|
Plant Physiol. (1998) 118: 373-385
Developmental Regulation of Intercellular Protein Trafficking
through Plasmodesmata in Tobacco Leaf Epidermis1
Asuka Itaya,
Young-Min Woo,
Chikara Masuta,
Yiming Bao,
Richard S. Nelson, and
Biao Ding*
Department of Botany, Oklahoma State University, Stillwater,
Oklahoma 74078 (A.I., Y.-M.W., B.D.); Plant Virology Laboratory,
Faculty of Agriculture, Hokkaido University, Sapporo 060, Japan (C.M.); and Plant Biology Division, The Samuel Roberts Noble Foundation,
Ardmore, Oklahoma 73402 (Y.B., R.S.N.)
 |
ABSTRACT |
Plasmodesmata mediate direct
cell-to-cell communication in plants. One of their significant features
is that primary plasmodesmata formed at the time of cytokinesis often
undergo structural modifications, by the de novo addition of
cytoplasmic strands across cell walls, to become complex secondary
plasmodesmata during plant development. Whether such modifications
allow plasmodesmata to gain special transport functions has been an
outstanding issue in plant biology. Here we present data showing that
the cucumber mosaic virus 3a movement protein (MP):green fluorescent
protein (GFP) fusion was not targeted to primary plasmodesmata in
the epidermis of young or mature leaves in transgenic tobacco
(Nicotiana tabacum) plants constitutively expressing the
3a:GFP fusion gene. Furthermore, the cucumber mosaic
virus 3a MP:GFP fusion protein produced in planta by biolistic
bombardment of the 3a:GFP fusion gene did not traffic
between cells interconnected by primary plasmodesmata in the epidermis
of a young leaf. In contrast, the 3a MP:GFP was targeted to complex
secondary plasmodesmata and trafficked from cell to cell when a leaf
reached a certain developmental stage. These data provide the first
experimental evidence, to our knowledge, that primary and complex
secondary plasmodesmata have different protein-trafficking functions
and suggest that complex secondary plasmodesmata may be formed to
traffic specific macromolecules that are important for certain stages
of leaf development.
 |
INTRODUCTION |
Plasmodesmata are intercellular connections that allow direct
cell-to-cell communication in plants. Traditionally, they were thought
to be able to permit only passive diffusion of small molecules, but recent studies have demonstrated that plasmodesmata can also mediate cell-to-cell trafficking of macromolecules such as proteins and
nucleic acids of viral origin (Fujiwara et al., 1993 ; Noueiry et al.,
1994 ; Ding et al., 1995 , 1997 ; Waigmann and Zambryski, 1995; Nguyen et
al., 1996 ; Canto et al., 1997 ; Itaya et al., 1997 ; Rojas et al., 1997 )
and of plant origin (Bostwick et al., 1992 ; Fisher et al., 1992 ;
Nakamura et al., 1993 ; Sakuth et al., 1993 ; Jackson et al., 1994 ;
Ishiwatari et al., 1995 ; Lucas et al., 1995 ; Schobert et al., 1995 ;
Perbal et al., 1996 ; Balachandran et al., 1997 ; Clark et al.,
1997 ; Kühn et al., 1997 ; Murillo et al., 1997 ). These findings
indicate that intercellular trafficking of macromolecules through
plasmodesmata is potentially an important means of coordinating
developmental and physiological processes at the transcellular level
(Lucas et al., 1993 ; Lucas, 1995 ; Mezitt and Lucas, 1996 ; Ding, 1997 ,
1998 ; Jackson and Hake, 1997 ; Ding et al., 1998).
A prominent feature of plasmodesmata is their structural modifications
associated with plant development. Previous work (Ding et al., 1992 ,
1993 ) showed that, at an early stage of tobacco (Nicotiana
tabacum) leaf development, mesophyll cells are connected solely by
simple primary plasmodesmata that are formed at the time of
cytokinesis. During leaf maturation, however, the majority of these
primary plasmodesmata undergo structural modification to become highly
branched by laterally fusing with neighboring primary plasmodesmata and
by the de novo addition of new cytoplasmic strands across the existing
cell walls. The resulting branched plasmodesmata are known as secondary
plasmodesmata (Jones, 1976 ; Ding et al., 1992 , 1993 ; Ding and Lucas,
1996 ) or, more specifically, complex secondary plasmodesmata (Ding,
1998 ). Modification of primary plasmodesmata to form complex secondary
plasmodesmata is likely a general phenomenon in plant development
(Jones, 1976 ; Ding et al., 1993 ; Volk et al., 1996 ) and may be of
functional significance.
Studies of the interactions between the 30-kD MP of TMV and
plasmodesmata suggest that primary and complex secondary plasmodesmata differ in some functional aspects. In TMV MP-transgenic tobacco plants,
MP is localized to complex secondary plasmodesmata in the mesophyll and
bundle sheath of mature leaves (Ding et al., 1992 ; Moore et al., 1992 )
but not to any primary plasmodesmata in young and mature leaves (Ding
et al., 1992 ). Furthermore, MP is able to modify the size-exclusion
limit of complex secondary plasmodesmata in the mesophyll and bundle
sheath from 1 kD to greater than 10 kD in mature leaves but not that of
primary plasmodesmata in young leaves (even though MP is produced in
such leaves) (Deom et al., 1990 ; Ding et al., 1992 ).
In contrast, Waigmann et al. (1994) showed that microinjected
recombinant TMV MP produced from engineered Escherichia coli is able to increase the size-exclusion limit of plasmodesmata in the
mesophyll of young leaves of nontransgenic tobacco plants, implying
that TMV MP might interact with primary plasmodesmata in young leaves.
Why the TMV MP has different effects on the plasmodesmata size-exclusion limit in young leaves of transgenic (Deom et al., 1990 ;
Ding et al., 1992 ) and nontransgenic tobacco plants (Waigmann et al.,
1994 ) is not well understood. Nevertheless, these observations raise a
number of important issues concerning the functions of different
plasmodesmata: Is localization to complex secondary but not primary
plasmodesmata a peculiar feature of TMV MP, or does it have
broader implications in protein-plasmodesmata interactions? And is such
preferential localization indicative of the different abilities of
these plasmodesmata to support intercellular trafficking of a
particular protein? Resolution of these issues is necessary to advance
our understanding of the functions of plasmodesmata in plant growth and
development. To resolve these issues, further studies are needed to
determine how other proteins interact with plasmodesmata. More
important, such studies must include testing directly the ability of
primary or complex secondary plasmodesmata to facilitate intercellular
trafficking of a specific protein, in addition to examining how the
protein is localized to plasmodesmata and how it affects the
size-exclusion limit of plasmodesmata.
Intercellular protein trafficking has been mainly studied by
microinjection techniques. In developing alternative methods, we
recently utilized biolistic bombardment (Sanford, 1988 ) to deliver a
DNA construct into epidermal cells of mature tobacco leaves to produce
a CMV 3a MP:GFP fusion directly in planta. The fusion protein produced
in this manner trafficked from cell to cell, as detected under a
fluorescence microscope (Itaya et al., 1997 ). CMV 3a MP:GFP fusion
produced during infection of an engineered CMV expressing the
3a:GFP gene also trafficked from cell to cell in tobacco
leaf epidermis (Canto et al., 1997 ). These data are consistent with
previous microinjection results showing cell-to-cell trafficking of a
recombinant CMV 3a MP in mature tobacco leaf mesophyll (Ding et al.,
1995 ).
We used an integrative approach that included structural analysis,
immunolabeling, and biolistic bombardment to study the functions of
primary and complex secondary plasmodesmata in trafficking CMV 3a
MP:GFP in tobacco leaf epidermis. In this report we show that
biolistically produced 3a MP:GFP fusion protein did not traffic between
epidermal cells interconnected by primary plasmodesmata in young
leaves. As these primary plasmodesmata became complex secondary
plasmodesmata during further leaf development, 3a MP:GFP began to
traffic between epidermal cells. Furthermore, in transgenic tobacco
plants constitutively producing 3a MP:GFP, this fusion protein was
localized to complex secondary but not to primary plasmodesmata as a
function of leaf development. The implications of these findings in
studying the functions of different plasmodesmata in plant growth
and development are discussed.
 |
MATERIALS AND METHODS |
Plant Material
Tobacco (Nicotiana tabacum L. cv Samsun NN) plants were
grown in a growth chamber under a day/night temperature regime of 24°C for 15 h/18°C for 9 h. During the day the light level was approximately 260 µmol m 2 s 1. Nine-
to ten-week-old plants were used for the experiments.
