| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
Plant Physiol. (1998) 118: 1049-1056 The Chemically Inducible Plant Cytochrome P450 CYP76B1 Actively Metabolizes Phenylureas and Other Xenobiotics1
Département d'Enzymologie Cellulaire et Moléculaire, Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique Unité Propre de Recherche 406, 28 rue Goethe, F-67000 Strasbourg, France (T.R., Y.B., F.C.-H., M.L., L.D., D.W.-R.); Institute of Cytology and Genetics, 630090 Novosibirsk-90, Russia (S.N.); and Laboratoire de Spectrométrie de Masse Bioorganique, Centre National de la Recherche Scientifique-Unité Mixte de Recherche 7509, 1 rue Blaise Pascal F-67000 Strasbourg, France (O.S.)
Cytochrome P450s (P450s) constitute one of the major classes of enzymes that are responsible for detoxification of exogenous molecules both in animals and plants. On the basis of its inducibility by exogenous chemicals, we recently isolated a new plant P450, CYP76B1, from Jerusalem artichoke (Helianthus tuberosus) and showed that it was capable of dealkylating a model xenobiotic compound, 7-ethoxycoumarin. In the present paper we show that CYP76B1 is more strongly induced by foreign compounds than other P450s isolated from the same plant, and metabolizes with high efficiency a wide range of xenobiotics, including alkoxycoumarins, alkoxyresorufins, and several herbicides of the class of phenylureas. CYP76B1 catalyzes the double N-dealkylation of phenylureas with turnover rates comparable to those reported for physiological substrates and produces nonphytotoxic compounds. Potential uses for CYP76B1 thus include control of herbicide tolerance and selectivity, as well as soil and groundwater bioremediation.
P450s constitute one of the largest and most extensively studied
classes of enzymes. This is mainly due to their critical role in the
detoxification or activation of drugs and dietary compounds in mammals
(Guengerich, 1995 Like their animal counterparts, plant P450s are highly inducible by
chemicals such as drugs or pesticides (Bolwell et al., 1994 Because our objective was to characterize plant P450s with high
xenobiotic-metabolizing capacities, we designed strategies aimed at the
isolation of the forms that are the most inducible by exogenous
chemicals. On the basis of Mn2+
and AP inducibility, we recently isolated two cDNAs encoding P450s from
Jerusalem artichoke (Helianthus tuberosus) (Batard et al.,
1998 Chemicals
Plant Material Jerusalem artichoke (Helianthus tuberosus L. var. Blanc commun) tubers were grown in an open field, harvested in November, and stored in plastic bags at 4°C in the dark. For aging experiments, tubers were sliced (1.5 mm thick), washed, and aged for 48 h in aerated (4 L min 1) distilled water containing
35 mM DMSO, 20 mM AP, 8 mM sodium PB, 25 mM MnCl2, 1.7 mM
Flav, 100 µM NA, or 260 µM
B(a)P. The MnCl2 solution was adjusted
to pH 7.0. Water-insoluble compounds (Flav, NA, and B(a)P)
were added to the aging medium dissolved in DMSO (0.25% of the total
volume).
RNA Isolation and RNA-Blot Hybridization Isolation of total RNA and RNA-blot hybridization was performed as described previously (Batard et al., 1998 ). The hybridization signal
was recorded and quantified with a phosphor imager (model BAS1000,
Fuji, Japan), using hybridization at 55°C to a 300-bp Capsicum
annuum 25S rRNA probe for standardization. The same membrane was
successively hybridized with the CYP81B1 (46% GC), CYP73A1 (47% GC),
CYP76B1 (43% GC), CYP81B1 (46% GC), and 25S rRNA probes (45 × 106 cpm in each case), respectively. It was
stripped by boiling in 0.1% SSC between successive hybridizations.
Slot-blot analysis was performed in the same conditions using 10 µg
of total RNA in each slot.
