125K):
[in this window]
[in a new window]
| Figure 3.
Fe(III) reductase assays of tobacco roots and
shoot segments of 8-week-old plants grown in the greenhouse. A, Roots
of control NI-1 (left) and transformant FRE1-C (right) after 6 h
in semisolid medium with 25 µM Fe(III)-EDTA and 0.3 mM BPDS. B, Roots of FRE2-B (left) and FRE1+2-A (right)
after 6 h in semisolid medium with 25 µM
Fe(III)-EDTA and 0.3 mM BPDS. C, Shoot segments of control
NI-1 (top) and transformant FRE1+2-A (bottom) after 4 h in
semisolid medium with 0.1 mM Fe(III)-EDTA and 0.3 mM BPDS. D, Shoot segments of 10 seedlings of a family
segregating for FRE1 in semisolid medium after 4 h
in semisolid medium with 0.1 mM Fe(III)-EDTA and 0.3 mM BPDS; PCR analyses of the same seedlings and water
control (0) with FRE1 primers are shown at bottom.
|
|
In liquid Fe(III) reduction assays performed with roots excised from
plants grown in greenhouse potting soil, FRE-containing lines had generally increased reduction, with up to 4-fold higher activity than control lines in a 1-h assay with 100 µM
Fe(III)-EDTA (Fig. 4A). The FRE1+2 line
had the highest Fe-reduction activity. The two
FRE-transformed lines that did not show enhanced Fe(III) reduction compared with the controls were FRE1-A and FRE1-B. FRE1-A also showed the highest level of truncated mRNA in the northern blots
(Fig. 2A, lane 2). Fe(III) reduction of exudates did not differ between
lines; it contributed about 25% to the total Fe(III) reduction of the
wild type and relatively less to the transformants. Therefore,
differences between transformed and control lines reflect Fe(III)
reduction by the roots. Essentially the same results were obtained with
roots of plants grown in Hoagland solution hydroponically. FRE1 lines
varied in their Fe(III) reduction levels, whereas FRE2 lines had
consistently higher Fe(III) reduction levels than the controls (data
not shown).

View larger version (36K):
[in this window]
[in a new window]
| Figure 4.
Fe(III) reduction in 0.1 mM
Fe(III)-EDTA and 0.3 mM BPDS for 1 h of control (wild
type [WT], NI-1, and NI-2) and FRE-transformed plants.
A, Fe(III) reduction by roots. B, Fe(III) reduction by shoot sections.
The LSD (P = 0.05) is indicated by a bar.
|
|
Assays with stem segments also confirmed the higher Fe(III) reduction
in transformants than in the controls. Intense color formation was seen
at the cut ends (Fig. 3C). Fe(III) reduction in liquid assays (Fig. 4B)
was also significantly higher in transformants than in controls.
Generally, shoot Fe(III) reduction correlated with that obtained for
roots, indicating consistent expression of FRE1 and
FRE2 in roots and shoots. Again, the double transformant had
the highest reduction and the FRE1-A line was not significantly different from the control.
The correlation between the presence of FRE and increased Fe
reduction was further confirmed by examining 10 seedlings from a
T2 family segregating for FRE1. The
one shoot segment (no. 9) that produced weak color intensity typical of
nontransformed shoots in the plate assay was also the only one negative
in the PCR test (Fig. 3D).
Chlorophyll Formation and Fe(III) Reduction at Fe-Deficient
Conditions
Plants were grown in hydroponic culture (Fig.
5A) to manipulate the Fe availability.