Gene Constructs for Tobacco Transformation
Construction of expression vectors pRTL2-MP3a:GFP and pRTL2-GFP
was described previously (Itaya et al., 1997 ). These vectors contain,
respectively, the CMV 3a:GFP fusion gene and the
GFP gene under the control of the CaMV 35S promoter. The
35S:3a:GFP fusion gene and the 35S:GFP gene
inserted in pRTL2-MP3a:GFP and pRTL2-GFP (Itaya et al., 1997 ) were
amplified by PCR using primer SacI-35S
(CGAGCTCGCATGCCTGCAGGTCA) and primer term-HindIII
(AAGCTTGCATGCCTGCAGGTCA). The PCR products were ligated into binary
vector pBIN19 using a DNA-ligation kit (Takara Shuzo, Ltd., Otsu,
Japan) following the manufacturer's instructions. Recombinant plasmids
were used to transform Escherichia coli (DH5 ) using the
protocol of Pope and Kent (1996) . Transformed E. coli were
grown on Luria-Bertani (Km 50 µg
mL 1) plates for selection. Purified plasmids
from isolated colonies were digested by SacI and
HindIII to check the size of inserts. The constructs were
also sequenced to confirm correct DNA sequences. Positive plasmids were
bombarded into tobacco leaves to check further the function of genes.
Plasmids containing the correct genes were then transferred via
electroporation into Agrobacterium tumefaciens strain LBA 4404, which carries the helper plasmid pAL4404. Competent A. tumefaciens cells were first prepared by growth at 29°C in YM
medium (0.04% [w/v] yeast extract, 1% [w/v] mannitol, 0.01%
[w/v] NaCl, 0.02% [w/v]
MgSO4·7H2O, 0.05%
[w/v]
K2HPO4·3H2O,
pH 7.0, and 500 µg mL 1 streptomycin) for
approximately 2 d until the A600
reached 0.7. The culture was chilled on ice for 15 min and then
centrifuged at 5000 rpm for 15 min at 4°C. The pellet was washed with
7 mL of sterile Hepes, pH 7.0 (0.2-µm filter sterilization), and
resuspended in 200 µL of sterile Hepes containing 10% (v/v)
glycerol. Cells were split into 45-µL aliquots, frozen in liquid
nitrogen, and stored at 20°C.
For electroporation, competent cells were thawed on ice and mixed with
approximately 0.3 µg of plasmid and then incubated on ice for 2 min.
The mixture was transferred to a prechilled electroporation cuvette
(0.2-cm gap) and electroporated at a field strength of 2.5 kV
cm 1 with a Gene Pulser (Bio-Rad). One
milliliter of prechilled YM broth was added to the cuvette immediately
after electroporation. The mixture was incubated with gentle shaking
for 1 h at 29°C. One hundred microliters of the culture was
spread onto selective YM plates (kanamycin 50 µg
mL 1 and streptomycin 500 µg
mL 1) and incubated at 29°C for 2 to 3 d.
Colony PCR was performed to check for the presence of the correct
insert in A. tumefaciens.
Tobacco Transformation
A standard leaf-disc transformation method (Horsch et al., 1985 )
was used to generate transformants of tobacco expressing 3a:GFP and GFP. Transformants initially growing
in the selection medium were further selected by fluorescence
microscopic examination for expression of 3a MP:GFP and GFP. Positive
transformants were then transferred to soil in pots and were allowed to
grow to maturity in a growth chamber.
Among the 16 primary transformants generated, three were found to show
3a MP:GFP production in all epidermal cells during initial screening by
fluorescence microscopy. These transgenic lines were designated
AI3a:GFP1, AI3a:GFP2, and AI3a:GFP3. These plants were self-fertilized
and seeds were collected. The seeds were planted in soil directly, and
progeny plants expressing the 3a:GFP or GFP gene
were selected by fluorescence microscopic examination. Immunoblot
analysis was performed to confirm the presence of 3a MP:GFP and GFP in
these plants, as described below.
Immunoblot Analysis of CMV 3a MP:GFP- and GFP-Transgenic
Tobacco Plants
Crude protein extracts were prepared from the transgenic and
nontransgenic control plants following the protocol of Vaquero et al.
(1994) . Fresh leaves (0.1 g) were ground in liquid nitrogen and
homogenized in 1 mL of grinding buffer (10 mM KCL, 5 mM MgCl2, 0.4 M Suc, 10%
[v/v] glycerol, and 10 mM 2-mercaptoethanol in Tris-HCl
buffer, pH 7.5). The mixture was centrifuged at 1000 rpm for 10 min at
4°C. The supernatant was collected and used for dot blotting.
For immunoblot analysis, 10 µL of the crude protein extract was
blotted onto nitrocellulose membranes. The membranes were incubated in
a blocking buffer consisting of 5% (w/v) nonfat dry milk in TBST (25 mM Tris-HCl, pH 7.4, 140 mM NaCl, 2.7 mM KCl, and 0.1% Tween 20) for 1 h and then incubated
with a rabbit-derived polyclonal antibody against GFP (Clontech, Palo
Alto, CA) overnight. After several buffer washes, the membranes were
treated for 1 h with a goat-derived anti-rabbit IgG antibody
conjugated to alkaline phosphatase. After the membranes were washed
again with buffer, color reaction was carried out using a detection kit
(Boehringer Mannheim) following the manufacturer's instructions.
CMV 3a MP:GFP and Callose Colocalization
Leaf blades from 3a MP:GFP-transgenic tobacco plants were
submerged in a fixative (3.7% paraformaldehyde, 0.2% picric acid, 50 mM potassium phosphate, and 5 mM EGTA, pH 6.8)
and cut into 2- × 3-mm segments. The leaf segments were then fixed in
the same fixative for 2 h at room temperature.
After buffer (50 mM potassium phosphate and 5 mM EGTA, pH 6.8) washes, the segments were gradually
infiltrated with a 2:1 mixture of 20% (w/v) Suc:Tissue Tek optimal
cutting temperature compound (Ted Pella, Inc., Redding, CA). The
infiltration was completed in three steps: 30% (v/v) of the mixture
for 30 min, 60% for 30 min, and 100% for 1 h.
Two to three infiltrated leaf segments were stacked in one drop of
absolute Tissue Tek on a piece of laboratory film (Parafilm, American
National Can, Greenwich, CT) at room temperature and were then frozen
in a CTD cryostat (International Equipment Co., Needham Heights,
MA). Ten-micrometer cryosections were obtained and attached to a
microscope slide coated with a mixture of 1% (w/v) gelatin and 0.1%
(w/v) chrome alum. The slides with tissue sections were incubated on a
warming plate at 40°C for at least 2 h before further
processing.
The slides were incubated in PBS buffer (140 mM NaCl, 2.7 mM KCl, 10 mM
Na2HPO4, and 1.8 mM KH2PO4, pH
7.4) containing 3% (w/v) BSA (fraction V, fatty acid free, Boehringer
Mannheim) and 1% (v/v) Nonidet P-40 (Sigma) for 30 min at room
temperature to wash away the optimal cutting temperature compound,
block nonspecific antibody binding, and extract autofluorescent
compounds from the sectioned tissues. Afterward, the sections were
incubated in a monoclonal antibody against callose (Biosupplies
Australia, Parkville, Australia) diluted 1:50 in PBS containing 1% BSA
and 0.05% (v/v) Triton X-100 for 1.5 to 2 h at 37°C. Following
PBS washes for 10 to 15 min, the sections were incubated in a
goat-derived and Texas Red-conjugated anti-mouse IgG (Jackson
ImmunoResearch Laboratories, West Grove, PA) at 1:50 dilution in PBS
containing 1% BSA and 0.05% Triton X-100 for 1 to 1.5 h at
37°C. The sections were washed with PBS, embedded in a mounting
medium, and covered with a coverslip. The slides were placed in the
dark for at least 1 h prior to microscopic examination.
The labeled sections were examined with either an epifluorescence
microscope (Optiphot-2, Nikon) or a confocal microscope (model
MRC-1024, Bio-Rad). Two sets of filter combinations were used with the
epifluorescence microscope. GFP was detected with a filter set
consisting of a blue excitation filter (420-490 nm), a dichroic mirror
(510 nm), and a green barrier filter (520-560 nm). Texas Red
fluorescence was detected with a filter set consisting of a green
excitation filter (546/10 nm), a 580-nm dichroic mirror, and an
orange-red barrier filter (590 nm). Fluorescent images were acquired
with a CCD (charge-coupled device) camera (model C2400, Hamamatsu
Photonic Systems, Bridgewater, NJ) and processed using an
image-processing system (Argus 20, Hamamatsu).
