|
Plant Physiol. (1998) 118: 1005-1014
The Heat-Shock Element Is a Functional Component of the
Arabidopsis APX1 Gene Promoter1
Sergei Storozhenko,
Pascal De Pauw,
Marc Van Montagu*,
Dirk Inzé, and
Sergei Kushnir
Laboratorium voor Genetica, Departement Genetica, Vlaams
Interuniversitair Instituut voor Biotechnologie (S.S., P.D.P.,
M.V.M., S.K.); and Laboratoire Associé de l'Institut National de
la Recherche Agronomique (France) (D.I.), Universiteit Gent, K.L.
Ledeganckstraat 35, B-9000 Gent, Belgium
 |
ABSTRACT |
Ascorbate peroxidases are important
enzymes that detoxify hydrogen peroxide within the cytosol and
chloroplasts of plant cells. To better understand their role in
oxidative stress tolerance, the transcriptional regulation of the
apx1 gene from Arabidopsis was studied.
The apx1 gene was expressed in all tested organs of
Arabidopsis; mRNA levels were low in roots, leaves, and stems and high
in flowers. Steady-state mRNA levels in leaves or cell suspensions
increased after treatment with methyl viologen, ethephon, high
temperature, and illumination of etiolated seedlings. A putative heat-shock cis element found in the apx1
promoter was shown to be recognized by the tomato (Lycopersicon
esculentum) heat-shock factor in vitro and to be responsible
for the in vivo heat-shock induction of the gene. The heat-shock
cis element also contributed partially to the induction
of the gene by oxidative stress. By using in vivo dimethyl sulfate
footprinting, we showed that proteins interacted with a G/C-rich
element found in the apx1 promoter.
 |
INTRODUCTION |
AOS such as superoxide radicals, hydrogen peroxide, and hydroxyl
radicals are continuously formed in aerobic organisms. AOS cause
oxidative damage of cell constituents (Halliwell and Gutteridge, 1989 ),
and their involvement in different kinds of biotic or abiotic stresses
such as chilling, drought, environmental pollution (ozone, sulfur
dioxide), and pathogen attack is well documented (Bowler et al., 1992 ).
Plants have both nonenzymatic and enzymatic AOS-detoxification systems.
Several small antioxidant molecules, such as ascorbic acid,
glutathione, -tocopherol, carotenoids, and flavonoids, can quench
all kinds of AOS (Halliwell and Gutteridge, 1989 ). Because of the
simple chemical nature of the quenching reactions, some of these
molecules have to accumulate to very high concentrations within the
cells to be effective (Loewus and Loewus, 1987 ). Several enzymes can
efficiently detoxify AOS; whereas superoxide radicals are
disproportionately detoxified by superoxide dismutases, hydrogen peroxide is destroyed by catalases and different kinds of peroxidases (Bowler et al., 1992 ).
A major hydrogen peroxide-detoxifying system in plant chloroplasts and
cytosol is the so-called ascorbate-glutathione cycle, in which APXs are
the key enzymes (Asada, 1994 ). So far, APX activity has been found in
plants, algae, and some cyanobacteria, and it has also recently been
identified in insects (Mathews et al., 1997 ). APX has been purified and
characterized from several plant species. Functionally and structurally
distinct from the typical peroxidase superfamily, APX is unique in
having a high specificity toward ascorbic acid as an electron donor
(for review, see Asada, 1994 ). The APXs are a fast-growing family of
proteins. Several different protein isoforms are known: two soluble
cytosolic forms, several cytosolic forms bound to membranes of
glyoxisomes and peroxisomes, and two chloroplastic forms, one of which
is stromal and the other is thylakoid bound (for review, see Jespersen
et al., 1997 ). Analysis of the expressed sequence tag databases has allowed the distinction of as many as seven different types of APXs in
Arabidopsis (Jespersen et al., 1997 ). Recently, APX activity in pea
mitochondria has been reported (Jiménez et al.,
1997 ).
APX is believed to be involved in the detoxification of photoproduced
hydrogen peroxide. The activities of the cytosolic and chloroplastic
APX increase in carotenoid-less mustard seedlings exposed to light
because of the increased rate of AOS photoproduction (Thomsen et al.,
1992 ). Furthermore, APX activity has been shown to increase in response
to a number of stress conditions, such as drought (Smirnoff and
Colombé, 1988 ; Tanaka et al., 1990 ; Mittler and Zilinskas, 1994 ),
air pollution (Tanaka et al., 1985 ; Mehlhorn et al., 1987 ; Conklin and
Last, 1995 ; Kubo et al., 1995 ; Rao et al., 1996 ), high light intensity
combined with chilling (Schöner and Krause, 1990 ) or deficiency
in microelements (Cakmak and Marschner, 1992 ), iron stress (Vansuyt et
al., 1997 ), excessive light (Karpinski et al., 1997 ), UV-B light (Rao
et al., 1996 ), and salt stress (Lopez et al., 1996 ). In some cases
posttranslational components are involved in the regulation of the APX
activity (Mittler and Zilinskas, 1994 ; Lopez et al., 1996 ). However,
increases in APX activity are usually accompanied by transcriptional
activation of the gene. In spite of this fact, surprisingly little is
known about the mechanisms underlying this regulation or about the
promoter organization of the APX genes.
At present the sequences of three APX genes are available: two from
Arabidopsis (apx1 and apx2;
Kubo et al., 1993 ; Santos et al., 1996 ) and one from pea
(apx1; Mittler and Zilinskas, 1992 ). All of them code for
cytosol-soluble isoforms of APX that are highly homologous to each
other (approximately 80% amino acid identity). However,
apx2 from Arabidopsis seems to differ from the Arabidopsis
apx1 gene as well as from the pea apx1 gene in many respects, particularly in the induction pattern, and represents another isoform of cytosol-soluble APX (Santos et al., 1996 ; Karpinski et al., 1997 ).
In pea apx1 gene expression is induced by oxidative stress,
heat, and drought stress and by ethylene and ABA (Mittler and Zilinskas, 1992 , 1994 ). In Arabidopsis the expression of the
apx1 gene was shown to be induced by ozone, sulfur dioxide,
and excessive light (Kubo et al., 1995 ; Karpinski et al., 1997 ).
Sequence comparison of the promoter of the pea and Arabidopsis
apx1 genes has revealed the presence of only one region of
high homology that is located around the TATA box and contains several
sequence motifs characteristic of the HSE identified in promoters of
all heat-shock-inducible genes.
The heat-shock response is a general reaction of all organisms after
exposure to elevated temperatures and is characterized by a rapid
synthesis of a set of specific heat-shock proteins (for review, see
Nover, 1991 ). However, the heat-shock response can be induced by other
stresses, particularly by oxidative stress (Morgan et al., 1986 ;
Courgeon et al., 1988 ; Liu and Thiele, 1996 ; McDuffee et al., 1997 ).
Conversely, heat shock can result in an oxidative stress, which induces
genes involved in the oxidative stress defense (Morgan et al., 1986 ).
We present an analysis of the Arabidopsis apx1 gene
promoter. Data from in vitro interactions of a tomato
(Lycopersicon esculentum) HSF with the apx1
promoter and mutational analysis confirmed that the HSE is responsible
for the heat-shock induction of the gene and partially contributes
to the induction by oxidative stress. Other putative regulatory
cis elements were characterized by in vivo footprinting.
 |
MATERIALS AND METHODS |
Plant Material
Plants of Arabidopsis ecotype Columbia were grown in
soil at 20°C under a 16-h light/8-h dark regime. The Arabidopsis
suspension culture was grown on a rotary shaker in B5 Gamborg medium
(GIBCO-BRL) supplemented with 1 mg L 1 2,4-D.