Expression in Yeast The BamHI and EcoRI sites were introduced by PCR just upstream of the ATG and downstream of the stop codon of the CYP76B1 coding sequence using the primers 5 -ATATATGGATCCATGGATTTTCTTATAATAGTGAGTAC (sense) and
5-TATATAGAATTCATGCTAGTTCAATGGTATTGGAACAACAC (reverse). The PCR mixture
was preheated for 2 min at 92°C before addition of 1 unit of
Pfu DNA polymerase (Stratagene). After 3 min of additional heating at 92°C, 30 cycles of amplification were carried out as follows: 1 min of denaturation at 92°C, 1 min of annealing at 52°C,
and 2 min of extension at 72°C. The reaction was completed by 10 min
of extension at 72°C. After BamHI/EcoRI
digestion, the 1470-bp coding sequence was inserted into the vector
pYeDP60 (Pompon et al., 1996). Transformation of the yeast
Saccharomyces cerevisiae W(R), WAT11 and WAT21, and yeast
growth were performed according to the method of Pompon et al. (1996).
When indicated, 0.5 mM  -aminolevulinic acid methyl ester
(Sigma) was added to the induction medium, or cells were stored at
4°C for 24 h before preparation of the microsomes. Yeast
microsomes were prepared as described in Batard et al. (1998).
Production of Antibodies and Western-Blot Analysis CYP76B1 4-His-tagged at the C terminus was generated by PCR modification of its coding sequence using the reverse primer 5-TATATAGAATTCATGCTAATGATGATGATGGTTCAATGGTATTGGAACAACAC with sense
primer and PCR conditions as above. The modified protein was
expressed in yeast using the same procedure as for the wild type.
Microsomes were solubilized in 2% Triton X-114 followed by phase
partitioning as described previously (Gabriac et al., 1991). The
protein was purified on a Ni2+-loaded chelating
column (HiTrap, Pharmacia Biotech) using the procedure recommended by
the manufacturer, with elution in sodium phosphate 50 mM,
pH 7.4, containing 0.5 M NaCl and 1 M
imidazole. Polyclonal antibodies were raised in rabbits by successive
injections of one time with 16 µg and five times with 8 µg of
purified protein emulsified in Freund's complete and incomplete
adjuvants, respectively, and used for western-blot analysis as in
Werck-Reichhart et al. (1993).
Enzyme Assays 7-Alkoxycoumarins and 7-alkoxyresorufins O-dealkylation were measured by fluorometry (Werck-Reichhart et al., 1990). The conversion of other molecules was
assayed by TLC or HPLC analysis of polar metabolites formed from
radiolabeled compounds (Cabello-Hurtado et al., 1998a, 1998b).
NADPH-Cyt c reductase was assayed according to the
method of Benveniste et al. (1986). Kinetic data were fitted using the
nonlinear regression program DNRPEASY (Duggleby, 1984).
Analytical Methods Liquid chromatography-MS was performed by coupling a HPLC system (model 140A, Perkin Elmer) on a VG BioQ triple quadrupole. The separation on a reverse-phase column (300-5 C18 2 × 125 mm, Macherey-Nagel, Duren, Germany) was flow spliced via a stainless steel tee with approximately 1/15 of column effluent directed toward the mass spectrometer, 14/15 directed toward the UV detector (model 496, Waters). The mass spectra were obtained by scanning from m/z 300 1800 in 6 s with a cone voltage of 50 V.
CYP76B1 Is More Strongly Induced by Xenobiotics than Other P450s Isolation of the CYP76B1 cDNA, based on PCR amplification of a conserved P450 region from a library of AP-treated Jerusalem artichoke tuber tissues, and subsequent selection of AP-induced P450 cDNAs, has been described previously (Batard et al., 1998). Two other P450 cDNAs were also isolated from Jerusalem
artichoke: cinnamate 4-hydroxylase CYP73A1 (Teutsch et al.,
1993) and fatty acid in-chain hydroxylase CYP81B1 (Cabello-Hurtado et
al., 1998a). Increased accumulation of all three of the P450 mRNAs was
detected following treatment of tuber tissues with xenobiotics.