Other sections were examined using a confocal microscope at the imaging
center at the Department of Genetics and Cell Biology, University of
Minnesota, St. Paul. The confocal microscope was attached to an
inverted microscope (Diaphot, Nikon) equipped with a 15-mW
krypton/argon laser. For 3a MP:GFP and Texas Red visualization, the
488-/568-nm excitation lines were used with a 585-nm double-dichroic mirror and a 585-nm ELP20 barrier filter. Digital images were collected
on a personal computer (model 300 ProSignia, Compaq Computer
Corporation, Houston, TX) using LaserSharp software (version 2.1, Bio-Rad). Images were further analyzed using imaging software (version
1.62 NIH Image, National Institutes of Health, Bethesda, MD).
Tissue Processing for Electron Microscopy
For structural analysis of plasmodesmata during leaf development,
tobacco leaves were initially fixed in 4% (v/v) glutaraldehyde/0.1% (v/v) tannic acid and then fixed in 2% (w/v) osmium tetroxide, as
described by Ding et al. (1992) . The fixed samples were then embedded
in Spurr's medium (Spurr, 1996). Thin sections of 60 to 70 nm were
stained with 2% (w/v) uranyl acetate in 70% (v/v) methanol and then
lead citrate for transmission electron microscopic examination (Ding et
al., 1992 ).
For immunolabeling, leaf tissues from 3a MP:GFP-transgenic and
nontransgenic control tobacco plants were fixed in 2% (w/v) paraformaldehyde/0.5% (v/v) glutaraldehyde and embedded in London White resin for obtaining thin sections (Ding et al., 1992 ).
Immunolabeling of CMV 3a MP:GFP
Immunolabeling of 3a MP:GFP was performed as described previously
(Ding et al., 1992 ). Thin sections of tobacco leaf samples from 3a
MP:GFP-transgenic tobacco plants and from nontransgenic control tobacco
plants were first incubated for 1 h in TBST buffer, which
consisted of 50 mM Tris-HCl, pH 7.4, 150 mM
NaCl, 2% (w/v) BSA, and 0.1% (v/v) Tween 20 (Sigma). Afterward, the
sections were incubated for 1 h in a rabbit-derived polyclonal
antibody (IgG) against CMV 3a MP (C. Masuta, unpublished data) at 1:200 dilutions. Following TBST buffer washes, the sections were incubated for 1 h in a goat-derived and 10-nm gold-conjugated anti-rabbit IgG antibody (Sigma). After buffer and distilled-water washes, the
sections were stained with 2% (w/v) uranyl acetate in methanol followed by lead citrate. All sections were then examined with an
electron microscope (model JEM-100CX II, JEOL) operated at 80 kV.
Biolistic Bombardment and Fluorescence Microscopy
Biolistic bombardment and fluorescence microscopy were essentially
as described previously (Itaya et al., 1997 ). A segment of detached
tobacco leaf from the tip or the base was immediately placed in a Petri
dish containing wet filter paper. The fresh cut end of the leaf segment
was covered with a wet cotton ball. The gene constructs were delivered
into the lower epidermis of the leaf segment using a biolistic PDS
1000/He system (Bio-Rad) at a pressure of 1300 p.s.i. After
bombardment, the leaf samples were kept in Petri dishes at 24°C as
described above. Images of GFP were detected and processed as described
previously (Itaya et al., 1997 ).
 |
RESULTS |
Development of Complex Secondary Plasmodesmata between Epidermal
Cells
We focused our investigation on plasmodesmatal functions in
tobacco leaf epidermis because this tissue is well suited for biolistic
bombardment and fluorescence microscopic observation with little tissue
manipulation (Itaya et al., 1997 ). The central issue under
investigation was whether primary and complex secondary plasmodesmata
function differently in interacting with and supporting intercellular
trafficking of 3a MP:GFP. Therefore, it was necessary to obtain
detailed information about plasmodesmal structure in the leaf epidermis
at various developmental stages. Figure 1
gives a schematic view of an approximately 9-week-old tobacco plant with the leaves studied in detail highlighted. Preliminary studies showed that CMV 3a MP:GFP produced in the epidermal cells of a 4-cm or
younger leaf did not traffic from cell to cell, in contrast to older
leaves. Thus, we arbitrarily defined this young leaf as the first leaf
for convenience of description. The second and third leaves were the
next successively older leaves. The trafficking patterns of 3a MP:GFP
in the epidermis of leaves at successive developmental stages are
presented in a later section.

View larger version (29K):
[in this window]
[in a new window]
| Figure 1.
Schematic view of a 10-week-old tobacco plant
showing the leaves used in the present study. For the first, second,
and third leaves, both the tip and the base regions (defined by the
dashed lines) were investigated in terms of the structure and
development of plasmodesmata and the interactions between CMV 3a MP:GFP
and plasmodesmata.
|
|
Because maturation of a tobacco leaf progresses from the tip to the
base regions (Turgeon, 1989 ), the tip region in a leaf at an early
stage of development will be more developed than the base region.
Previous work with mesophyll tissue of tobacco showed that modification
of primary plasmodesmata into complex secondary plasmodesmata also
progresses from tip to base in a developing leaf (Ding et al., 1992 ).
Therefore, we studied the structure of epidermal plasmodesmata in both
the tip and the base regions of each experimental leaf. As shown in
Figures 2A and
3, all plasmodesmata connecting epidermal
cells in the base of the first leaf were simple primary plasmodesmata.
In the tip of this leaf, although approximately 86% of the
plasmodesmata were still primary, 14% had become branched (Figs. 2, B
and C, and 3). These branched plasmodesmata were either H or Y shaped
(Fig. 2C) and had no central cavity. The H-shaped plasmodesmata were
apparently derived from the fusion of two neighboring primary
plasmodesmata and were previously called "modified primary
plasmodesmata" (Ding et al., 1993 ). The Y-shaped plasmodesmata most
likely came from the de novo addition of a new cytoplasmic strand to a
primary plasmodesmata across the existing cell walls.

View larger version (155K):
[in this window]
[in a new window]
| Figure 2.
Structure and development of plasmodesmata between
epidermal cells during tobacco leaf maturation. A, Primary
plasmodesmata (arrows) in the base of the first leaf (see Fig. 1 for
numbering of leaves). B, Primary plasmodesmata in the tip of the first
leaf. C, H- and Y-shaped branched plasmodesmata in the tip of the first
leaf. D, Primary plasmodesmata in the base of the second leaf. E,
Primary (arrows) and branched (arrowhead) plasmodesmata in the base of
the second leaf. F, Primary (arrow) and branched (arrowhead)
plasmodesmata in the tip of the second leaf. G, Branched plasmodesmata
in the tip of the second leaf. H, Branched plasmodesmata in the base of
the third leaf. I, Branched plasmodesmata in the tip of the third leaf.
Note the presence of a central cavity in the plasmodesmata (arrow). J,
Truncated plasmodesmata between an epidermal cell (EC) and a mature
guard cell (GC). Scale bars = 0.5 µm.
|
|

View larger version (38K):
[in this window]
[in a new window]
| Figure 3.
Distribution of primary versus branched
plasmodesmata (PD) between epidermal cells during tobacco leaf
development. Total numbers of plasmodesmata examined for the different
leaf regions were 315 for the base of first leaf, 474 for the tip of
first leaf, 547 for the base of second leaf, 559 for the tip of second
leaf, 380 for the base of third leaf, and 480 for the tip of third
leaf. The plasmodesmata were counted from 200 to 300 cellular
interfaces derived from two different tobacco plants.
|
|
In the base of the second leaf, approximately 84% of the plasmodesmata
were primary and 16% were either H or Y shaped (Figs. 2, D and E, and
3). This pattern was similar to that found in the tip of the first
leaf. In the tip of the second leaf, primary plasmodesmata were only
about 13% of the total, and 87% of the plasmodesmata had become
branched. In contrast to the H- or Y-shaped branched plasmodesmata
found in the tip of the first leaf and at the base of the second leaf,
a prominent feature of the branched plasmodesmata in the tip of the
second leaf was that multiple branches (more than three in many cases)
were confluent at a central cavity in the middle lamellar region of the
cell walls (Fig. 2, F and G). This structural feature and distribution
pattern of the branched plasmodesmata were maintained throughout leaf
development. As shown in Figures 2, H and I, and 3, structures and
percentages of branched plasmodesmata in the base and tip of the third
leaf were very similar to those found at the tip of the second leaf. Thus, modification of primary plasmodesmata into highly branched plasmodesmata occurred most dramatically and appeared to reach a
maximal level in the tip of the second leaf.
Based on the data presented above, the highly branched plasmodesmata
between tobacco epidermal cells were apparently formed utilizing
similar mechanisms, as found for the formation of complex secondary
plasmodesmata between mesophyll cells (Ding et al., 1992 , 1993 ).