For the expression analysis, plants were sprayed with 10 6 M methyl viologen or with 15 mM ethephon. For the light-induction experiments, 5- to
6-d-old etiolated seedlings were exposed to light. Protoplasts were
prepared from soil-grown plants essentially as described previously
(Altmann et al., 1992 ).
Screening of Arabidopsis cDNA and Genomic Libraries
Phages (5 × 105) of an Arabidopsis
cDNA library in gt10 were screened with a probe prepared from a
spinach apx cDNA (S. Kushnir, unpublished results). Twelve
positive plaques were purified to homogeneity and the two longest cDNAs
were sequenced on both strands.
To clone the apx1 gene, 3 × 104
plaques of an Arabidopsis ecotype Landsberg
erecta genomic library in Charon 35 were screened with
the Arabidopsis apx1 cDNA probe. After the two overlapping clones, APAG7 and APAG3, were isolated and mapped, the apx1
gene sequence was determined on both strands, including 1.5 kb of the promoter sequence.
RNA Analysis
RNA was extracted from Arabidopsis organs according to the method
of Shirzadegan et al. (1991) . RNA gel-blot analysis of glyoxylated RNA
was performed according to standard procedures (Ausubel et al., 1993 ).
To ensure equal loading of RNA, blots were stained with methylene blue
(Ausubel et al., 1993 ). Hybridizations of RNA blots were according to
the method of Church and Gilbert (1984) . Poly(A+) mRNA was
prepared using oligo(dT)-beads (Dynabeads, Dynal, Oslo, Norway) as
recommended by the manufacturer. The transcription start was mapped by
T4 DNA polymerase primer extension mapping (Hu and Davidson, 1986 ) and
by the PCR amplification of 5 ends of the apx1 mRNA (Troutt
et al., 1992 ).
HSF Expression
A tomato (Lycopersicon esculentum) HSF cDNA was
amplified by PCR from tomato cDNA using Pfu polymerase (Stratagene) and
the primers CCAACTTCACCTCAGTTACAAACC and
GGATCCCATATGTCGCAAAGAACAGCGCCGGCG. Primers were designed according
to the known cDNA sequence of the tomato HSF B2 (Scharf et al., 1990 ;
Nover et al., 1996 ). The cloned PCR fragment was sequenced and the
encoded protein was identical to HSF B2 except for a few differences in
amino acid sequence (data not shown). The tomato HSF B2 cDNA was
subcloned in the pQE8 (Qiagen, Chatsworth, CA) and pET11a (Novagen,
Madison, WI) expression vectors to produce an in-frame amino-terminal
fusion with a stretch of six His residues (the fusion protein referred to as hHSF) and with a T7 immunotag (the fusion protein referred to as
tHSF), respectively. The expression of proteins was in
Escherichia coli strains M15 (Qiagen) for pQE8 or BL21 for
pET11a. The protein synthesis was induced in logarithmically grown
E. coli cultures in Luria-Bertani medium (37°C) by the
addition of 1 mM
isopropyl- -D-thiogalacto-pyranoside, and the cultures
were grown for an additional 4 to 5 h at different temperatures.
HSF active in DNA binding was obtained only when E. coli
cells were grown at 25°C to 28°C but not at 37°C. Most of the
hHSF fusion protein was found in inclusion bodies regardless of the
temperature at which cells were grown, whereas the tHSF was detected in
soluble form and with high activity in DNA binding.
Both HSF proteins were purified under native conditions. The hHSF was
purified as recommended by the manufacturer on a nickel-chelating column (Qiagen), dialyzed against TM buffer (Kroeger et al.,
1993 ), and stored at 70°C.
For the tHSF preparation 200 mL of induced E. coli culture
was used. The tHSF was purified as follows: after induction, cells were
harvested by centrifugation and the pellet was resuspended in TM buffer
supplemented with 20 mg mL 1 leupeptin. Cells were
disrupted by sonication and the homogenate was cleared by
centrifugation in a SW27 rotor (Beckman) for 30 min at 4°C. The
supernatant was mixed with 5 mL of CM Sephadex G-50 (Pharmacia,
Uppsala, Sweden) equilibrated in the same buffer, and proteins were
allowed to absorb for 30 min at 4°C. Sephadex was then packed in a
small column and washed with TM buffer. Bound proteins were eluted by
TM buffer containing 0.4 M KCl. The eluate was diluted
2-fold with TM buffer, applied to a heparin-Sepharose column (5 mL)
equilibrated with TM buffer containing 0.2 M KCl, washed,
and subsequently eluted with 0.4 M KCl in TM buffer. At this step, the tHSF was approximately 80% pure and the major
contaminating proteins were truncated forms of the recombinant protein
that were efficiently removed by gel filtration in TM buffer on an Ultrahydrogel 500 column (7.8 mm × 30 cm [Waters]). The tHSF
peak fractions were separated into aliquots and stored at 70°C.
Gel-Shift Analysis and in Vitro Footprinting
Two apx1 promoter fragments were amplified by PCR and
subcloned in pBluescript KS+ (Stratagene). Fragment A
contained sequences from 274 to +42 (primers CCCTCCACACGAAGCATGTATCC
and CTGGAGAAATGCGAGTGG), and fragment B contained sequences from
246 to 499 (primers ATTGGAGGATACATGCTTCGTGTGG and
GGTGAGAAACCTAATAACACTG). The 3 and 5 end-labeled fragments were
prepared according to standard procedures (Ausubel et al., 1993 ).
DNase I footprinting was done essentially as described previously
(Kroeger et al., 1993 ). Labeled probe (20,000-50,000 cpm), 1 µg of
poly(dIdC)·poly(dIdC), and tHSF were incubated in binding buffer (50 mM Tris-HCl, pH 7.3, 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 5%
Suc, and 5% glycerol) in a total volume of 20 µL. After the sample
was incubated for 20 to 30 min at room temperature, 2 µL of a Ca/Mg
mixture (10 mM CaCl2 and 10 mM MgCl2) and 2 µL of DNase I
(Pharmacia) dilution were added to the binding buffer. After 1 min of
DNase I digestion, samples were processed as described previously
(Kroeger et al., 1993 ). The same labeled fragment was chemically
cleaved at the G and A bases following standard procedures (Ausubel et
al., 1993 ) to provide molecular mass markers.
For the electrophoretic mobility-shift assays, labeled fragments were
incubated with tHSF or hHSF under the same conditions as for the DNase
I footprinting, and DNA-protein complexes were resolved by native 5%
PAGE in 0.5× Tris-borate buffer at room temperature. Variables were
the amount of nonspecific competitor DNA, the type of competitor DNA
(salmon-sperm), and the presence or absence of specific competitors
(fragments A and B).
apx1 Promoter-gus Fusion Construction,
Site-Directed Mutagenesis of HSE, and Plant Transformation
Fusion at the ATG start codon of the gus reporter gene
was obtained after site-directed mutagenesis by PCR. The
apx1 gene-specific primer CCATGGTAGCTAAGCTCTGGAACAA was used
to introduce a NcoI site at the ATG start codon. The
amplified 1.2-kb fragment was digested with NcoI and
HindIII and subcloned into NcoI plus
HindIII-cleaved pGUS1 plasmid (Peleman et al., 1989 ).
apx1 promoter-gus fusions were subcloned as
EcoRI-HindIII fragments into the binary vector pGSV6 (Plant Genetic Systems N.V., Gent, Belgium). Binary vectors were
transformed into Agrobacterium tumefaciens
C58C1RifR (pGV2260) according to the
method of De Block et al. (1987) . Arabidopsis C24 was transformed
according to the method of Valvekens et al. (1988) .