However, successive hybridizations of CYP76B1,
CYP73A1, and CYP81B1 probes with the same RNA gel
blot prepared with tuber tissues treated with different chemicals
(DMSO, MnCl2, AP, PB, Flav, NA, and
B(a)P) indicated that by far the highest increase in the
steady-state level of P450 transcripts was achieved in the case of
CYP76B1 (Fig. 1). Similar
results were obtained by parallel slot-blot hybridization analysis of
the same set of total RNA. Tuber tissues treated with chemicals, in
particular Mn2+ and AP, accumulated 2- to 6-fold
more transcripts coding for CYP76B1 than for CYP73A1 or CYP81B1.
Optimized Expression of CYP76B1 in Yeast The CYP76B1 coding sequence was expressed in three engineered yeast strains, W(R), WAT11, and WAT21, which also expressed yeast or Arabidopsis P450 reductases ATR1 and ATR2, respectively, under the transcriptional control of the same Gal-inducible promoter GAL10-CYC1 (Urban et al., 1997). The levels of expression of
CYP76B1 were compared in the different yeast strains after 12, 16, 24, and 36 h of induction with Gal, or continuously grown in the
presence of Gal. Highest expression was obtained using the WAT11 strain continuously grown in the presence of Gal, reaching 157 pmol
mg1 microsomal protein (0.86% of microsomal
protein). Contrary to CYP81B1 (Cabello-Hurtado et al., 1998a), CYP76B1
was expressed at a significant level in the presence of yeast
reductase, but its expression was consistently 15% to 40% lower in
WAT21 or W(R) than in WAT11 (Fig. 2).
Expression did not increase when -aminolevulinic acid was added to
the growth medium, and significantly decreased when cells were grown at
25°C or stored for 24 h at 4°C before extraction.
CYP76B1 Metabolizes Several Classes of Exogenous Molecules CYP76B1 was previously reported to dealkylate 7-ethoxycoumarin (Batard et al., 1998). After optimized expression in yeast, its
metabolic capacity was more thoroughly investigated. Using transformed
WAT11 yeast microsomes, we first assayed for possible metabolism of a
number of endogenous molecules known or suspected to be substrates of
P450 oxygenases from Jerusalem artichoke tuber tissues. No metabolites
were formed from phenolics (cinnamate, benzoate, ferulate, naringenin,
scopoletin, and isoscopoletin), isoprenoids (geraniol, ABA, and
obtusifoliol), or fatty acids (capric, lauric, myristic, palmitic,
oleic, linoleic, and linolenic acids). We then tested different classes
of foreign compounds, including molecules previously shown to be
metabolized by the plant-tuber microsomes (Higashi et al., 1981;
Fonné, 1985; Fonné-Pfister et al., 1988;
Werck-Reichhart et al., 1990; Batard et al., 1995): B(a)P
and the drug AP, fluorescent alkoxycoumarins (7-methoxycoumarin, 7-propoxycoumarin, and 7-butoxycoumarin) and alkoxyphenoxazones (7-methoxy-resorufin, 7-ethoxyresorufin, 7-pentoxyresorufin, and 7-benzyloxyresorufin), and representative members of different classes
of herbicides (2,4-D, diclofop, chlorsulfuron, bentazon, dicamba,
chlortoluron, and isoproturon). In addition to 7-ethoxycoumarin, five
xenobiotics were actively converted into more polar metabolites (Table I). No metabolism was detected in
the absence of NADPH or in control microsomes prepared from yeast
transformed with a void plasmid.