Following the terminology used for tobacco mesophyll (Ding et al.,
1992 , 1993 ; Ding and Lucas, 1996 ; Ding, 1998 ), we will refer to the
highly branched plasmodesmata found in the tip of the second leaf and
older leaves as "complex secondary plasmodesmata." The conditions
and limitations of the usage of this term have been discussed
previously (Ding et al., 1992 ; Ding, 1998 ). The full development of
complex secondary plasmodesmata from the tip of the second leaf onward
was directly correlated with the ability of these leaf tissues to allow
plasmodesmal localization and cell-to-cell trafficking of 3a MP:GFP, as
discussed below.
Truncated plasmodesmata were observed on an epidermal cell side that
abutted a mature guard cell (Fig. 2J). Whether these plasmodesmata had
been formed previously or they were formed after the plasmodesmata on
the guard cell side were completely sealed during leaf maturation was
not investigated. Nevertheless, our observation that truncated
plasmodesmata exist between epidermal and mature guard cells is
consistent with earlier findings by Willmer and Sexton (1979) and
Willie and Lucas (1984) in tobacco and several other species. 3a MP:GFP
was found to be targeted to these plasmodesmata in a transgenic tobacco
plant (see below).
CMV 3a MP:GFP Fusion Protein Was Localized to Complex Secondary
Plasmodesmata, and Not Primary Plasmodesmata, during Leaf Development
in Transgenic Tobacco
To determine how 3a MP:GFP would interact with plasmodesmata
during leaf development, we generated transgenic tobacco plants expressing the CMV 3a:GFP fusion gene under the control of
the constitutive CaMV 35S promoter (see ``Materials and Methods'' for
details). Transgenic line AI3a:GFP1 showed a higher level of 3a MP:GFP
fluorescence than other lines and was therefore chosen for detailed
study. The presence of the fusion protein in leaves of different
developmental stages was also confirmed by immunoblot analysis, as
shown in Figure 4.

View larger version (20K):
[in this window]
[in a new window]
| Figure 4.
Immunoblot analysis showing the presence of 3a
MP:GFP and GFP in transgenic tobacco plants expressing these proteins.
The control is a nontransgenic tobacco plant. The fusion protein was
detected with a rabbit-derived polyclonal antibody against GFP and then
with a goat-derived anti-rabbit IgG antibody conjugated to alkaline
phosphatase.
|
|
Detailed analysis of AI3a:GFP1 plants revealed the appearance of
distinct green fluorescent dots in the cell walls of epidermis and
mesophyll as a function of leaf development. In the base of the second
leaf (Fig. 5A) and the entire first leaf
(data not shown), there were no green fluorescent dots in the cell
walls of epidermal cells overlaying the mesophyll. In the tip of the second leaf, green fluorescent dots started to appear in the walls of
epidermal cells (Fig. 5B). In the third (Fig. 5C) and older leaves,
green fluorescent dots were detected in the epidermal cell walls from
the tip to the base region of every leaf. Some fluorescent dots also
appeared to be present in the cell walls adjoining epidermal and guard
cells (Fig. 5C, arrowhead). Transgenic tobacco plants producing GFP
alone did not exhibit any fluorescent dots in the cell walls of any
leaves (Fig. 5D). GFP accumulated in the nucleus and cytoplasm of every
cell.

View larger version (108K):
[in this window]
[in a new window]
| Figure 5.
Localization of CMV 3a MP:GFP to plasmodesmata
during leaf development in a transgenic tobacco plant (AI3a:GFP1). A,
Base of second leaf. Green fluorescence is visible in the cytoplasm of
all epidermal and guard cells. There are no fluorescent dots in the
cell walls. The first leaf showed the same image. B, Tip of the same
second leaf as in A. Green fluorescent dots (arrows) are present in the
cell walls between epidermal cells. C, Tip of third leaf. Green
fluorescent dots (arrows) are prominent between all epidermal cells. In
addition, such dots are also visible in the part of epidermal cell wall
abutting a mature guard cell (arrowhead). D, Tip of third leaf from a
transgenic tobacco plant expressing the GFP gene only.
GFP fluorescence is prominent in all epidermal and guard cells and
accumulates in the nucleus of every cell. Note the absence of green
fluorescent dots in the walls between the cells. E, Confocal image of
3a MP:GFP fluorescent dots in walls between mesophyll cells in the tip
of a third leaf. This image was obtained from a cryosection of leaf
tissue. F, Confocal image of callose in the same cryosection, detected
with a monoclonal anti-callose antibody and a Texas Red-conjugated
secondary antibody. G, Superimposed confocal images of E and F
demonstrating colocalization of 3a MP:GFP and callose. Scale bars = 40 µm.
|
|
We performed immunolabeling studies with transgenic tobacco plants to
determine whether the green fluorescent dots of 3a MP:GFP in the cell
walls represented localization of the fusion protein in plasmodesmata.
Since callose is typically deposited in the cell wall area immediately
surrounding the orifice of a plasmodesmata, especially when a tissue is
wounded or during aldehyde fixation (Hughes and Gunning, 1980 ;
Northcote et al., 1989 ; Vaughn et al., 1996 ), a colocalization of
callose and green fluorescent dots would indicate that the latter
represent 3a MP:GFP in plasmodesmata. This strategy has been used to
localize TMV MP:GFP to plasmodesmata in tobacco infected with an
engineered TMV (Oparka et al., 1997 ) and 3a MP:GFP to plasmodesmata in
tobacco infected with potato virus X expressing a 3a:GFP
fusion gene (Blackman et al., 1998 ).
Using a monoclonal antibody against callose (1,3- -glucan) and a
Texas Red-conjugated secondary antibody to label cryosections, we
localized callose to the cell walls as punctate dots in the epidermis
and mesophyll of the 3a MP:GFP-transgenic tobacco plants. Confocal
microscopic examination of the distribution patterns of 3a MP:GFP
fluorescent dots and callose staining on any given section indicated
that 3a MP:GFP and callose were colocalized in most cases (Fig. 5,
E-G).
Our data therefore demonstrated that the green fluorescent dots in the
cell walls were 3a MP:GFP localized to plasmodesmata. Furthermore, 3a
MP:GFP localization to plasmodesmata was a function of leaf development
in transgenic tobacco plants. Specifically, this pattern suggests that
3a MP:GFP might be localized to complex secondary plasmodesmata, as TMV
MP does in the mesophyll of transgenic tobacco plants (Ding et al.,
1992 ). To test this possibility, we performed further immunolabeling
experiments at the electron microscope level using a rabbit-derived
polyclonal antibody (IgG) against CMV 3a MP and a goat-derived, 10-nm
gold-conjugated secondary antibody against rabbit IgG. By this method,
we localized 3a MP:GFP to complex secondary plasmodesmata in the
mesophyll and epidermal cells of transgenic leaves (Fig.
6, A and B). In addition, 3a MP:GFP was
localized to the truncated plasmodesmata between guard cells and
epidermal cells (Fig. 6C). 3a MP:GFP was absent from primary
plasmodesmata in the third (Fig. 6D) and younger (data not shown)
leaves. Therefore, we concluded that the green fluorescent dots
observed at the fluorescence microscope level represented localization
of the 3a MP:GFP specifically to complex secondary plasmodesmata.

View larger version (99K):
[in this window]
[in a new window]
| Figure 6.
Immunolabeling of CMV 3a MP:GFP fusion protein to
complex secondary plasmodesmata in transgenic tobacco plants. The
fusion protein was detected with a polyclonal anti-CMV 3a MP antibody
and a 10-nm gold-conjugated secondary antibody. A, Complex secondary
plasmodesmal between two mesophyll cells showing gold labeling. B,
Complex secondary plasmodesmal between two epidermal cells showing gold
labeling. C, Truncated plasmodesmal between an epidermal cell (EC) and
a guard cell (GC) showing gold labeling. D, Primary plasmodesmata from
a third leaf showing no gold labeling. CW, Cell wall. Scale bars = 0.25 µm.
|
|
Cell-to-Cell Trafficking of CMV 3a MP:GFP Fusion Protein in Tobacco
Leaf Epidermis Was Correlated with the Development of Complex Secondary
Plasmodesmata during Leaf Maturation
Having established that 3a MP:GFP was localized to complex
secondary plasmodesmata as a function of leaf development in transgenic tobacco plants, we then asked whether this localization pattern was
indicative of the capabilities of primary and/or complex secondary plasmodesmata to facilitate 3a MP:GFP cell-to-cell trafficking in
tobacco leaves. To answer this question, we used a biolistic bombardment method to deliver plasmid pRTL2-3a:GFP, which carries the
3a:GFP fusion gene under the control of the CaMV 35S
promoter (Itaya et al., 1997 ) into the epidermis of nontransgenic
tobacco leaves at successive developmental stages to produce 3a MP:GFP fusion protein and then monitored its trafficking or nontrafficking function.