To introduce point mutations into the HSE, site-directed mutagenesis
was done by PCR. The HSE-specific primer CAGATCTACCATAACATTATCATTAATGAC with two mutated bases was used as a mutagenic PCR primer, whereas the
above-mentioned apx1 gene-specific primer generating the
NcoI site at the ATG codon was utilized as the second PCR
primer. The wild-type sequence in the apx1
promoter-gus fusion was replaced with an amplified genomic
fragment with mutated HSE using BglII and NcoI
sites.
To study the induction of the gene with mutated HSE, 2-week-old, in
vitro-grown Arabidopsis seedlings of four independent transgenic lines
transformed with the mutant or wild-type apx1 promoter-gus fusion were pooled and infiltrated with
10 5 M methyl viologen. To induce
heat shock, plants were grown in a chamber (Weiss Klimatechnik GmbH,
Reiskirchen, Germany) at 22°C and then subjected to single-step
increases in temperature to 37°C.
In Vivo Footprinting
The ligation-mediated PCR version of in vivo footprinting was used
(Mueller and Wold, 1989 ; Pfeifer et al., 1989 ). Arabidopsis protoplast
suspensions (10 mL) were treated with 0.2% DMS in W5 salt solution
(Altmann et al., 1992 ) at room temperature for 5 and 10 min.
Protoplasts were then pelleted and washed with 10 mL of ice-cold W5
solution. The protoplast pellet was lysed with a lysis buffer and DNA
was purified as described above. The DNA samples were processed as
described previously (Mueller and Wold, 1989 ; Pfeifer et al., 1989 ).
Three specific overlapping oligonucleotides (CCTTAGTCCAATTGGGATCTTCGCC
at position 415, TTGGGATCTTCGCCTGCGTGAGACG, and
CGCCTGCGTGAGACGCGTCACACCTGCG) were used in the ligation-mediated PCR
footprinting of the apx1 promoter. The adaptor for the
ligation was prepared by annealing two oligonucleotides
(GCGGTGACCCGGGAGATCTGAATTC and GAATTCAGATC) (Mueller and Wold, 1989 ).
 |
RESULTS |
Previously, a cDNA and a gene encoding the cytosolic APX from
Arabidopsis were cloned (Kubo et al., 1992 , 1993 ). The independent isolation, and sequencing of the gene, and mapping of the transcription start confirmed the published data (data not shown).
A comparison of the promoter sequences showed that the Arabidopsis
apx1 gene shared only one region (approximately 44 bp) with
strong homology to the promoter of the pea apx1 gene (80% identity over 44 bp; Fig. 1B). This
region, located around the TATA box, contains a putative HSE. The
promoter sequence of another APX gene from Arabidopsis,
apx2, had no extended sequence homology with the promoter of
apx1. However, two HSE-like sequences were also present in
the promoter of the apx2. A first HSE was identified by
Santos et al. (1996) at position 293, but careful sequence inspection
exposed a second HSE at position 205.

View larger version (15K):
[in this window]
[in a new window]
| Figure 1.
A, Schematic representation of the
apx1 promoter organization. ATG indicates the initiating
translation codon. An intron located in the 5 untranslated region and
the transcription start are marked by a black box and an arrowhead,
respectively. The positions (in bp) of the putative and identified
cis elements as related to the transcription start are
indicated above the line. as/ocs, Sequences similar to the
cis elements as-1 from the 35S cauliflower mosaic virus
promoter (Benfey and Chua, 1990 ) and ocs from the octopine synthase
promoter (Singh et al., 1990 ), which are recognized by a member of the
b-Zip family of DNA-binding proteins; H, sequence similar to the H box,
recognized by proteins from the myb family (Sablovski et
al., 1994); G/C, G- and C-rich sequence for which in vivo footprints
have been identified in this study. B, Comparison of the heat-shock
elements from pea (P.s.) and Arabidopsis (A.th.) apx1.
Sequences matching the nGAAn, the basic 5-bp HSE motif, are indicated
in uppercase letters. The two central motifs are in reverse orientation
and perfectly match requirements for the minimal HSF-binding motif
nGAAnnTTCn. They are flanked by two other motifs, of which the upstream
motif has one tolerated substitution and the downstream motif perfectly
fits the nGAAn consensus except that it is shifted on 1 bp and has a
direct instead of a reverse orientation to the adjacent 5-bp motif.
Orientations of the nGAAn-like motifs are indicated by arrows. The
sequence of the TATA box is shown in bold uppercase letters.
|
|
Computer analysis of the Arabidopsis apx1 gene also revealed
the presence of two other elements, the H box and the as-1/ocs box,
which are possibly recognized by Myb and b-Zip proteins, respectively
(Fig. 1A). The as-1/ocs-like motifs were also found in the pea
apx1 promoter and were similar to the xenobiotic responsive element that is recognized by AP-1-like b-ZIP transcription factors in
mammalian cells (Mittler and Zilinskas, 1992 ).
Analysis of apx1 mRNA Levels in Response to Stress
Expression analysis was undertaken to characterize the
apx1 gene. A single transcript of approximately 1080 nucleotides hybridizing to the apx1 probe could be detected
by RNA gel-blot analysis of total Arabidopsis RNA. Figure
2A shows that the apx1 mRNA of
Arabidopsis was present in all tested organs, with the highest level in
flowers and lower levels in leaves, stems, and roots.

View larger version (39K):
[in this window]
[in a new window]
| Figure 2.
RNA gel-blot analysis of APX mRNA. A, Size and
levels of apx1 mRNA in roots (R), stems (S), flowers
(F), and leaves (L) of soil-grown Arabidopsis. Labeled and glyoxylated
HindIII fragments were loaded to evaluate the size of
the mRNA, which is indicated in bases. B, The effect of methyl viologen
(10 6 M), ethephon (15 mM), and
light on the apx1 mRNA levels of in vitro-grown cells,
mature plants, and etiolated seedlings, respectively. Hours after
treatment are given at the top of the lanes.
|
|
Methyl viologen is commonly used in experiments to induce oxidative
stress. Apx1 mRNA levels increased within a few hours after
Arabidopsis plants were sprayed with this herbicide (Fig. 2B). No
visible damage of the leaves was observed 24 h after
10 6 M methyl viologen was sprayed.
Elevated apx1 mRNA levels could also be detected after
treatment of an Arabidopsis cell-suspension culture with methyl
viologen (Fig. 2B).
APX activity was shown to increase in plants after ethylene treatment
(Mehlhorn et al., 1987 ). To determine whether ethylene had an effect on
the apx1 mRNA levels, Arabidopsis plants were sprayed with a
15 mM solution of ethephon, which releases ethylene after
decomposition. Figure 2B shows that such a treatment led to a
severalfold increase of the apx1 mRNA within 3 h.
Furthermore, light had positive effects on the amount of the
apx1 mRNA in etiolated Arabidopsis seedlings (Fig. 2B).
Because the pea apx1 gene was induced by heat, and the
putative HSE was present in the apx1 gene promoter of both
pea and Arabidopsis genes, we analyzed the expression of the
apx1 gene after heat shock and found that the steady-state
Arabidopsis apx1 mRNA level was also induced by heat
treatment (see below).
In Vitro Interactions of the HSF with the apx1 promoter
Heat-shock induction of the gene strongly suggested that the
putative HSE might be responsible for the induction. A necessary condition for the heat-shock-activated transcription was a binding of
the HSF trimer(s) to the sequence of HSE (for review, see Wu, 1995 ).