Tiny seedlings obtained from seeds germinated under aseptic conditions
were first acclimated in Hoagland nutrient solution for 2 weeks and
then transferred to Fe-deficient culture solution. Fe deficiency was
created by the presence of 10 mM NaHCO3, which
increased the pH to 7.8. Leaf chlorosis appeared on control plants
after 4 to 5 d. Younger leaves became progressively more yellow
and by d 6, significant differences in chlorophyll concentrations (SPAD readings) of the upper two leaves were detected between FRE2 and control plants (data not shown). By d 10, the upper leaves of
the controls were highly chlorotic, whereas only slight yellowing occurred among the FRE2 transformants (Fig. 5B) and the double transformants (not shown). The visual difference was reflected by the
SPAD readings (Fig. 6). In
contrast, the phenotype and chlorophyll concentrations of FRE1
transformants were not significantly different from those of controls.
Older leaves, such as leaf 1, which were about fully expanded before Fe
stress was applied, were unaffected and remained green on all plants.

View larger version (52K):
[in this window]
[in a new window]
| Figure 5.
Plants grown in hydroponics. A, Hydroponic system
5 d before the start of the experiment. B, Plants of NI-2 (left),
FRE2-A (middle), and FRE2-C (right) after 10 d in nutrient
solution with 10 mM NaHCO3 and 2 µM Fe-DTPA.
|
|

View larger version (51K):
[in this window]
[in a new window]
| Figure 6.
SPAD leaf readings of control and
transformed plants after 10 d in Fe-deficient nutrient solution
with 10 mM NaHCO3 and 2 µM
Fe-DTPA. Leaf 1 was the lowest leaf included in the measurements and
the only fully expanded leaf at the beginning of the experiment; leaf 4 was the uppermost leaf at the completion of the experiment. The
LSD (P = 0.05) is indicated by a bar.
|
|
Fe(III) reduction was measured after 10 d (Fig.
7). It is interesting that Fe(III)
reduction was higher in the controls than in the FRE2 transformants.
Compared with plants grown in Fe-sufficient conditions, the controls
showed a 10- to 15-fold increase in reduction, whereas the increase in
the FRE1+2 transformant was only 2-fold. Root Fe reduction was
inversely related to leaf chlorosis and seemed to reflect the severity
of Fe stress sensed by the plant.

View larger version (42K):
[in this window]
[in a new window]
| Figure 7.
Root Fe(III) reduction in 0.1 mM
Fe(III)-EDTA and 0.3 mM BPDS of control (wild
type [WT], NI-1, and NI-2) and FRE-transformed
plants after 10 d in Fe-deficient nutrient solution with 10 mM NaHCO3 and 2 µM Fe-DTPA. The
LSD (P = 0.05) is indicated by a bar.
|
|
Leaf Fe Concentrations
The Fe concentrations in the upper three leaves of plants
grown under Fe-sufficient and Fe-deficient conditions were measured (Table II). The same sets of Fe-stressed
plants were used as were used for SPAD readings and Fe-reduction
determinations. For a comparison, plants of the same lines were grown
in Hoagland solution for the same duration. Clearly, the Fe
concentrations were significantly lower under Fe deficiency. However,
under both conditions, FRE2 plants (including the double transformant)
had about 50% higher Fe than the controls. FRE1 lines had Fe
concentrations closer to those of the controls than FRE2 lines when
grown under Fe deficiency and were more variable when Fe supply was
sufficient.
View this table:
[in this window]
[in a new window]
|
Table II.
Fe concentrations in the upper three leaves of
FREtransformed and control tobacco plants grown in Fe-sufficient
(Hoagland) solution or Fe-deficient (Chaney) solution for 10 d
|
|
Overall, FRE2 lines were consistent in all parameters measured. These
included higher Fe concentrations under both Fe-deficient and
Fe-sufficient conditions, higher leaf chlorophyll and lower Fe(III)
reduction under Fe stress, but higher Fe(III) reduction under Fe
sufficiency.