When the plasmid was bombarded into either the base or the tip of the
first leaf, the 3a MP:GFP fusion protein was produced in epidermal
cells. The green fluorescence was confined to the cytoplasm. There were
no fluorescent dots in the cell walls, indicating that the fusion
protein was not targeted to plasmodesmata. The fusion protein also did
not move into neighboring cells (Fig. 7A;
Table I).

View larger version (133K):
[in this window]
[in a new window]
| Figure 7.
Cell-to-cell trafficking of CMV 3a MP:GFP in
tobacco leaf epidermis as a function of leaf development. The fusion
protein was produced upon biolistic bombardment of the
3a:GFP fusion gene. A, 3a MP:GFP produced in an
epidermal cell in the tip of the first leaf, which does not traffic
into neighboring cells. B, 3a MP:GFP produced in an epidermal cell in
the base of the second leaf, which also remains in a single cell. C, 3a
MP:GFP produced in an epidermal cell (asterisk) in the tip of the
second leaf, which trafficks into neighboring cells. Note the presence
of green fluorescent dots in the walls of the cell producing the
fusion protein and in neighboring cells (arrows). D, 3a MP:GFP produced
in the base of the third leaf, which trafficks from cell to cell. The
asterisk denotes the cell producing the protein. The arrow points to a
guard cell that produces 3a MP:GFP but does not permit cell-to-cell
trafficking of the fusion protein. E, High-magnification view of D
showing the presence of fluorescent dots in the cell walls. F, 3a
MP:GFP produced in an epidermal cell in the base of the third leaf. The
fusion protein was not targeted to complex secondary plasmodesmata, as
determined by the lack of green fluorescent dots in the cell walls. The
protein does not traffic into neighboring cells. Scale bars = 20 µm.
|
|
View this table:
[in this window]
[in a new window]
|
Table I.
Cell-to-cell trafficking of CMV 3a MP:GFP fusion
protein in the epidermis of tobacco
The proteins (fusion or nonfusion) were produced in planta after
plasmids containing the respective genes were delivered into the
tobacco epidermis by a particle gun. Three to four leaves from
different plants were used in each experiment, except for the first
leaf, for which 10 samples were used. The data are the number of cells
permitting cell-to-cell trafficking of a protein over the total cells
producing the protein.
|
|
In the base of the second leaf the 3a MP:GFP produced in a cell was not
targeted to plasmodesmata and did not traffic out of the cell (Fig. 7B;
Table I). In contrast, the fusion protein produced in the tip of the
same leaf was targeted to plasmodesmata, as manifested by the presence
of fluorescent dots in the cell walls, and trafficked from cell to cell
(Fig. 7C; Table I). In the third leaf, 3a MP:GFP was targeted to
plasmodesmata and was able to traffic from cell to cell in both the
base (Fig. 7, D and E) and the tip regions (Table I).
The cell-to-cell trafficking pattern of 3a MP:GFP in nontransgenic
tobacco plants was positively correlated with the localization pattern
of 3a MP:GFP in transgenic plants. This fusion protein was not
localized to and did not traffic through primary plasmodesmata in young
leaves. At a leaf developmental stage at which complex secondary
plasmodesmata became predominant (the tip of the second leaf in the
present study), the fusion protein was localized to complex secondary
plasmodesmata and trafficked from cell to cell. Therefore, the
formation of complex secondary plasmodesmata appears to be necessary
for 3a MP:GFP cell-to-cell trafficking.
In control experiments GFP alone or GFP fused to mutant M5 of 3a MP,
which was shown previously to be incapable of trafficking from cell to
cell (Itaya et al., 1997 ), did not traffic from cell to cell in either
first or third leaves (Table I). These results confirmed that
cell-to-cell trafficking of 3a MP:GFP during tobacco leaf development
was a specific function mediated by 3a MP.
Targeting to Complex Secondary Plasmodesmata Was Required for CMV
3a MP:GFP Trafficking
When 3a MP:GFP trafficked from cell to cell in the tip of the
second leaf and the entire third leaf, green fluorescent dots were
observed in the walls of cells producing this fusion protein and the
surrounding cells an indication that the fusion protein was targeted
to complex secondary plasmodesmata. The fusion protein never trafficked
out of a cell that did not exhibit green fluorescent dots in the cell
walls of these leaves (Fig. 7F). Because our extensive electron
microscopic studies revealed that complex secondary plasmodesmata
predominantly connected all epidermal cells in these leaves, the lack
of fluorescent dots in a cell such as that shown in Figure 7F indicates
that factors yet to be identified contributed to the lack of targeting
of 3a MP:GFP to complex secondary plasmodesmata. Therefore, targeting
to complex secondary plasmodesmata is apparently required for 3a MP:GFP
intercellular trafficking.
 |
DISCUSSION |
We have demonstrated that the ability of CMV 3a MP:GFP to interact
with plasmodesmata and to traffic between tobacco leaf epidermal cells
is a function of leaf development. Specifically, our data indicated
that 3a MP:GFP does not interact with and traffic cell to cell through
primary plasmodesmata in young tobacco leaves, and yet the same fusion
protein is able to interact with and traffic through complex secondary
plasmodesmata formed during further leaf development. Primary and
complex secondary plasmodesmata therefore have different
protein-trafficking functions. It is unlikely that such differences are
significant for only the intercellular trafficking of a viral protein.
We suggest that primary and complex secondary plasmodesmata can
differentially traffic endogenous macromolecules that are critical for
specific stages of plant development. This is consistent with the view
that complex secondary plasmodesmata are probably important for later
stages of leaf development, based on the observation that arrested
formation of complex secondary plasmodesmata in the mesophyll of a
transgenic tobacco plant expressing an acid invertase is correlated
with accelerated leaf senescence (Ding et al., 1993 ). Because
modification of primary plasmodesmata into complex secondary
plasmodesmata appears to be a general phenomenon associated with plant
development (Jones, 1976 ; Ding et al., 1992 , 1993 ; Ding and
Lucas, 1996 ; Volk et al., 1996 ), elucidating the specific functions of
such modifications should enhance our understanding of cell-to-cell
communication in plant development.
Vaquero et al. (1996) previously showed immunolocalization of CMV 3a MP
in the cell walls, and presumably to plasmodesmata, in CMV-infected as
well as in CMV 3a MP-transgenic tobacco plants. Blackman et al. (1998)
showed clear and conclusive evidence for plasmodesmatal localization of
3a MP during CMV infection and of 3a MP:GFP expressed from a potato
virus X vector. Those studies, however, did not distinguish between
primary and complex secondary plasmodesmata and did not examine the
localization pattern of 3a MP or 3a MP:GFP as a function of leaf
development. Our data extended those observations by showing that 3a
MP:GFP is localized exclusively to complex secondary plasmodesmata, not
to primary plasmodesmata of young or mature leaves of transgenic
tobacco plants. This pattern of localization is similar to that of TMV MP in transgenic tobacco (Ding et al., 1992 ). Thus, preferential interaction with complex secondary plasmodesmata is not a peculiar feature of a particular protein (TMV MP or CMV 3a MP); rather, it is
likely a function shared by many proteins. These pooled data further
support the view that primary and complex secondary plasmodesmata have
unique trafficking functions that are of broad biological significance.
The molecular basis underlying the different abilities of primary and
complex secondary plasmodesmata to allow 3a MP:GFP to traffic from cell
to cell remains to be elucidated. There are a number of possibilities.
First, during leaf development, modification of primary plasmodesmata
into complex secondary plasmodesmata is accompanied by changes in the
biochemical composition of these plasmodesmata, so complex
secondary plasmodesmata may possess the factor (receptor?) that is
necessary for 3a MP:GFP trafficking. Second, a cytosolic factor that
recognizes and shuttles 3a MP:GFP to plasmodesmata is expressed only at
certain stages of leaf development. It may be this factor, and not
plasmodesmata structure or biochemical components, that dictates
developmental regulation of 3a MP:GFP trafficking. Third, specific
interactions among 3a MP:GFP, a cytosolic factor, and a plasmodesmal
component are necessary for trafficking, and both the necessary
cytosolic factor and the plasmodesmal component are expressed only at a
certain leaf developmental stage. Irrespective of the specific
mechanisms involved, our data suggest that tobacco leaf development may
provide a useful system for biochemical and molecular characterization
of cellular factors that participate in intercellular protein
trafficking through plasmodesmata.