In vitro binding assays were performed to obtain evidence for the
possible binding of an HSF to the putative HSE. The full-length cDNA
encoding the tomato HSF B2 (Scharf et al., 1990 ; Nover et al., 1996 )
was cloned after PCR amplification, and the encoded HSF was expressed,
albeit at low amounts, in the soluble fraction as hHSF in E. coli. The interaction of the hHSF with apx1 promoter fragments was analyzed by an electrophoresis mobility-shift assay. As
shown in Figure 3A, incubation of the
316-bp fragment containing the HSE of the apx1 promoter
(fragment A) with the hHSF resulted in the formation of DNA-protein
complexes that were insensitive to increasing amounts of nonspecific
competitor nucleic acids. This hHSF-binding activity could be competed
out by only a 50- and 100-fold excess of the same unlabeled fragment
but not with fragment B from the apx1 promoter.

View larger version (43K):
[in this window]
[in a new window]
| Figure 3.
Expression and analysis of DNA-binding activities
of the HSF. A, Electrophoresis mobility-shift assay of the DNA-protein
complexes between hHSF and fragment A from the apx1
promoter. Labeled fragment A (40,000 cpm; see ``Materials and Methods'') was incubated with hHSF in the presence of the nonspecific
DNA competitor poly(dIdC)·poly(dIdC) in increasing amounts (0.5, 1.0, and 2.0 µg) with unlabeled, cold fragment A (Fr A) at 20 ng (+) and
100 ng (++) as a specific competitor, and with fragment B (Fr B) at 20 ng (+) and 100 ng (++) as an unspecific competitor. After 30 min of
incubation, DNA-protein complexes were resolved by 5% PAGE and the gel
was dried and exposed to radiographic film. B, Purification of tHSF.
Approximately 2 µg of the tHSF (lane 2) after the gel-filtration step
was mixed with loading buffer, boiled, and resolved by the denatured
12% SDS-PAGE aside a molecular mass marker (lane 1). Molecular masses
are indicated on the left in kD. C, Saturation binding of the tHSF to
the fragment A from apx1 promoter. Fragment A was
incubated with increasing amounts of the tHSF. Lanes 2 to 8 contain 1, 5, 10, 50, 100, 200, and 300 ng of tHSF, respectively, in the binding
buffer in the presence of poly(dIdC)·poly(dIdC) as a
nonspecific competitor. The DNA-protein complexes were resolved by
native PAGE. In lane 1, no protein was added. Arrowheads in A and C
indicate migration of the free probe. D, Schematic representation of
fragments A and B used in the experiment with respect to the
apx1 sequence.
|
|
To optimize the expression of the HSF we expressed it as an
amino-terminal fusion in the pET11a plasmid in E. coli BL21
(see ``Materials and Methods''). The expressed protein (tHSF), which
was mainly present in the soluble fraction, was purified to near
homogeneity by three chromatography steps (Fig. 3B). In a dilution
series of tHSF, complete saturation of the binding sites in the
apx1 promoter could be reached (Fig. 3C). Although in vivo
HSF binds DNA as a trimer (Scharf et al., 1990 ; Lis and Wu, 1993 ),
trimerization increases only the affinity of HSF to DNA, and only the
monomeric HSF and the DNA-binding domain of the HSF are able to
specifically bind DNA (Flick et al., 1994 ). Retention time of the tHSF
peak elution in the HPLC gel-filtration step indicated that the tHSF was in a monomeric form. Because the tHSF protein existed as a monomer
in the solution, and several binding sites for the protein were present
in a HSE, we observed the formation of several DNA-protein complexes.
To prove that the interaction of tHSF is specific and to delineate the
HSE in the apx1 gene, we performed in vitro DNase
I-footprinting analysis. As shown in Figure
4, incubation of the apx1
promoter fragment with increasing amounts of tHSF resulted in the
complete protection of a 30-bp sequence on both strands. This sequence contained two 5-bp core HSE motifs arranged in reverse orientation, aGAAcgTTCt, which perfectly fit a defined minimal unit nGAAnnTTCn necessary for HSF trimer binding (Perisic et al., 1989 ). Two other similar 5-bp motifs were found on both sides of the central
inverted repeat, which served as additional binding sites for the HSF; it has been shown that at least three such 5-bp basic motifs are necessary for high-affinity binding of the HSF (Perisic et al., 1989 ;
Kroeger et al., 1993 ).

View larger version (112K):
[in this window]
[in a new window]
| Figure 4.
In vitro DNase I-footprinting analysis of the
tHSF interactions with apx1 promoter. Fragment A was
labeled at the 3 (coding strand) or 5 (noncoding strand) ends.
Labeled fragments were incubated with increasing amounts of tHSF (1, 5, 10, 50, 100, 200, and 300 ng) or alone in the binding buffer, followed
by DNase I digestion and separation on a 5% sequencing gel. The
fragment was chemically cleaved at the A/G bases to provide a molecular
mass marker. Triangles over the lanes indicate increasing
concentrations of tHSF. The sequence of the apx1
promoter with the putative HSE is in between the two sequencing gels.
Regions protected from DNase I digestion are indicated by bars. All
sequences that fit the nGAAn 5-bp HSE motif are indicated by italic
uppercase letters, and the expected TATA box is indicated by boldface
uppercase letters.
|
|
Stress Responsiveness of the apx1 Promoter Mutated
in HSE
To prove that the putative HSE is involved in the regulation of
apx1 gene expression in vivo, we designed an apx1
promoter-gus translational fusion at the ATG start codon.
This construct contained 1.2 kb of apx1 promoter sequence
and was used to introduce point mutations into the putative HSE. The
HSE mutant version of the apx1 promoter was prepared by
introducing two nucleotide replacements into the central inverted
repeat aGAAcgTTCt, which then read aTAAcgTTAt (Fig.
5A). The replacement of the G base in the
nGAAn basic HSE motif is known to have the most deleterious effect on
the HSF binding in vitro (Fernandes et al., 1994 ) and dramatically
affects heat-shock inducibility in vivo (Barros et al., 1992 ).

View larger version (62K):
[in this window]
[in a new window]
| Figure 5.
Study of the stress responsiveness of the
apx1 promoter mutated in HSE. A, Site-directed
mutagenesis of the putative HSE. Sequences matching the nGAAn consensus
are indicated in uppercase letters. The arrows point from the
nucleotides that have been changed to the nucleotides introduced
instead. The BglII site used for cloning is underlined
and the TATA box is indicated in bold uppercase letters. B, Study of
the apx1 promoter with mutated HSE in response to heat
shock. In vitro-grown, 2-week-old transgenic Arabidopsis seedlings
expressing apx1(HSEmut) and
apx1(HSEwt) were shifted from 22°C to
37°C, and RNA was extracted from the whole seedlings at different
times and analyzed by gel-blot hybridization using apx1-
and gus-specific probes. The times in minutes are
indicated at the top of the lanes. C, Effect of methyl viologen
treatment on the apx1 promoter function with mutated
HSE. The same plant material as in B was infiltrated with
10 5 M methyl viologen solution. RNA was
extracted at different times after the treatment and analyzed by
gel-blot hybridization using mixed apx1- and
gus-specific probes. The times in hours are indicated at
the top of the lanes. The difference between the endogenous
apx1 and gus mRNA levels reflects the
difference between specific radioactivities of the probes used rather
than the levels of real mRNA. Infiltration of the plants with water was
also used as a control and no increase in the mRNA levels was observed
(data not shown).
|
|
The promoter-gus fusions were subcloned into a binary vector
and stably integrated into the genome of Arabidopsis C24. The transgenic plants were monitored for their ability to express the
apx1(HSEmut) mRNA under normal and
stress conditions. Transgenic plants expressing the
apx1(HSEwt) were used as a control.
Because the size of the gus fusion mRNA was substantially
higher than the apx1 messenger, we could easily distinguish
both the fusion and endogenous apx1 expression on the same
RNA gel-blot membrane by using corresponding mixed probes.