Characterization of the Phenylurea Metabolites Microsomes from AP-treated Jerusalsem artichoke tuber, when incubated with NADPH and chlortoluron, produce principally mono- and di-N-dealkylated metabolites and minor amounts of the ring-methyl hydroxylated compound (Fonné, 1985). It
was unclear whether these different metabolites were generated by a
single or several P450 enzymes. The products of CYP76B1-dependent
metabolism of chlortoluron and isoproturon were thus extensively
characterized. Both TLC and HPLC analysis of the metabolites, including
cochromatography with reference standards (not shown), suggested a
sequential conversion of the herbicide to mono- and di-dealkylated
derivatives. This was further confirmed by liquid
chromatography-MS analysis (Fig. 3). For both chlortoluron and
isoproturon, time-dependent and sequential formation of m/z
14 and 28 molecular ions was observed. To confirm the capacity of
CYP76B1 to catalyze the double dealkylation of chlortoluron, the
mono-demethylated derivative was purified by TLC from large-scale
incubations of transformed yeast microsomes with NADPH and
14C-chlortoluron. In the absence of chlortoluron,
its mono-N-demethylated derivative was actively dealkylated
by CYP76B1.
Catalytic Parameters of the CYP76B1-Dependent Reactions Methoxy- and ethoxyresorufins were the best substrates of CYP76B1, with very high kcat/Km of 237 and 165 min1
µM1, respectively, in microsomes
from the WAT11 yeast strain (Table II).
The second-best substrate was chlortoluron, the first dealkylation proceeding significantly faster than the second. The first
demethylation of isoproturon was slower than that of chlortoluron.
7-Ethoxycoumarin and 7-methoxycoumarin turned out to be the poorest
substrates of CYP76B1. In terms of turnover number, phenyl-ureas
were the fastest metabolized substrates of CYP76B1
(kcat of 803 and 147 min1 for the first demethylation of
chlortoluron and isoproturon, respectively), the second
demethylation (kcat = 46 min1 for monodemethyl-chlortoluron) being the
rate-limiting step for total detoxification of the herbicides.
Influence of the P450 Reductases on CYP76B1 Activity Preliminary results (Table I) indicated that the differences in catalytic activity were larger than the differences in P450 expression in the three yeast strains. Accordingly, the catalytic parameters of xenobiotic metabolism were determined with CYP76B1 expressed in both W(R) and WAT11 microsomes (Table II). The nature of the coexpressed reductase did not influence the Km of the reactions to any great extent, although Km measured in the presence of the Arabidopsis reductase ATR1 were consistently lower than those determined in presence of yeast reductase. However, large changes in kcat were observed depending on the origin of the coexpressed reductase. The maximum velocities of oxygenation of all six substrates were about 3 times higher in the presence of ATR1. Catalytic parameters were also measured in the presence of the other Arabidopsis reductase ATR2 with methoxyresorufin as the substrate. They were not significantly different (Km = 0.185 µM; kcat = 43 min1)
from those determined with microsomes from WAT11.
Other Phenylurea Herbicides Metabolism of both chlortoluron and isoproturon suggests that other herbicides of the class of phenylureas could be substrates as well. Therefore, we tested the binding of a set of related molecules in the active site of CYP76B1. The binding of substrates into the catalytic site of a P450 usually induces a shift of the absorption maximum, redox potential, and iron spin state (Raag and Poulos, 1989),
resulting from the displacement of the water molecule that serves as
the sixth ligand of the heme iron. Substrate binding is easily detected
by difference spectroscopy, resulting in the formation of a so-called
type I spectrum with a maximum at 390 nm and a trough at 420 nm
(Jefcoate, 1978). The variation of the difference absorbance
 A390-420 versus substrate concentration
allows the calculation of an apparent dissociation constant
(KS). A high
Amax induced by the ligand is usually an indication of correct ligand positioning for catalysis. Therefore, the
high Amax induced by the binding of the
molecules in Table III suggests that a
similar positioning of the dimethylurea function close to heme iron and
favorable to catalysis is maintained for many phenyl-ureas.
Affinity for the active site seems to be largely governed by the
substituents on the phenyl ring, the presence of ring-deactivating
halogens being more favorable than methyl or other potentially
activating substituents. Replacement of one of the N-methyls
by a hydroxymethyl group also seems to favor the binding of the
molecules in the active site of CYP76B1.