In search of cellular factors essential for plasmodesma-mediated
protein trafficking, it should be noted that a putative protein kinase
that can phosphorylate the TMV 30-kD MP has been detected in the cell
walls of tobacco leaf mesophyll. In particular, the activity of this
kinase is also a function of tobacco leaf development, being absent
from young leaves and present in more mature leaves (Citovsky et al.,
1993 ). Thus, there is a possibility that this kinase is a component of
complex secondary plasmodesmata in tobacco leaves (Citovsky et al.,
1993 ). Citovsky et al. (1993) speculated that phosphorylation of TMV MP
may lead to its inactivation and then accumulation in complex secondary
plasmodesmata in transgenic tobacco plants, thereby sequestering this
protein to this location (possibly as a plant defense mechanism).
The data in the present study suggest the possibility that, contrary to
the speculation of Citovsky et al. (1993) , the phosphorylation of an MP
such as CMV 3a MP, and perhaps even TMV MP, is required for
intercellular trafficking. Accumulation of 3a MP:GFP and TMV MP (Ding
et al., 1992 ) in complex secondary plasmodesmata might therefore be due
to a different type of protein modification. Alternatively,
phosphorylation of an MP may lead to its accumulation in a complex
secondary plasmodesmata, as suggested by Citovsky et al. (1993) , and a
different mechanism is responsible for the trafficking of MP through
the plasmodesmata. Further experimental studies in this direction
should provide important insights into the mechanisms that regulate
intercellular protein trafficking through plasmodesmata.
Targeting of 3a MP:GFP to truncated plasmodesmata between the epidermal
and mature guard cells was unexpected, because these plasmodesmata
apparently do not have intercellular transport functions (Erwee et al.,
1985 ; Palevitz and Hepler, 1985 ; Ding et al., 1997 ). Nevertheless, this
finding implies that protein targeting to plasmodesmata is an
autonomous function of a cell and is not necessarily coupled to protein
translocation through plasmodesmata or protein release from
plasmodesmata for import into a neighboring cell. Thus, targeting to
and release from plasmodesmata may be separate steps in intercellular protein trafficking that require specific interactions between the
trafficking protein and dedicated cellular factors (Carrington et al.,
1996 ; Ding, 1998 ).
Although our investigation was not specifically aimed at providing a
mechanistic explanation of how CMV moves from cell to cell, the finding
that 3a MP:GFP does not traffic from cell to cell in a young leaf
raises the question of how a virus such as CMV, which can infect young
leaves (Cooper and Dodds, 1995 ; Ding et al., 1995 ), moves
intercellularly. Based on the observation that CMV virions are absent
from plasmodesmata in infected tobacco cells and that 3a MP can traffic
CMV RNA from cell to cell, Ding et al. (1995) suggested that CMV moves
from cell to cell as a ribonucleoprotein complex. CMV replicase (Gal-On
et al., 1994 ) and coat protein (Suzuki et al., 1991 ; Boccard and
Baulcombe, 1993 ; Canto et al., 1997 ) also appear to be required for CMV
cell-to-cell movement. Blackman et al. (1998) recently proposed that a
CMV ribonucleoprotein complex that moves from cell to cell consists of
CMV RNA, 3a MP, and coat protein. Thus, it is possible that CMV 3a MP
will traffic from cell to cell through primary plasmodesmata in young
leaves in the presence of other viral factors under infection conditions and that such trafficking is necessary for viral genome trafficking. Alternatively, cell-to-cell trafficking of 3a MP can
enhance viral genome trafficking but is not absolutely required. These
possibilities need to be tested in future studies.
Canto et al. (1997) observed cell-to-cell spreading of biolistically
produced GFP in both N. tabacum and Nicotiana
benthamiana leaf epidermis. We have been unable to confirm that
finding with our extensive experiments with tobacco. In the study of
Canto et al. (1997) , the spreading of free GFP from cell to cell was observed 5 d after bombardment. In our experiments we could detect GFP fluorescence approximately 9 to 10 h after plasmid
bombardment. GFP fluorescence remained in single cells for 3 to 7 d, depending on the cells, and then disappeared completely. Our
preliminary studies in Arabidopsis and cucumber indicate that
biolistically produced GFP can indeed spread from cell to cell in some
tissues (A. Itaya, Y.-M. Woo, and B. Ding, unpublished results);
therefore, cell-to-cell spreading of free GFP may be associated with a
particular plant species, tissue, growth condition, or development
stage.
Our transgenic tobacco plants expressing 3a MP:GFP may have other
applications. For instance, such plants may be used to map development
of complex secondary plasmodesmata at the light microscope level by
detecting the presence of 3a MP:GFP fluorescence dots in the cell
walls. This should make it possible to examine the effects of various
environmental and physiological factors on complex secondary
plasmodesma formation in tobacco leaves. Since these plants now contain
an endogenous and visible marker for complex secondary plasmodesmata,
they may also be used to test whether a putative plasmodesmal
protein is localized to plasmodesmata in immunolabeling studies at the
light microscope level. This might be especially useful when the
immunolabeling intensity is limited at the electron microscope level.
 |
FOOTNOTES |
1
This study was supported by a grant from The
Samuel Roberts Noble Foundation (to B.D. and R.S.N.), by a grant from
the U.S. Department of Agriculture National Research Initiative
Competitive Grants Program (no. 97-35303-4519 to B.D.), and by a
Dean's Incentive Grant from the College of Arts and Sciences, Oklahoma
State University (to B.D.).
*
Corresponding author; e-mail bxding{at}osuunx.ucc.okstate.edu;fax
1-405-744-7074.
Received May 8, 1998;
accepted July 1, 1998.
 |
ABBREVIATIONS |
Abbreviations:
CaMV, cauliflower mosaic virus.
CMV, cucumber
mosaic virus.
GFP, green fluorescent protein.
MP, movement protein.
TMV, tobacco mosaic virus.
 |
ACKNOWLEDGMENTS |
We thank Peter Palukaitis for providing plasmids pET-MP3a and
pET-MPm5 and James Carrington for plasmid pRTL2. We thank John Cushman,
Yinghua Huang, Yi Li, and Zhenbiao Yang for technical advice concerning
the generation of transgenic plants. David Meinke is acknowledged with
special thanks for making his equipment available to us. We thank John
Cushman, SueAnn Hudiberg, and Janet Rogers at the Oklahoma State
University Recombinant DNA/Protein Resources Facility for the synthesis
and purification of oligonucleotides, DNA sequencing, and use of
equipment. We are grateful to Christine Fry of Nikon Corporation for
loaning us oil lenses and a mercury lamphouse, and to Phoebe Doss at
the Oklahoma State University Electron Microscopy Laboratory for the
use of the electron microscope and for technical assistance. Finally,
we thank Mark Sanders of the Imaging Center, Department of Genetics and
Cell Biology, University of Minnesota at St. Paul for the use of
the confocal microscope.
 |
LITERATURE CITED |
Balachandran S,
Xiang Y,
Schobert C,
Thompson GA,
Lucas WJ
(1997)
Phloem sap proteins from Cucurbita maxima and Ricinus communis have the capacity to traffic cell to cell through plasmodesmata.
Proc Natl Acad Sci USA
94:
14150-14155
[Abstract/Free Full Text]
Blackman LM,
Boevink P,
Santa Cruz S,
Palukaitis P,
Oparka KJ
(1998)
The movement protein of cucumber mosaic virus traffics into sieve elements in minor veins of Nicotiana clevelandii.
Plant Cell
10:
525-537
[Abstract/Free Full Text]
Boccard F,
Baulcombe D
(1993)
Mutational analysis of cis-acting sequences and gene function in RNA3 of cucumber mosaic virus.
Virology
193:
563-578
[CrossRef][Medline]
Bostwick DE,
Dannenhoffer JM,
Skaggs MI,
Lister RM,
Larkins BA,
Thompson GA
(1992)
Pumpkin phloem lectin genes are specifically expressed in companion cells.
Plant Cell
4:
1539-1548
[Abstract/Free Full Text]
Canto T,
Prior DAM,
Hellward KH,
Oparka KJ,
Palukaitis P
(1997)
Characterization of cucumber mosaic virus. 4. Movement protein and coat proteins are both essential for cell-to-cell movement of cucumber mosaic virus.
Virology
237:
237-248
[CrossRef][Medline]
Carrington JC,
Kasschau KD,
Mahajan SK,
Schaad MC
(1996)
Cell-to-cell and long-distance transport of viruses in plants.