Under normal conditions the basal level of the
apx1(HSEmut) and
apx1(HSEwt) mRNAs seemed to be similar
(Fig. 5B). However, a dramatic difference in expression was found after
the heat-shock treatment. The levels of the endogenous apx1
and apx1(HSEwt) mRNAs clearly
increased, as discussed above. In contrast, the apx1(HSEmut) was repressed, with mRNA
being almost undetectable after 1.5 h of the onset of heat shock.
These data confirm that the putative HSE is the functional HSE
responsible for the heat-shock induction of the apx1 gene.
We also analyzed the oxidative stress response of
apx1(HSEmut). Results of the induction
with methyl viologen in the same system are shown in Figure 5C. The
promoter containing the mutant HSE was still induced, suggesting that
this type of apx1 induction depends mainly on some other
cis element(s) to be identified further. However,
quantitative analysis of the intensity of the bands using phosphor
imaging revealed that the induction by methyl viologen of the
apx1(HSEmut) was weaker, ranging from
70% of the apx1(HSEwt) level during
the first 2 h of the treatment to 30% of the
apx1(HSEwt) level by the end of the
treatment. The high reproducibility of the induction pattern of the
endogenous apx1 in the transgenic plants expressing both the
apx1(HSEmut) and
apx1(HSEwt) ruled out the possibility
that the observed differences were due to variability in the methyl
viologen treatments.
In Vivo Footprinting of the apx1 Promoter
As a second approach to gaining insight into the promoter of the
apx1 gene, we analyzed DNA-protein interactions in the
proximal part of the apx1 promoter using ligation-mediated
PCR-DMS in vivo footprinting (Mueller and Wold,
1989 ; Pfeifer et al., 1989 ). The G ladder was visualized using two
different modifications of this method, blotting with subsequent DNA
hybridization (Pfeifer et al., 1989 ) and extension of
32P-labeled primer (Mueller and Wold, 1989 ).
Figure 6 shows the results obtained with
DNA extracted from DMS-treated Arabidopsis leaf protoplasts compared
with DMS-treated naked DNA. As confirmed by the two methods and several
independent experiments, G at 273, 272, and 271 on the noncoding
strand were protected from DMS modification and G at 269 was
hypersensitive to DMS. Similar G/C-rich sequences were found in several
plant promoters that had homology to the ethylene-inducible bean
chalcone synthase and avocado cellulase promoters (Fig. 6). A strong
DMS hypersensitivity at G 55 was detected close to the TATA box in
the HSE sequence, confirming our results on the functionality of HSE in
the apx1 promoter.

View larger version (74K):
[in this window]
[in a new window]
| Figure 6.
In vivo footprinting analysis of the proximal part
(approximately 400 bp) of the apx1 promoter. Lanes 1, 2, 9, and 10 are DMS-treated naked genomic Arabidopsis DNA from two
independent samples. Reactions were performed with DNA samples from the
DMS-treated protoplasts. The samples loaded in lanes 3 to 6, 7 and 8, and 10 to 13 were derived from two independent preparations and were
loaded in all other lines. Protoplasts were treated with 0.2% DMS for
5 min (lanes 3, 5, 7, and 8) and 10 min (lanes 4, 6, 11, 12, and 13).
The footprinting was done by the hybridization approach (Pfeifer et
al., 1989 ) or by extension of a labeled primer (top and bottom
autographs, respectively; Muller and Wold, 1989). Arrows with open
circles indicate complete protection from the DMS modification, and
arrows with filled circles indicate the G-269 and G-55 hypersensitive
to DMS. Between the autoradiographs, the corresponding sequences of the
apx1 gene promoter are shown and the protected bases on
the noncoding strand are pointed out as above. Below, an
apx1 promoter sequence, part of the promoter sequences
of the bean chalcone synthase gene CH5B (Broglie et al., 1989 ), and the
avocado cellulase gene CEL (Cass et al., 1990 ) are
shown. The vertical bars show the similarity between these sequences.
|
|
 |
DISCUSSION |
APXs are thought to play an essential role in protecting plants
from oxidative stress. It was shown previously that steady-state transcript levels of the pea apx1 gene strongly increase
after treatment of plants with ethephon, methyl viologen, heat shock, and drought stress (Mittler and Zilinskas, 1992 , 1994 ). In agreement with this observation, we found that the steady-state mRNA levels of
the apx1 from Arabidopsis are up-regulated by methyl
viologen, ethephon, and heat shock. The heat-shock response is very
fast; a significant increase in transcript levels is seen already after 15 min. The observed changes in apx1 mRNA levels after
various environmental stimuli indicate that the transcriptional
activation of the apx1 gene might be an important, although
not the sole (as shown for the pea apx1 [Mittler and
Zilinskas, 1992 , 1994 ]) control step leading to higher APX activity in
plants under oxidative stress.
As an initial step in the analysis of the apx1 promoter, we
studied a putative HSE in more detail for at least two reasons. First,
the putative HSE is the sole conserved sequence between promoters of
pea and Arabidopsis apx1, implying its importance for the
promoter activity. Moreover, the promoter of the other recently cloned
apx gene from Arabidopsis, apx2, also contains the two putative HSEs (Santos et al., 1996 ; our data). Second, the
heat-shock response is known to be induced not only by heat but also by
a number of other environmental stimuli including oxidative stress. For
example, it was shown that hydrogen peroxide treatment results in the
induction of heat-shock proteins in Drosophila melanogaster
(Courgeon et al., 1988 ); and Salmonella typhimurium cells
(Morgan et al., 1986 ).
Moreover, oxidative stress imposed by menadione induced HSF
phosphorylation and an HSF-dependent transcriptional activation of the
yeast metallothionein cup1 gene (Liu and Thiele, 1996 ). Direct evidence has also been presented that proteins containing nonnative disulfate bonds as a result of oxidative stress can serve as
a signal for the activation of the heat-shock response (McDuffee et
al., 1997 ). Conversely, oxidative stress has been shown to play a major
role in heat-induced cell death in yeast (Davidson et al., 1996 ). In
parsley a small heat-shock protein was found to be induced by ozone and
heat shock (Eckey-Kaltenbach et al., 1997 ). These few examples suggest
that there is a considerable overlap in cellular processes induced by
heat shock and oxidative stress and in the subsets of genes reacting to
these stimuli. Therefore, we addressed the question of whether the HSE
may play a key role in the regulation of apx1 gene
expression.
In vitro analysis of the interaction between recombinant tomato HSF and
the apx1 promoter confirmed that the apx1 HSE
represents a functional HSF-binding site. Furthermore, the
apx1 promoter with a mutated HSE loses inducibility and even
becomes repressed under the heat-shock treatment. Nevertheless, the
inducibility by methyl viologen is retained. A careful analysis of the
phosphor images, however, demonstrated that the strength of
apx1(HSEmut) transcription was lower
than apx1(HSEwt) after the methyl
viologen treatment. This finding may not be surprising in view of the
indiscriminate chemical reactivity of AOS, which probably leads to the
elicitation of a number of redundant and/or overlapping signaling
pathways ending on different cis-acting elements in the
apx1 promoter.
We carried out an additional in vivo analysis of the apx1
promoter aiming to find other putative cis-acting elements.