Oxidative N-demethylation of phenylureas, described by
Frear and coworkers as early as 1969, together with kaurene
hydroxylase, were the two first P450-dependent reactions characterized
in higher plants. This pioneer work supported the idea that several
phenylurea derivatives might be substrates of the same P450 enzyme, and
that this P450 might be able to carry out the double dealkylation
of the molecules. The involvement of P450 in the
Ndemethylation of chlortoluron was first demonstrated
using microsomes from Jerusalem artichoke tuber treated with PB
(Fonné, 1985
Received May 28, 1998;
accepted July 27, 1998.
Abbreviations:
AP, aminopyrine.
B(a)P, benzo(a)pyrene.
CTUDM, chlortoluron demethylase.
ECOD, 7-ethoxycoumarin O-deethylase.
EROD, 7-ethoxyresorufin O-deethylase.
Flav, flavone.
IPUDM, isoproturon demethylase.
MCOD, 7-methoxycoumarin
O-deethylase.
MROD, 7-methoxyresorufin
O-deethylase.
NA, naphthalic anhydride.
P450, Cyt P450.
PB, phenobarbital.
We would like to thank Drs. D. Pompon and P. Urban for providing
the W(R), WAT11, and WAT21 yeast strains and the pYeDP60 expression
vector. We would also like to thank M.F. Castaldi for her technical
assistance and R. Kahn for the linguistic improvement of the
manuscript.
Barrett M
(1995)
Metabolism of herbicides by cytochrome P450 in corn.
Drug Metab Drug Interact
12:
299-315
[Medline]
Batard Y,
LeRet M,
Schalk M,
Zimmerlin A,
Durst F,
Werck-Reichhart D
(1998)
Plant J
14:
111-120
[CrossRef][Medline]
Batard Y,
Schalk M,
Pierrel MA,
Zimmerlin A,
Durst F,
Werck-Reichhart D
(1997)
Regulation of the cinnamate 4-hydroxylase (CYP73A1) in Jerusalem artichoke tubers in response to wounding and chemical treatments.
Plant Physiol
113:
951-959
[Abstract]
Batard Y,
Zimmerlin A,
Le Ret M,
Durst F,
Werck-Reichhart D
(1995)
Multiple xenobiotic-inducible P450s are involved in alkoxycoumarins and alkoxyresorufins metabolism in higher plants.
Plant Cell Environ
18:
523-533
[CrossRef]
Benveniste I,
Gabriac B,
Durst F
(1986)
Purification and characterization of the NADPH-cytochrome P450 (cytochrome c) reductase from higher-plant microsomal fraction.
Biochem J
235:
365-373
[Medline]
Bolwell GP,
Bozac K,
Zimmerlin A
(1994)
Plant cytochrome P450.
Phytochemistry
37:
1491-1506
[CrossRef][ISI][Medline]
Cabello-Hurtado F,
Batard Y,
Salaün J,
P,
Durst F,
Pinot F,
Werck-Reichhart D
(1998a)
Cloning, expression in yeast and functional characterization of CYP81B1, a plant P450 which catalyzes in-chain hydroxylation of fatty acids.
J Biol Chem
273:
7260-7267
Cabello-Hurtado F, Durst F, Jorrin JV, Werck-Reichhart D (1998b)
Coumarins in Helianthus tuberosus: characterization, induced
accumulation and biosynthesis. Phytochemistry (in press)
Duggleby RG
(1984)
Regression analysis of nonlinear Arrhenius plots: an empirical model and a computer program.
Comput Biol Med
14:
447-455
[CrossRef][Medline]
Fonné R (1985) Intervention du cytochrome P450 des
végétaux supérieurs dans l'oxydation de
composés exogènes: l'aminopyrine et le chlortoluron. PhD
thesis. Université Louis Pasteur, Strasbourg, France
Fonné-Pfister R,
Kreuz K
(1990)
Ring-methyl hydroxylation of chlortoluron by an inducible cytochrome P450-dependent enzyme from maize.