Plant Cell
8:
1669-1681
[CrossRef][Web of Science][Medline]
Citovsky V,
McLean BG,
Zupan JR,
Zambryski P
(1993)
Phosphorylation of tobacco mosaic virus cell-to-cell movement protein by a developmentally regulated plant cell wall-associated protein kinase.
Genes Dev
7:
904-910
[Abstract/Free Full Text]
Clark AM,
Jacobsen KR,
Bostwick DE,
Dannenhoffer JM,
Skaggs MI,
Thompson GA
(1997)
Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.
Plant J
12:
49-61
[CrossRef][Web of Science][Medline]
Cooper B,
Dodds JA
(1995)
Differences in the subcellular localization of tobacco mosaic virus and cucumber mosaic virus movement proteins in infected and transgenic plants.
J Gen Virol
76:
3217-3221
[Abstract/Free Full Text]
Deom CM,
Schubert K,
Wolf S,
Holt C,
Lucas WJ,
Beachy RN
(1990)
Molecular characterization and biological function of the movement protein of tobacco mosaic virus in transgenic plants.
Proc Natl Acad Sci USA
87:
3284-3288
[Abstract/Free Full Text]
Ding B
(1997)
Cell-to-cell transport of macromolecules through plasmodesmata: a novel signalling pathway in plants.
Trends Cell Biol
7:
5-9
Ding B
(1998)
Intercellular protein trafficking through plasmodesmata.
Plant Mol Biol
38:
279-310
[CrossRef][Medline]
Ding B,
Haudenshield JS,
Hull RJ,
Wolf S,
Beachy RN,
Lucas WJ
(1992)
Secondary plasmodesmata are specific sites of localization of the tobacco mosaic virus movement protein in transgenic tobacco plants.
Plant Cell
4:
915-928
[Abstract/Free Full Text]
Ding B,
Haudenshield JS,
Willmitzer L,
Lucas WJ
(1993)
Correlation between arrested secondary plasmodesmal development and onset of accelerated leaf senescence in yeast acid invertase transgenic tobacco plants.
Plant J
4:
179-189
[CrossRef][Medline]
Ding B, Itaya A, Woo Y-M (1999) Plasmodesmata and cell-to-cell
communication in plants. Int Rev Cytol (in press)
Ding B,
Kwon M-O,
Hammond R,
Owens R
(1997)
Cell-to-cell movement of potato spindle tuber viroid.
Plant J
12:
931-936
[CrossRef][Medline]
Ding B,
Li Q-b,
Nguyen L,
Palukaitis P,
Lucas WJ
(1995)
Cucumber mosaic virus 3a protein potentiates cell-to-cell trafficking of CMV-vRNA in tobacco plants.
Virology
207:
345-353
[CrossRef][Web of Science][Medline]
Ding B, Lucas WJ (1996) Secondary plasmodesmata: biogenesis,
special functions, and evolution. In M Smallwood, P Knox, D
Bowles, eds, Membranes: Specialized Functions in Plants. BIOS
Scientific Publishers, Inc., Oxford, UK, pp 489-506
Erwee MG,
Goodwin PB,
Van Bel AJE
(1985)
Cell-cell communication in the leaves of Commelina cyanea and other plants.
Plant Cell Environ
8:
173-178
Fisher D,
Wu Y,
Ku MSB
(1992)
Turnover of soluble proteins in the wheat sieve tube.
Plant Physiol
100:
1433-1441
[Abstract/Free Full Text]
Fujiwara T,
Giesmann-Cookmeyer D,
Ding B,
Lommel SA,
Lucas WJ
(1993)
Cell-to-cell trafficking of macromolecules through plasmodesmata potentiated by the red clover necrotic mosaic virus movement protein.
Plant Cell
5:
1783-1794
[Abstract]
Gal-On A,
Kaplan I,
Roossinck MJ,
Palukaitis P
(1994)
The kinetics of infection of zucchini squash by cucumber mosaic virus indicates a function for RNA 1 in virus movement.
Virology
205:
280-289
[CrossRef][Medline]
Horsch RB,
Fry J,
Hoffmann NL,
Wallroth M,
Eichholtz D,
Rogers SG,
Fraley RT
(1985)
A simple and general method for transferring genes into plants.
Science
227:
1229-1231
[Abstract/Free Full Text]
Hughes JE,
Gunning BES
(1980)
Glutaraldehyde-induced deposition of callose.
Can J Bot
58:
250-258
Ishiwatari Y,
Honda C,
Kawashima I,
Nakamura S-i,
Hirano H,
Mori S,
Fujiwara T,
Hayashi H,
Chino M
(1995)
Thioredoxin h is one of the major proteins in rice phloem sap.
Planta
195:
456-463
[Web of Science][Medline]
Itaya A,
Hickman H,
Bao Y,
Nelson R,
Ding B
(1997)
Cell-to-cell trafficking of cucumber mosaic virus movement protein: green fluorescent protein fusion produced by biolistic gene bombardment in tobacco.
Plant J
12:
1223-1230
[CrossRef]
Jackson D,
Hake S
(1997)
Morphogenesis on the move: cell-to-cell trafficking of plant regulatory proteins.
Curr Opin Genet Dev
7:
495-500
[CrossRef][Web of Science][Medline]
Jackson D,
Veit B,
Hake S
(1994)
Expression of maize KNOTTED1 related homeobox genes in the shoot apical meristem predicts patterns of morphogenesis in the vegetative shoot.
Development
120:
405-413
[Abstract]
Jones MGK
(1976)
The origin and development of plasmodesmata.
In
BES Gunning,
RW Robards,
eds, Intercellular Communication in Plants: Studies on Plasmodesmata.
Springer-Verlag, Berlin, pp 81-105
Kühn C,
Franceschi VR,
Schulz A,
Lemoine R,
Frommer WB
(1997)
Macromolecular trafficking indicated by localization and turnover of sucrose transporters in enucleate sieve elements.
Science
275:
1298-1300
[Abstract/Free Full Text]
Lucas WJ
(1995)
Plasmodesmata: intercellular channels for macromolecular transport in plants.
Curr Opin Cell Biol
7:
673-680
[CrossRef][Web of Science][Medline]
Lucas WJ,
Bouche-Pillon S,
Jackson DP,
Nguyen L,
Baker L,
Ding B,
Hake S
(1995)
Selective trafficking of KNOTTED1 homeodomain protein and its mRNA through plasmodesmata.
Science
270:
1980-1983
[Abstract/Free Full Text]
Lucas WJ,
Ding B,
Van der Schoot C
(1993)
Plasmodesmata and the supracellular nature of plants.
New Phytol
125:
435-476
[CrossRef][Web of Science]
Mezitt LA,
Lucas WJ
(1996)
Plasmodesmal cell-to-cell transport of proteins and nucleic acids.
Plant Mol Biol
32:
251-273
[CrossRef][Web of Science][Medline]
Moore PJ,
Fenczik CA,
Deom CM,
Beach RN
(1992)
Developmental changes in plasmodesmata in transgenic tobacco expressing the movement protein of tobacco mosaic virus.
Protoplasma
170:
115-127
[CrossRef][Web of Science]
Murillo I,
Cavallarin L,
Segundo BS
(1997)
The maize pathogenesis-related PRms protein localizes to plasmodesmata in maize radicles.
Plant Cell
9:
145-156
[Abstract]
Nakamura S,
Hayashi H,
Mori S,
Chino M
(1993)
Protein phosphorylation in the sieve tubes of rice plants.
Plant Cell Physiol
34:
927-933
[Abstract/Free Full Text]
Nguyen L,
Lucas WJ,
Ding B,
Zaitlin M
(1996)
Viral RNA trafficking is inhibited in replicase-mediated resistant transgenic tobacco plants.
Proc Natl Acad Sci USA
93:
12643-12647
[Abstract/Free Full Text]
Northcote DH,
Davey R,
Lay J
(1989)
Use of antisera to localize callose, xylan and arabinogalactan in the cell plate, primary and secondary walls of plants cells.
Planta
178:
353-366
[CrossRef]
Noueiry AO,
Lucas WJ,
Gilbertson RL
(1994)
Two proteins of a plant DNA virus coordinate nuclear and plasmodesmal transport.
Cell
76:
925-932
[CrossRef][Web of Science][Medline]
Oparka KJ,
Prior DAM,
Santa Cruz S,
Padgett HS,
Beachy RN
(1997)
Gating of epidermal plasmodesmata is restricted to the leading edge of expanding infection sites of tobacco mosaic virus (TMV).
Plant J
12:
781-789
[CrossRef][Web of Science][Medline]
Palevitz BA,
Hepler PK
(1985)
Changes in dye coupling of stomatal cells of Allium and Commelina demonstrated by microinjection of Lucifer yellow.