For several "stress-related" plant genes it has been shown that
relevant cis elements are located close to the TATA box,
usually about 200 to 400 bp upstream from the transcription start. To
study this sequence in detail, in vivo footprinting analysis of the apx1 promoter was started, which particularly focused on the
first 300 bp. We found strong differences in DMS reactivity of G
residues in a sequence (GTGGGCCCTCC) located at approximately 270 bp
from the transcription start. This sequence is highly similar to the G/C-rich boxes found in the chlorophyll a/b-binding protein
and alcohol dehydrogenase genes, although further experiments are necessary to show whether it is recognized either by the GCBP-1 (Olive et al., 1991 ) or the GC-1 (Schindler and Cashmore, 1990 ) transcription factors. A similar element is present in a bean chalcone
synthase promoter, where it is essential for ethylene induction
(Broglie et al., 1989 ), and a homologous element is also found in
promoters of ethylene-regulated cellulase genes in avocado (Cass et
al., 1990 ).
 |
FOOTNOTES |
1
This research was supported by grants from the
Belgian Program on Interuniversity Poles of Attraction (Prime
Minister's Office, Science Policy Programming, no. 38) and the Vlaams
Actieprogramma Biotechnologie (no. ETC 002), by the International Human
Frontier Science Program (no. RG-43494M), and by the
European Community Biotech Program as part of the Project of
Technological Priority (1993-1996). D.I. is a Research Director of the
Institut National de la Recherche Agronomique (France).
*
Corresponding author; e-mail mamon{at}gengenp.rug.ac.be; fax
32-9-264-5349.
Received February 20, 1998;
accepted July 9, 1998.
 |
ABBREVIATIONS |
Abbreviations:
AOS, active oxygen species.
APX, ascorbate
peroxidase.
apx1(HSEmut), apx1 promoter-gus fusion mutated in HSE.
apx1(HSEwt), wild-type apx1
promoter-gus fusion.
DMS, dimethyl sulfate.
hHSF, hexahistidine-HSF fusion.
HSE, heat-shock cis element.
HSF, heat-shock factor.
tHSF, T7 immunotag-HSF fusion.
 |
ACKNOWLEDGMENTS |
We thank Alfredo Herrera-Estrella, Ranjan Perera, Wim Van Camp,
Didier Hérouart, Marc Van den Bulcke, and Vladimir Mironov for
many stimulating discussions and helpful comments in the course of this
work. We are grateful to Wilson Ardiles, Raimundo Villarroel, and Jan
Gielen for help with the DNA sequencing and computer sequence analysis,
to Enric Belles-Boix for technical assistance, to Martine De Cock for
preparing the manuscript, and to Vera Vermaercke, Rebecca Verbanck, and
Karel Spruyt for excellent artwork.
 |
LITERATURE CITED |
Altmann T, Damm B, Halfter U, Willmitzer L, Morris P-C (1992)
Protoplast transformation and methods to create specific mutants in
Arabidopsis thaliana. In C Koncz, N-H Chua, J Schell, eds,
Methods in Arabidopsis Research. World Scientific Publishing,
Singapore, pp 310-330
Asada K
(1994)
Production and action of active oxygen species in photosynthetic tissues.
In
CH Foyer,
PM Mullineaux,
eds, Causes of Photooxidative Stress and Amelioration of Defense Systems in Plants.
CRC Press, Boca Raton, FL, pp 77-104
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA,
Struhl K (1993) Current Protocols in Molecular Biology, Vol 1. Current Protocols, New York
Barros MD,
Czarnecka E,
Gurley WB
(1992)
Mutational analysis of a plant heat shock element.
Plant Mol Biol
19:
665-675
[CrossRef][Web of Science][Medline]
Benfey PN,
Chua N-H
(1990)
The cauliflower mosaic virus 35S promoter: combinatorial regulation of transcription in plants.
Science
250:
959-966
[Abstract/Free Full Text]
Bowler C,
Van Montagu M,
Inzé D
(1992)
Superoxide dismutase and stress tolerance.
Annu Rev Plant Physiol Plant Mol Biol
43:
83-116
[CrossRef][Web of Science]
Broglie KE,
Biddle P,
Cressman R,
Broglie R
(1989)
Functional analysis of DNA sequences responsible for ethylene regulation of a bean chitinase gene in transgenic tobacco.
Plant Cell
1:
599-607
[Abstract/Free Full Text]
Cakmak I,
Marschner H
(1992)
Magnesium deficiency and high light intensity enhance activities of superoxide dismutase, ascorbate peroxidase, and glutathione reductase in bean leaves.
Plant Physiol
98:
1222-1227
[Abstract/Free Full Text]
Cass LG,
Kirven KA,
Christoffersen RE
(1990)
Isolation and characterization of a cellulase gene family member expressed during avocado fruit ripening.
Mol Gen Genet
223:
76-86
[Medline]
Church GM,
Gilbert W
(1984)
Genomic sequencing.
Proc Natl Acad Sci USA
81:
1991-1995
[Abstract/Free Full Text]
Conklin PL,
Last RL
(1995)
Differential accumulation of antioxidant mRNAs in Arabidopsis thaliana exposed to ozone.
Plant Physiol
109:
203-212
[Abstract]
Courgeon A-M,
Rollet E,
Becker J,
Maisonhaute C,
Best-Belpomme M
(1988)
Hydrogen peroxide (H2O2) induces actin and some heat-shock proteins in Drosophila cells.
Eur J Biochem
171:
163-170
[Web of Science][Medline]
Davidson JF,
Whyte B,
Bissinger PH,
Schiestl RH
(1996)
Oxidative stress is involved in heat-induced cell death in Saccharomyces cerevisiae.
Proc Natl Acad Sci USA
93:
5116-5121
[Abstract/Free Full Text]
De Block M,
Botterman J,
Vandewiele M,
Dockx J,
Thoen C,
Gosselé V,
Movva R,
Thompson C,
Van Montagu M,
Leemans J
(1987)
Engineering herbicide resistance in plants by expression of a detoxifying enzyme.
EMBO J
6:
2513-2518
[Web of Science][Medline]
Eckey-Kaltenbach H,
Kiefer E,
Grosskopf E,
Ernst D,
Sandermann H Jr
(1997)
Differential transcript induction of parsley pathogenesis-related proteins and of a small heat shock protein by ozone and heat shock.
Plant Mol Biol
33:
343-350
[CrossRef][Web of Science][Medline]
Fernandes M,
Xiao H,
Lis JT
(1994)
Fine structure analyses of the Drosophila and Saccharomyces heat shock factor-heat shock element interactions.
Nucleic Acids Res
22:
167-173
[Abstract/Free Full Text]
Flick KE,
Gonzalez L Jr,
Harrison CJ,
Nelson HCM
(1994)
Yeast heat shock transcription factor contains a flexible linker between the DNA-binding and trimerization domains. Implications for DNA binding by trimeric proteins.
J Biol Chem
269:
12475-12481
[Abstract/Free Full Text]
Halliwell B,
Gutteridge JMC
(1989)
Free Radicals in Biology and Medicine.
Clarendon Press, Oxford, UK
Hu MC-T,
Davidson N
(1986)
Mapping transcription start points on cloned genomic DNA with T4 DNA polymerase: a precise and convenient technique.
Gene
42:
21-29
[CrossRef][Medline]
Jespersen HM,
Kjærsgård IVH,
Østergaard L,
Welinder KG
(1997)
From sequence analysis of three novel ascorbate peroxidases from Arabidopsis thaliana to structure, function and evolution of seven types of ascorbate peroxidase.
Biochem J
326:
305-310
Jiménez A,
Hernández JA,
del Río LA,
Sevilla F
(1997)
Evidence for the presence of the ascorbate-glutathione cycle in mitochondria and peroxisomes of pea leaves.
Plant Physiol
114:
275-284
[Abstract]
Karpinski S,
Escobar C,
Karpinska B,
Creissen G,
Mullineaux PM
(1997)
Photosynthetic electron transport regulates the expression of cytosolic ascorbate peroxidase genes in Arabidopsis during excess light stress.