 |
DISCUSSION |
Comparisons between transgenic and control tobacco plants in
Fe-sufficient conditions indicated that the yeast FRE genes
are functional in plants. The increase in Fe(III) reduction at Fe sufficiency (up to 4-fold) was constitutive, occurring in both transformed roots and shoots. Fe(III) reduction varied between FRE1-containing lines, whereas FRE2 plants uniformly showed
higher activity. Although variability in transgene expression is a
common phenomenon and the presence of multiple gene copies can lead to gene silencing (Meyer, 1995 ), the variability may be caused by other
factors. One of the possibilities may be instability or premature
truncation of FRE1 mRNA, as illustrated by the occurrence of
a second, shorter-than-expected message. The relatively large amount of
this shorter mRNA in FRE1-A, the line without any increased Fe(III)
reductase activity, seems to lend support to this hypothesis. The
highest reduction activity was found in the line containing both
FRE1 and FRE2. This may be due to additive
effects of the FRE1 and FRE2 genes, as in yeast,
in which the two genes together account for the total Fe(III) reduction
activity (Georgatsou and Alexandrakis, 1994).
Transgenic FRE2 plants were more tolerant of Fe-deficient conditions.
The chlorophyll content was higher in new leaves of FRE2 and FRE1+FRE2
transformants than in comparable leaves of control plants. However, no
increased resistance to Fe-deficient conditions was found for FRE1
lines, including FRE1-C, which showed significantly increased Fe(III)
reduction. The reason for this is uncertain, but it is possible that
FRE1 protein has only low affinity for the Fe(III) substrate, resulting
in enzyme activity at the high substrate concentration (100 µM) of the Fe(III) reductase assay but not at low
substrate availability (Fe-deficient conditions in hydroponics). Also
intriguing is the inverse relationship between tolerance of Fe
deficiency and root Fe reduction under low Fe availability. It is
possible that, since their Fe levels are higher, FRE2-containing plants sense less stress than controls, and,
therefore, the native inducible Fe(III) reductase system is less
active. This interpretation would be compatible with the hypothesis
that signals from the shoots stimulate Fe reduction in roots (Grusak and Pezeshgi, 1996 ). In addition, constitutive expression of
FRE2 in shoots and leaves may increase the level of
available Fe for chlorophyll synthesis in these tissues. FRE2 plants
may show Fe(III) reduction levels as high as or higher than those of
controls if left under stress conditions for a longer period, but this
could not be tested in our present system because of the small size of
the containers relative to the size of the plants. Finally, the higher
chlorophyll level in FRE2-containing plants may be related
to other, as-yet-undetermined functions of the FRE genes. For yeast, Lesuisse et al. (1996) have provided evidence that the FRE
proteins may not be Fe(III) reductases themselves but rather a part of
a multicomponent electron-transport chain. However, the observation
that expression of FRE1 from a high-copy plasmid leads to
increased Fe reductase activity (Shatwell et al., 1996 ) indicates
clearly that FRE1 is an important and limiting component in Fe
reduction, regardless of its exact function.
Posttranslational modifications and targeting may also affect the
activity of FRE proteins in plants. The FRE1 sequence contains several
potential glycosylation sites (Dancis et al., 1992 ), and glycosylation
of the protein was demonstrated by in vitro transcription/translation products formed in the presence and absence of canine microsomes (Samuelsen, 1996 ). Fully active FRE1 may require a flavin or heme group, as suggested by data reported by Shatwell et al. (1996) . It is
not known at present if such modifications occur in transgenic plants.
In theory, effective Fe reductase should be located in the PM of
epidermal cells. The fact that most transgenic lines exhibited higher
Fe reductase activity under nonstress conditions than controls would
suggest that some of the FRE protein is correctly targeted. However,
ectopic expression of high levels of protein may lead to altered
localization and function. To answer some of these questions,
monoclonal antibodies to selected portions of the FRE proteins are
being generated.
Yamaguchi et al. (1995) reported no detectable effect of a similar
FRE1 construct in tobacco. Although in our tests the
FRE1 gene also had no effect on tolerance to Fe-deficient
conditions, it did enhance Fe(III) reduction under Fe sufficiency in
some of the transformed lines. It is not clear how many lines were examined by Yamaguchi et al. (1995) , but the lack of transgene effect
may be attributable to random variation among lines. Moreover, a
slightly different gene construct could have led to relatively high
mRNA truncation, as in line FRE1-A, and significant reduction of
functional gene product.