Planta
164:
473-479
[CrossRef][Web of Science]
Perbal M-C,
Haughn G,
Saedler H,
Schwarz-Sommer Z
(1996)
Non-autonomous function of the Antirrhinum floral homeotic proteins DEFICIENS and GLOBOSA is exerted by their polar cell-to-cell trafficking.
Development
122:
3433-3441
[Abstract]
Pope B,
Kent HM
(1996)
High efficiency 5 min transformation of Escherichia coli.
Nucleic Acids Res
24:
536-537
[Free Full Text]
Rojas MR,
Zerbini FM,
Allison RF,
Gilbertson RL,
Lucas WJ
(1997)
Capsid protein and helper component-proteinase function as potyvirus cell-to-cell movement proteins.
Virology
237:
283-295
[CrossRef][Web of Science][Medline]
Sakuth T,
Schobert C,
Pecsvaradi A,
Eichholz A,
Komor E,
Orlich G
(1993)
Specific proteins in the sieve-tube exudate of Ricinus communis L. seedlings: separation, characterization and in vivo labelling.
Planta
191:
207-213
Sanford JC
(1988)
The biolistic process.
Trends Biotechnol
6:
299-302
Schobert C,
Grossmann P,
Gottschalk M,
Komor E,
Pecsvaradi A,
Nieden UZ
(1995)
Sieve-tube exudate from Ricinus communis L. seedlings contains ubiquitin and chaperones.
Planta
196:
205-210
[Web of Science]
Spurr AR
(1969)
A low viscosity epoxy resin embedding medium for electron microscopy.
J Ultrastruct Res
26:
31-43
[CrossRef][Web of Science][Medline]
Suzuki M,
Kuwata S,
Kataoka J,
Masuta C,
Nitta N,
Takanami Y
(1991)
Functional analysis of deletion mutants of cucumber mosaic virus RNA3 using an in vitro transcription system.
Virology
183:
106-113
[CrossRef][Web of Science][Medline]
Turgeon R
(1989)
Sink-source transition in leaves.
Annu Rev Plant Physiol Plant Mol Biol
40:
119-138
[CrossRef][Web of Science]
Vaquero C,
Sanz AI,
Serra MT,
García-Luque I
(1996)
Accumulation kinetics of CMV RNA 3-encoded proteins and subcellular localization of the 3a protein in infected and transgenic tobacco plants.
Arch Virol
141:
987-999
[CrossRef][Medline]
Vaquero C,
Turner AP,
Demangeat G,
Sanz A,
Serra MT,
Roberts K,
García-Luque I
(1994)
The 3a protein from cucumber mosaic virus increases the gating capacity of plasmodesmata in transgenic tobacco plants.
J Gen Virol
75:
3193-3197
[Abstract/Free Full Text]
Vaughn KC,
Hoffman JC,
Hahn MG,
Staehelin LA
(1996)
The herbicide dichlobenil disrupts cell plate formation: immunogold characterization.
Protoplasma
194:
117-132
[CrossRef]
Volk GM,
Turgeon R,
Beebe DU
(1996)
Secondary plasmodesmata formation in the minor-vein phloem of Cucumis melo L. and Cucurbita pepo L.
Planta
199:
425-432
Waigmann E,
Lucas WJ,
Citovsky V,
Zambryski P
(1994)
Direct functional assay for tobacco mosaic virus cell-to-cell movement protein and identification of a domain involved in increasing plasmodesmal permeability.
Proc Natl Acad Sci USA
91:
1433-1437
[Abstract/Free Full Text]
Willie AC,
Lucas WJ
(1984)
Ultrastructural and histochemical studies on guard cells.
Planta
160:
129-142
[CrossRef]
Willmer CM,
Sexton R
(1979)
Stomata and plasmodesmata.
Protoplasma
100:
113-124
This article has been cited by other articles:

|
 |

|
 |
 
C. Simpson, C. Thomas, K. Findlay, E. Bayer, and A. J. Maule
An Arabidopsis GPI-Anchor Plasmodesmal Neck Protein with Callose Binding Activity and Potential to Regulate Cell-to-Cell Trafficking
PLANT CELL,
February 1, 2009;
21(2):
581 - 594.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Xiong, J. Wu, Y. Zhou, and X. Zhou
Identification of a Movement Protein of the Tenuivirus Rice Stripe Virus
J. Virol.,
December 15, 2008;
82(24):
12304 - 12311.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Faulkner, O. E. Akman, K. Bell, C. Jeffree, and K. Oparka
Peeking into Pit Fields: A Multiple Twinning Model of Secondary Plasmodesmata Formation in Tobacco
PLANT CELL,
June 1, 2008;
20(6):
1504 - 1518.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kronberg, F. Vogel, T. Rutten, M.-R. Hajirezaei, U. Sonnewald, and D. Hofius
The Silver Lining of a Viral Agent: Increasing Seed Yield and Harvest Index in Arabidopsis by Ectopic Expression of the Potato Leaf Roll Virus Movement Protein
Plant Physiology,
November 1, 2007;
145(3):
905 - 918.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Winter, G. Kollwig, S. Zhang, and F. Kragler
MPB2C, a Microtubule-Associated Protein, Regulates Non-Cell-Autonomy of the Homeodomain Protein KNOTTED1
PLANT CELL,
October 1, 2007;
19(10):
3001 - 3018.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Gopinath and C. C. Kao
Replication-Independent Long-Distance Trafficking by Viral RNAs in Nicotiana benthamiana
PLANT CELL,
April 1, 2007;
19(4):
1179 - 1191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-Y. Zhang, X.-L. Wang, X.-F. Wang, G.-H. Xia, Q.-H. Pan, R.-C. Fan, F.-Q. Wu, X.-C. Yu, and D.-P. Zhang
A Shift of Phloem Unloading from Symplasmic to Apoplasmic Pathway Is Involved in Developmental Onset of Ripening in Grape Berry
Plant Physiology,
September 1, 2006;
142(1):
220 - 232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Lee, K.-i. Taoka, B.-C. Yoo, G. Ben-Nissan, D.-J. Kim, and W. J. Lucas
Plasmodesmal-Associated Protein Kinase in Tobacco and Arabidopsis Recognizes a Subset of Non-Cell-Autonomous Proteins
PLANT CELL,
October 1, 2005;
17(10):
2817 - 2831.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Qi, T. Pelissier, A. Itaya, E. Hunt, M. Wassenegger, and B. Ding
Direct Role of a Viroid RNA Motif in Mediating Directional RNA Trafficking across a Specific Cellular Boundary
PLANT CELL,
July 1, 2004;
16(7):
1741 - 1752.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. An, U. Melcher, P. Doss, M. Payton, A. C. Guenzi, and J. Verchot-Lubicz
Evidence that the 37 kDa protein of Soil-borne wheat mosaic virus is a virus movement protein
J. Gen. Virol.,
November 1, 2003;
84(11):
3153 - 3163.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Jacobs, V. Lipka, R. A. Burton, R. Panstruga, N. Strizhov, P. Schulze-Lefert, and G. B. Fincher
An Arabidopsis Callose Synthase, GSL5, Is Required for Wound and Papillary Callose Formation
PLANT CELL,
November 1, 2003;
15(11):
2503 - 2513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Kim, Z. Yuan, and D. Jackson
Developmental regulation and significance of KNOX protein trafficking in Arabidopsis
Development,
September 15, 2003;
130(18):
4351 - 4362.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Itaya, F. Ma, Y. Qi, Y. Matsuda, Y. Zhu, G. Liang, and B. Ding
Plasmodesma-Mediated Selective Protein Traffic between "Symplasmically Isolated" Cells Probed by a Viral Movement Protein
PLANT CELL,
September 1, 2002;
14(9):
2071 - 2083.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhu, Y. Qi, Y. Xun, R. Owens, and B. Ding
Movement of Potato Spindle Tuber Viroid Reveals Regulatory Points of Phloem-Mediated RNA Traffic
Plant Physiology,
September 1, 2002;
130(1):
138 - 146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Haywood, F. Kragler, and W. J. Lucas
Plasmodesmata: Pathways for Protein and Ribonucleoprotein Signaling
PLANT CELL,
May 1, 2002;
14(90001):
S303 - 325.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Y. Kim, Z. Yuan, M. Cilia, Z. Khalfan-Jagani, and D. Jackson
Intercellular trafficking of a KNOTTED1 green fluorescent protein fusion in the leaf and shoot meristem of Arabidopsis
PNAS,
March 19, 2002;
99(6):
4103 - 4108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Hanson and R. H. Kohler
GFP imaging: methodology and application to investigate cellular compartmentation in plants
J. Exp. Bot.,
April 1, 2001;
52(356):
529 - 539.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|