Phytochemistry
9:
2793-2796
[CrossRef]
Fonné-Pfister R,
Simon A,
Salaün JP,
Durst F
(1988)
Xenobiotic metabolism in higher plants: involvement of microsomal cytochrome P450 in aminopyrine N-demethylation.
Plant Sci
55:
9-20
[CrossRef]
Frear DS
(1995)
Wheat microsomal cytochrome P450 monooxygenases: characterization and importance in the metabolic detoxification and selectivity of wheat herbicides.
Drug Metab Drug Interact
12:
329-357
[Medline]
Frear DS,
Swanson HR,
Tanaka FS
(1969)
N-demethylation of substituted 3-(phenyl)-1-methylureas: isolation and characterization of a microsomal mixed function oxidase from cotton.
Phytochemistry
8:
2157-2169
[CrossRef]
Frear DS,
Swanson HR,
Thalacker FW
(1991)
Induced microsomal oxidation of diclofop, triasulfuron, chlorsulfuron and linuron in wheat.
Pestic Biochem Physiol
41:
274-287
Gabriac B,
Werck-Reichhart D,
Teutsch GH,
Durst F
(1991)
Purification and immunocharacterization of a plant cytochrome P450: the cinnamic acid 4-hydroxylase.
Arch Biochem Biophys
288:
302-309
[CrossRef][Medline]
Guengerich FP (1995) Human cytochromes P450 enzymes. In
PR Ortiz de Montellano, ed, Cytochrome P450: Structure, Mechanism, and
Biochemistry, 2nd Ed. Plenum Press, New York, pp 367-390
Higashi K,
Nakashima K,
Karasaki Y,
Fukunaga M,
Mizuguchi Y
(1981)
Activation of benzo(a)pyrene by microsomes of higher plant tissues and their mutagenesis.
Biochem Internat
2:
373-380
Holton T,
Brugliera F,
Lester DR,
Tanaka Y,
Hyland CD,
Menting JGT,
Lu CY,
Farcy E,
Srevenson TW,
Cornish EC
(1993)
Cloning and expression of cytochrome P450 genes controlling flower colour.
Nature
366:
276-279
[CrossRef][Medline]
Jefcoate CR
(1978)
Measurement of substrate and inhibitor binding to microsomal cytochrome P450 by optical-difference spectroscopy.
Methods Enzymol
52:
258-279
[Medline]
Mehmoud Z, Kelly DE, Kelly SL (1995) Metabolism of the herbicide
chlortoluron by human cytochrome P4503A4. Chemosphere
11/12: 4515-4529
Moreland DE,
Corbin FT,
Fleischmann TJ,
McFarland JE
(1995)
Partial characterization of microsomes isolated from mung bean cotyledons.
Pest Biochem Physiol
52:
98-108
[CrossRef]
Mougin C,
Cabanne F,
Canivenc MC,
Scalla R
(1990)
Hydroxylation and N-demethylation of chlortoluron by wheat microsomal enzymes.
Plant Sci
66:
195-203
[CrossRef]
Persan MW,
Schuler MA
(1995)
Differential induction of cytochrome P450-mediated triasulfuron metabolism by naphthalic anhydride and triasulfuron.
Plant Physiol
109:
1483-1490
[Abstract]
Pierrel MA,
Batard Y,
Kazmaier M,
Mignotte-Vieux C,
Durst F,
Werck-Reichhart D
(1994)
Catalytic properties of the plant cytochrome P450 CYP73 expressed in yeast: substrate specificity of a cinnamate hydroxylase.
Eur J Biochem
224:
835-844
[Medline]
Pompon D,
Louerat B,
Bronine A,
Urban P
(1996)
Yeast expression of animal and plant P450s in optimized redox environment.
Methods Enzymol
272:
51-64
[CrossRef][ISI][Medline]
Potter S,
Moreland DE,
Kreuz K,
Ward E
(1995)
Induction of cytochrome P450 genes by ethanol in maize.