Plant Cell
9:
627-640
[Abstract]
Kroeger PE,
Sarge KD,
Morimoto RI
(1993)
Mouse heat shock transcription factors 1 and 2 prefer a trimeric binding site but interact differently with the HSP70 heat shock element.
Mol Cell Biol
13:
3370-3383
[Abstract/Free Full Text]
Kubo A,
Saji H,
Tanaka K,
Kondo N
(1993)
Genomic DNA structure of a gene encoding cytosolic ascorbate peroxidase from Arabidopsis thaliana.
FEBS Lett
315:
313-317
[CrossRef][Medline]
Kubo A,
Saji H,
Tanaka K,
Kondo N
(1995)
Expression of Arabidopsis cytosolic ascorbate peroxidase gene in response to ozone or sulfur dioxide.
Plant Mol Biol
29:
479-489
[CrossRef][Web of Science][Medline]
Kubo A,
Saji H,
Tanaka K,
Kondo N
(1992)
Cloning and sequencing of a cDNA encoding ascorbate peroxidase from Arabidopsis thaliana.
Plant Mol Biol
18:
691-701
[CrossRef][Web of Science][Medline]
Lis J,
Wu C
(1993)
Protein traffic on the heat shock promoter: parking, stalling, and trucking along.
Cell
74:
1-4
[CrossRef][Web of Science][Medline]
Liu X-d,
Thiele DJ
(1996)
Oxidative stress induces heat shock factor phosphorylation and HSF-dependent activation of yeast metallothionein gene transcription.
Genes Dev
10:
592-603
[Abstract/Free Full Text]
Loewus FA,
Loewus MW
(1987)
Biosynthesis and metabolism of ascorbic acid in plants.
CRC Crit Rev Plant Sci
5:
101-119
Lopez F,
Vansuyt G,
Casse-Delbart F,
Fourcroy P
(1996)
Ascorbate peroxidase activity, not the mRNA level, is enhanced in salt-stressed Raphanus sativus plants.
Physiol Plant
97:
13-20
[CrossRef]
Mathews MC,
Summers CB,
Felton GW
(1997)
Ascorbate peroxidase: a novel antioxidant enzyme in insects.
Arch Insect Biochem Physiol
34:
57-68
[CrossRef]
McDuffee AT,
Senisterra G,
Huntley S,
Lepock JR,
Sekhar KR,
Meredith MJ,
Borrelli MJ,
Morrow JD,
Freeman ML
(1997)
Proteins containing non-native disulfide bonds generated by oxidative stress can act as signals for the induction of the heat shock response.
J Cell Physiol
171:
143-151
[CrossRef][Web of Science][Medline]
Mehlhorn H,
Cottam DA,
Lucas PW,
Wellburn AR
(1987)
Induction of ascorbate peroxidase and glutathione reductase activities by interactions of mixtures of air pollutants.
Free Radical Res Commun
3:
193-197
[Medline]
Mittler R,
Zilinskas BA
(1992)
Molecular cloning and characterization of a gene encoding pea cytosolic ascorbate peroxidase.
J Biol Chem
267:
21802-21807
[Abstract/Free Full Text]
Mittler R,
Zilinskas BA
(1994)
Regulation of pea cytosolic ascorbate peroxidase and other antioxidant enzymes during the progression of drought stress and following recovery from drought.
Plant J
5:
397-405
[CrossRef][Web of Science][Medline]
Morgan RW,
Christman MF,
Jacobson FS,
Storz G,
Ames BN
(1986)
Hydrogen peroxide-inducible proteins in Salmonella typhimurium overlap with heat shock and other stress proteins.
Proc Natl Acad Sci USA
83:
8059-8063
[Abstract/Free Full Text]
Mueller PR,
Wold B
(1989)
In vivo footprinting of a muscle specific enhancer by ligation mediated PCR.
Science
246:
780-786
[Abstract/Free Full Text]
Nover L
(1991)
Heat Shock Response.
CRC Press, Boca Raton, FL
Nover L,
Scharf KD,
Gagliardi D,
Vergne P,
Czarnecka-Verner E,
Gurley WB
(1996)
The HSF world: classification and properties of plant heat stress transcription factors.
Cell Stress Chaperones
1:
215-223
[CrossRef][Web of Science][Medline]
Olive MR,
Peacock WJ,
Dennis ES
(1991)
The anaerobic responsive element contains two GC-rich sequences essential for binding a nuclear protein and hypoxic activation of the maize Adh1 promoter.
Nucleic Acids Res
19:
7053-7060
[Abstract/Free Full Text]
Peleman J,
Boerjan W,
Engler G,
Seurinck J,
Botterman J,
Alliotte T,
Van Montagu M,
Inzé D
(1989)
Strong cellular preference in the expression of a housekeeping gene of Arabidopsis thaliana encoding S-adenosylmethionine synthetase.
Plant Cell
1:
81-93
[Abstract/Free Full Text]
Perisic O,
Xiao H,
Lis JT
(1989)
Stable binding of Drosophila heat shock factor to head-to-head and tail-to-tail repeats of a conserved 5 bp recognition unit.
Cell
59:
797-806
[CrossRef][Web of Science][Medline]
Pfeifer GP,
Steigerwald SD,
Mueller PR,
Wold B,
Riggs AD
(1989)
Genomic sequencing and methylation analysis by ligation mediated PCR.
Science
246:
810-815
[Abstract/Free Full Text]
Rao MV,
Paliyath G,
Ormrod DP
(1996)
Ultraviolet-B- and ozone-induced biochemical changes in antioxidant enzymes of Arabidopsis thaliana.
Plant Physiol
110:
125-136
[Abstract]
Sablowski RWM,
Moyano E,
Culianez-Macia FA,
Schuch W,
Martin C,
Bevan M
(1994)
A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes.
EMBO J
13:
128-137
[Web of Science][Medline]
Santos M,
Gousseau H,
Lister C,
Foyer C,
Creissen G,
Mullineaux P
(1996)
Cytosolic ascorbate peroxidase from Arabidopsis thaliana L. is encoded by a small multigene family.
Planta
198:
64-69
[Web of Science][Medline]
Scharf K-D,
Rose S,
Zott W,
Schöff F,
Nover L
(1990)
Three tomato genes code for heat stress transcription factors with a region of remarkable homology to the DNA-binding domain of the yeast HSF.
EMBO J
9:
4495-4501
[Web of Science][Medline]
Schindler U,
Cashmore AR
(1990)
Photoregulated gene expression may involve ubiquitous DNA binding proteins.
EMBO J
9:
3415-3427
[Web of Science][Medline]
Schöner S,
Krause GH
(1990)
Protective systems against active oxygen species in spinach: response to cold acclimation in excess light.
Planta
180:
383-389
[CrossRef]
Shirzadegan M,
Christie P,
Seemann JR
(1991)
An efficient method for isolation of RNA from tissue cultured plant cells.
Nucleic Acids Res
19:
6055
[Free Full Text]
Singh K,
Dennis ES,
Ellis JG,
Llewellyn DJ,
Tokuhisa JG,
Wahleithner JA,
Peacock WJ
(1990)
OCSBF-1, a maize ocs enhancer binding factor: isolation and expression during development.
Plant Cell
2:
891-903
[Abstract/Free Full Text]
Smirnoff N,
Colombé SV
(1988)
Drought influences the activity of enzymes of the chloroplast hydrogen peroxide scavenging system.
J Exp Bot
39:
1097-1108
[Abstract/Free Full Text]
Tanaka K,
Masuda R,
Sugimoto T,
Omasa K,
Sakaki T
(1990)
Water deficiency-induced changes in the contents of defensive substances against active oxygen in spinach leaves.