Although the exact mechanism of the FRE proteins in mediating tolerance
of Fe deficiency remains to be determined, from a practical point of
view, FRE2 and other Fe-related genes are promising candidates for improving Fe utilization in plants. These may include the Arabidopsis froh genes (Robinson et al., 1997a , 1997b )
and genomic clones with some homology to the FRE1 gene (Yi
et al., 1994 ). Because frohC transcript accumulated in roots
and leaves under Fe-deficient conditions, it was suggested that the
protein may be a membrane-bound Fe reductase involved in Fe transport. It will be interesting to determine if controlled expression of such
genes in specific tissues will alter Fe reduction and uptake.
 |
FOOTNOTES |
2
Present address: Biology Department, Albright
College, Reading, PA 19612.
*
Corresponding author; e-mail mokm{at}bcc.orst.edu; fax
1-541-737-3479.
Received March 9, 1998;
accepted June 16, 1998.
1
This research was supported by the U.S.
Department of Agriculture (USDA)-National Research Initiative
Competitive Grants Program (grant no. 95-37100-1566), the Oregon
Agricultural Experiment Station (paper no. 11,169), and USDA Special
Grant: Oregon/Massachusetts Biotechnology Partnership.
Abbeviations: BPDS, bathophenanthrolinedisulfonic acid; DTPA,
diethylenetriaminepentaacetic acid; PM, plasma membrane; SPAD, Specialty Products Agricultural Division.
 |
ACKNOWLEDGMENTS |
We thank Dr. Stephen Johnston (University of Texas Southwestern
Medical Center, Dallas) for his gift of yeast genomic DNA and Dr.
Detlef Becker (Hygienie Institut der Freien und Hansestadt Hamburg,
Germany) for providing the vector pGPTV-BAR. We thank Dr. Walter Ream
and Dr. Joyce Loper for their helpful suggestions on the manuscript.
 |
LITERATURE CITED |
Becker D,
Kemper E,
Schell J,
Masterson R
(1992)
New plant binary vectors with selectable markers located proximal to the left T-DNA border.
Plant Mol Biol
20:
1195-1197
[CrossRef][Web of Science][Medline]
Carrington JC,
Parks TD,
Cary SM,
Dougherty WG
(1987)
Vectors for cell-free expression and mutagenesis of protein-coding sequences.
Nucleic Acids Res
15:
10066
[Free Full Text]
Chaney RL,
Coulombe BA,
Bell PF,
Angle SJ
(1992)
Detailed method to screen dicot cultivars for resistance to Fe-chlorosis using FeDTPA and bicarbonate in nutrient solutions.
J Plant Nutr
15:
2063-2083
Colau D,
Negrutiu I,
Van Montagu M,
Hernalsteens J-P
(1987)
Complementation of a threonine dehydratase-deficient Nicotiana plumbaginifolia mutant after Agrobacterium tumefaciens-mediated transfer of the Saccharomyces cerevisiae ILV1 gene.
Mol Cell Biol
7:
2552-2557
[Abstract/Free Full Text]
Dancis A,
Klausner AD,
Hinnebusch AG,
Barriocanal JG
(1990)
Genetic evidence that ferric reductase is required for iron uptake in Saccharomyces cerevisiae.
Mol Cell Biol
10:
2294-2301
[Abstract/Free Full Text]
Dancis A,
Roman DG,
Anderson GJ,
Hinnebusch AG,
Klausner RD
(1992)
Ferric reductase of Saccharomyces cerevisiae: molecular characterization, role in iron uptake, and transcriptional control by iron.