Drug Metab Drug Interact
12:
317-327
[Medline]
Raag R,
Poulos TL
(1989)
The structural basis for substrate-induced changes in redox potential and spin equilibrium in cytochrome P450CAM.
Biochemistry
28:
917-922
[CrossRef][Medline]
Ryan PJ,
Gross D,
Owen WJ,
Laanio TL
(1981)
The metabolism of chlortoluron, diuron, and CGA 43057 in tolerant and susceptible plants.
Pestic Biochem Physiol
16:
213-221
Ryan PJ, Owen WJ (1982) The mechanism of selectivity of
chlortoluron between cereals and grassweeds. Proc Br Crop Prot
Conf-Weeds 317-323
Sandermann H Jr
(1994)
Higher plant metabolism of xenobiotics: the "green liver" concept.
Pharmacogenetics
4:
225-241
[CrossRef][Medline]
Schopfer CR,
Ebel J
(1998)
Isolation of elicitor-inducible cytochrome P450s of soybean (Glycine max L.) using differential display of mRNA.
Mol Gen Genet
258:
315-322
[CrossRef][Medline]
Schuler MA
(1996)
Rev Plant Sci
15:
235-284
Shiota N,
Nagasawa A,
Sakaki T,
Yabusaki Y,
Ohkawa H
(1994)
Herbicide-resistant plants expressing the fused enzyme between rat cytochrome P4501A1 (CYP1A1) and yeast NADPH-cytochrome P450 reductase.
Plant Physiol
106:
17-23
[Abstract]
Teutsch GH,
Hasenfratz MP,
Lesot A,
Stoltz C,
Garnier JM,
Jeltsch JM,
Durst F,
Werck-Reichhart D
(1993)
Isolation and sequence of a cDNA encoding the Jerusalem artichoke cinnamate hydroxylase, a major plant cytochrome P450 involved in the general phenylpropanoid pathway.
Proc Natl Acad Sci USA
90:
4102-4106
Toguri T,
Kobayashi O,
Umemoto N
(1993)
The cloning of eggplant seedling cDNA encoding proteins from a novel cytochrome P450 family (CYP76).
Biochim Biophys Acta
1216:
165-169
[Medline]
Urban P,
Mignotte C,
Kazmaier M,
Delorme F,
Pompon D
(1997)
Cloning, yeast expression, and characterization of the coupling of two distantly related Arabidopsis thaliana NADPH-cytochrome P450 reductases with P450 CYP73A5.
J Biol Chem
272:
19176-19186
Waxman DJ, Chang TKH (1995) Hormonal regulation of liver
cytochrome P450 enzymes. In PR Ortiz de Montellano, ed,
Cytochrome P450: Structure, Mechanism, and Biochemistry, 2nd Ed. Plenum
Press, New York, pp 391-417
Werck-Reichhart D
(1995)
Herbicide metabolism and selectivity: role of cytochrome P450.
Proc Br Crop Prot Conf-Weeds
3:
813-822
Werck-Reichhart D,
Batard Y,
Kochs G,
Lesot A,
Durst F
(1993)
Monospecific polyclonal antibodies directed against purified cinnamate 4-hydroxylase from Helianthus tuberosus: immunopurification, immunoquantitation, interspecies cross-reactivity.
Plant Physiol
102:
1291-1298
[Abstract]
Werck-Reichhart D,
Gabriac B,
Teutsch H,
Durst F
(1990)
Two cytochrome P450 isoforms catalyzing O-dealkylation of ethoxycoumarin and ethoxyresorufin in higher plants.
Biochem J
270:
729-735
[Medline]
Whitlock JP, Denison MS (1995) Induction of cytochrome P450
enzymes that metabolize xenobiotics. In PR Ortiz de
Montellano, ed, Cytochrome P450: Structure, Mechanism, and
Biochemistry, 2nd Ed. Plenum Press, New York, pp 367-390
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY | THE PLANT CELL | |
|---|---|---|---|
Top
Abstract
Introduction