Agric Biol Chem
54:
2629-2634
Tanaka K,
Suda Y,
Kondo N,
Sugahara K
(1985)
O3 tolerance and the ascorbate-dependent hydrogen peroxide decomposing system in chloroplasts.
Plant Cell Physiol
26:
1425-1431
[Abstract/Free Full Text]
Thomsen B,
Drumm-Herrel H,
Mohr H
(1992)
Control of the appearance of ascorbate peroxidase (EC 1.11.1.11) in mustard seedling cotyledons by phytochrome and photooxidative treatments.
Planta
186:
600-608
Troutt AB,
McHeyzer-Williams MG,
Pulendran B,
Nossal GJV
(1992)
Ligation-anchored PCR: a simple amplification technique with single-sided specificity.
Proc Natl Acad Sci USA
89:
9823-9825
[Abstract/Free Full Text]
Valvekens D,
Van Montagu M,
Van Lijsebettens M
(1988)
Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection.
Proc Natl Acad Sci USA
85:
5536-5540
[Abstract/Free Full Text]
Vansuyt G,
Lopez F,
Inzé D,
Briat JF,
Fourcroy P
(1997)
Iron triggers a rapid induction of ascorbate peroxidase gene expression in Brassica napus.
FEBS Lett
410:
195-200
[CrossRef][Medline]
Wu C
(1995)
Heat shock transcription factors: structure and regulation.
Annu Rev Cell Dev Biol
11:
441-469
[CrossRef][Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
B. Steffens and M. Sauter
Epidermal Cell Death in Rice Is Confined to Cells with a Distinct Molecular Identity and Is Mediated by Ethylene and H2O2 through an Autoamplified Signal Pathway
PLANT CELL,
January 1, 2009;
21(1):
184 - 196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Muhlenbock, M. Plaszczyca, M. Plaszczyca, E. Mellerowicz, and S. Karpinski
Lysigenous Aerenchyma Formation in Arabidopsis Is Controlled by LESION SIMULATING DISEASE1
PLANT CELL,
November 1, 2007;
19(11):
3819 - 3830.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yamasaki, S. E. Abdel-Ghany, C. M. Cohu, Y. Kobayashi, T. Shikanai, and M. Pilon
Regulation of Copper Homeostasis by Micro-RNA in Arabidopsis
J. Biol. Chem.,
June 1, 2007;
282(22):
16369 - 16378.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Y. Yoo, K. Miura, J. B. Jin, J. Lee, H. C. Park, D. E. Salt, D.-J. Yun, R. A. Bressan, and P. M. Hasegawa
SIZ1 Small Ubiquitin-Like Modifier E3 Ligase Facilitates Basal Thermotolerance in Arabidopsis Independent of Salicylic Acid
Plant Physiology,
December 1, 2006;
142(4):
1548 - 1558.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. MILLER and R. MITTLER
Could Heat Shock Transcription Factors Function as Hydrogen Peroxide Sensors in Plants?
Ann. Bot.,
August 1, 2006;
98(2):
279 - 288.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kojo, T. Yaeno, K. Kusumi, H. Matsumura, S. Fujisawa, R. Terauchi, and K. Iba
Regulatory Mechanisms of ROI Generation are Affected by Rice spl Mutations
Plant Cell Physiol.,
August 1, 2006;
47(8):
1035 - 1044.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Davletova, L. Rizhsky, H. Liang, Z. Shengqiang, D. J. Oliver, J. Coutu, V. Shulaev, K. Schlauch, and R. Mittler
Cytosolic Ascorbate Peroxidase 1 Is a Central Component of the Reactive Oxygen Gene Network of Arabidopsis
PLANT CELL,
January 1, 2005;
17(1):
268 - 281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tsukamoto, S. Morita, E. Hirano, H. Yokoi, T. Masumura, and K. Tanaka
A Novel cis-Element That Is Responsive to Oxidative Stress Regulates Three Antioxidant Defense Genes in Rice
Plant Physiology,
January 1, 2005;
137(1):
317 - 327.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Panikulangara, G. Eggers-Schumacher, M. Wunderlich, H. Stransky, and F. Schoffl
Galactinol synthase1. A Novel Heat Shock Factor Target Gene Responsible for Heat-Induced Synthesis of Raffinose Family Oligosaccharides in Arabidopsis
Plant Physiology,
October 1, 2004;
136(2):
3148 - 3158.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Rizhsky, H. Liang, J. Shuman, V. Shulaev, S. Davletova, and R. Mittler
When Defense Pathways Collide. The Response of Arabidopsis to a Combination of Drought and Heat Stress
Plant Physiology,
April 1, 2004;
134(4):
1683 - 1696.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Fourcroy, G. Vansuyt, S. Kushnir, D. Inze, and J.-F. Briat
Iron-Regulated Expression of a Cytosolic Ascorbate Peroxidase Encoded by the APX1 Gene in Arabidopsis Seedlings
Plant Physiology,
February 1, 2004;
134(2):
605 - 613.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. G. L. op den Camp, D. Przybyla, C. Ochsenbein, C. Laloi, C. Kim, A. Danon, D. Wagner, E. Hideg, C. Gobel, I. Feussner, et al.
Rapid Induction of Distinct Stress Responses after the Release of Singlet Oxygen in Arabidopsis
PLANT CELL,
October 1, 2003;
15(10):
2320 - 2332.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. de Pinto, P. Lavermicocca, A. Evidente, M. M. Corsaro, S. Lazzaroni, and L. De Gara
Exopolysaccharides Produced by Plant Pathogenic Bacteria Affect Ascorbate Metabolism in Nicotiana tabacum
Plant Cell Physiol.,
August 15, 2003;
44(8):
803 - 810.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Rossel, I. W. Wilson, and B. J. Pogson
Global Changes in Gene Expression in Response to High Light in Arabidopsis
Plant Physiology,
November 1, 2002;
130(3):
1109 - 1120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Rizhsky, H. Liang, and R. Mittler
The Combined Effect of Drought Stress and Heat Shock on Gene Expression in Tobacco
Plant Physiology,
November 1, 2002;
130(3):
1143 - 1151.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. M. Pastori and C. H. Foyer
Common Components, Networks, and Pathways of Cross-Tolerance to Stress. The Central Role of "Redox" and Abscisic Acid-Mediated Controls
Plant Physiology,
June 1, 2002;
129(2):
460 - 468.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. I. Panchuk, R. A. Volkov, and F. Schoffl
Heat Stress- and Heat Shock Transcription Factor-Dependent Expression and Activity of Ascorbate Peroxidase in Arabidopsis
Plant Physiology,
June 1, 2002;
129(2):
838 - 853.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Vranova, D. Inze, and F. Van Breusegem
Signal transduction during oxidative stress
J. Exp. Bot.,
May 15, 2002;
53(372):
1227 - 1236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Shigeoka, T. Ishikawa, M. Tamoi, Y. Miyagawa, T. Takeda, Y. Yabuta, and K. Yoshimura
Regulation and function of ascorbate peroxidase isoenzymes
J. Exp. Bot.,
May 15, 2002;
53(372):
1305 - 1319.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Sato, T. Murakami, H. Funatsuki, S. Matsuba, H. Saruyama, and M. Tanida
Heat shock-mediated APX gene expression and protection against chilling injury in rice seedlings
J. Exp. Bot.,
January 1, 2001;
52(354):
145 - 151.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Yoshimura, Y. Yabuta, T. Ishikawa, and S. Shigeoka
Expression of Spinach Ascorbate Peroxidase Isoenzymes in Response to Oxidative Stresses
Plant Physiology,
May 1, 2000;
123(1):
223 - 234.
[Abstract]
[Full Text]
|
 |
|
|
|