Proc Natl Acad Sci USA
89:
3869-3873
[Abstract/Free Full Text]
Davis LG, Dibner MD, Battey JF (1986) Basic Methods in Molecular
Biology. Elsevier, New York
Doyle JJ,
Doyle JL
(1990)
Isolation of plant DNA from fresh tissue.
Focus
12:
13-15
Georgatsou E,
Alexandraki D
(1994)
Two distinctly regulated genes are required for ferric reduction, the first step of iron uptake in Saccharomyces cerevisiae.
Mol Cell Biol
14:
3065-3073
[Abstract/Free Full Text]
Grusak MA,
Pezeshgi S
(1996)
Shoot-to-root signal transmission regulates root Fe(III) reductase activity in the dgl mutant of pea.
Plant Physiol
110:
329-334
[Abstract]
Guerinot ML,
Yi Y
(1994)
Iron: nutritious, noxious, and not readily available.
Plant Physiol
104:
815-820
[CrossRef][Web of Science][Medline]
Hofgen R,
Willmitzer L
(1988)
Storage of competent cells for Agrobacterium transformation.
Nucleic Acids Res
16:
9877
[Free Full Text]
Hood EE,
Gelvin SB,
Melchers LS,
Hoekema A
(1993)
New Agrobacterium helper plasmids for gene transfer to plants.
Transgenic Res
2:
208-218
[CrossRef][Web of Science]
Horsch RB,
Fry J,
Hoffmann N,
Neidermeyer J,
Rogers SG,
Fraley RT
(1988)
Leaf disc transformation.
In
SB Gelvin,
RA Schilperoort,
eds, Plant Molecular Biology Manual.
Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 1-9
Kozak M
(1986)
Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.
Cell
44:
283-292
[CrossRef][Web of Science][Medline]
Lesuisse E,
Casteras-Simon M,
Labbe P
(1996)
Evidence for the Saccharomyces cerevisiae ferrireductase system being a multicomponent transport chain.
J Biol Chem
271:
13578-13583
[Abstract/Free Full Text]
Lesuisse E,
Crichton RR,
Labbe P
(1990)
Iron-reductases in the yeast Saccharomyces cerevisiae.
Biochim Biophys Acta
1038:
253-259
[CrossRef][Medline]
Lesuisse E,
Raguzzi F,
Crichton RR
(1987)
Iron uptake by the yeast Saccharomyces cerevisiae: involvement of a reduction step.
J Gen Microbiol
133:
3229-3236
[Abstract/Free Full Text]
Lindbo J,
Dougherty WG
(1992)
Pathogen-derived resistance to a potyvirus: immune and resistant phenotypes in transgenic tobacco expressing altered forms of a potyvirus coat protein nucleotide sequence.
Mol Plant Microbe Interact
5:
144-153
[Medline]
Marquard RD,
Tipton JL
(1987)
Relationship between extractable chlorophyll and an in situ method to estimate leaf greenness.
HortScience
22:
1327
Meyer P
(1995)
Variation of transgene expression in plants.
Euphytica
85:
359-366
Moog PR,
Brüggemann W
(1994)
Iron reductase systems on the plant plasma membrane: a review.
Plant Soil
165:
241-260
Murashige T,
Skoog F
(1962)
A revised medium for rapid growth and bioassays with tobacco tissue cultures.
Physiol Plant
15:
473-497
[CrossRef]
Robinson NJ,
Sadjuga MR,
Groom QJ
(1997a)
The froh gene family from Arabidopsis thaliana: putative iron-chelate reductases.
Plant Soil
196:
245-248
[CrossRef]
Robinson NJ,
Wilson JR,
Turner JS,
Fordham-Skelton AP,
Groom QJ
(1997b)
Metal-gene-interactions in roots: metallothionein-like genes and iron reductases.
In
HM Anderson,
PW Barlow,
DT Clarkson,
MB Jackson,
PR Shewry,
eds, Plant Roots: From Cells to Systems.
Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 117-130
Roman DG,
Dancis A,
Anderson GJ,
Klausner RD
(1993)
The fission yeast ferric reductase gene Frp1+ is required for ferric iron uptake and is homologous to the gp91-phox subunit of the human NADPH phagocyte oxidoreductase.
Mol Cell Biol
13:
4342-4350
[Abstract/Free Full Text]
Römheld V
(1987)
Existence of two different strategies for the acquisition of iron in higher plants.
In
G Winkelmann,
D van der Helm,
JB Neilands,
eds, Iron Transport in Microbes, Plants and Animals.
VCH, Weinheim, Germany, pp 353-374
Römheld V,
Marschner H
(1983)
Mechanism of iron uptake by peanut plants. I. Fe III reduction, chelate splitting, and release of phenolics.
Plant Physiol
71:
949-954
[Abstract/Free Full Text]
Samuelsen AI
(1996)
Transformation of tobacco with the yeast FRE1 and FRE2 genes: characterization of transformants and discovery of a temperature-dependent morphological mutant. PhD thesis.
Oregon State University, Corvallis
Shatwell KP,
Dancis A,
Cross AR,
Klausner RD,
Segal AW
(1996)
The FRE1 ferric reductase of Saccharomyces cerevisiae is a cytochrome b similar to that of NADPH oxidase.
J Biol Chem
271:
14240-14244
[Abstract/Free Full Text]
Von Schaewen A,
Stitt M,
Schmidt R,
Sonnewald U,
Willmitzer L
(1990)
Expression of a yeast-derived invertase in the cell wall of tobacco and Arabidopsis plants leads to accumulation of carbohydrate and inhibition of photosynthesis and strongly influences growth and phenotype of transgenic tobacco plants.
EMBO J
9:
3033-3044
[Web of Science][Medline]
Yamaguchi H, Fujiwara T, Mori S (1995) Genetic introduction of the
gene coding yeast ferric reductase into tobacco plants.
In International Conference on BioIron, Asheville, NC
(Abstracts), p 84
Yi Y, Saleeba JA, Guerinot ML (1994) Iron uptake in
Arabidopsis thaliana. In JA Manthey, DE Crowley, DG Luster,
eds, Biochemistry of Metal Micronutrients in the Rhizosphere. Lewis
Publishers, Boca Raton, FL, pp 295-307
This article has been cited by other articles:

|
 |

|
 |
 
M. A. Forner-Giner, M. J. Llosa, J. L. Carrasco, M. A. Perez-Amador, L. Navarro, and G. Ancillo
Differential gene expression analysis provides new insights into the molecular basis of iron deficiency stress response in the citrus rootstock Poncirus trifoliata (L.) Raf.
J. Exp. Bot.,
November 13, 2009;
(2009)
erp328v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Lindblom, S. Abdel-Ghany, B. R. Hanson, S. Hwang, N. Terry, and E. A. H. Pilon-Smits
Constitutive Expression of a High-Affinity Sulfate Transporter in Indian Mustard Affects Metal Tolerance and Accumulation
J. Environ. Qual.,
April 3, 2006;
35(3):
726 - 733.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Wangeline, J. L. Burkhead, K. L. Hale, S. D. Lindblom, N. Terry, M. Pilon, and E. A. H. Pilon-Smits
Overexpression of ATP Sulfurylase in Indian Mustard: Effects on Tolerance and Accumulation of Twelve Metals
J. Environ. Qual.,
January 1, 2004;
33(1):
54 - 60.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. E. Bennett, J. L. Burkhead, K. L. Hale, N. Terry, M. Pilon, and E. A. H. Pilon-Smits
Analysis of Transgenic Indian Mustard Plants for Phytoremediation of Metal-Contaminated Mine Tailings
J. Environ. Qual.,
March 1, 2003;
32(2):
432 - 440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Grusak
Enhancing Mineral Content in Plant Food Products
J. Am. Coll. Nutr.,
June 1, 2002;
21(90003):
178S - 183.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|