|
Plant Physiol. (1998) 118: 1049-1056
The Chemically Inducible Plant Cytochrome P450 CYP76B1 Actively
Metabolizes Phenylureas and Other Xenobiotics1
Tiburce Robineau,
Yannick Batard,
Svetlana Nedelkina,
Francisco Cabello-Hurtado,
Monique LeRet,
Odile Sorokine,
Luc Didierjean, and
Danièle Werck-Reichhart*
Département d'Enzymologie Cellulaire et Moléculaire,
Institut de Biologie Moléculaire des Plantes, Centre National de
la Recherche Scientifique Unité Propre de Recherche 406, 28 rue Goethe, F-67000 Strasbourg, France (T.R., Y.B., F.C.-H., M.L.,
L.D., D.W.-R.); Institute of Cytology and Genetics, 630090 Novosibirsk-90, Russia (S.N.); and Laboratoire de Spectrométrie
de Masse Bioorganique, Centre National de la Recherche
Scientifique-Unité Mixte de Recherche 7509, 1 rue Blaise Pascal
F-67000 Strasbourg, France (O.S.)
 |
ABSTRACT |
Cytochrome P450s (P450s) constitute
one of the major classes of enzymes that are responsible for
detoxification of exogenous molecules both in animals and plants. On
the basis of its inducibility by exogenous chemicals, we recently
isolated a new plant P450, CYP76B1, from Jerusalem artichoke
(Helianthus tuberosus) and showed that it was capable of
dealkylating a model xenobiotic compound, 7-ethoxycoumarin. In the
present paper we show that CYP76B1 is more strongly induced by foreign
compounds than other P450s isolated from the same plant, and
metabolizes with high efficiency a wide range of xenobiotics, including
alkoxycoumarins, alkoxyresorufins, and several herbicides of the class
of phenylureas. CYP76B1 catalyzes the double
N-dealkylation of phenylureas with turnover rates
comparable to those reported for physiological substrates and produces
nonphytotoxic compounds. Potential uses for CYP76B1 thus include
control of herbicide tolerance and selectivity, as well as soil and
groundwater bioremediation.
 |
INTRODUCTION |
P450s constitute one of the largest and most extensively studied
classes of enzymes. This is mainly due to their critical role in the
detoxification or activation of drugs and dietary compounds in mammals
(Guengerich, 1995 ). In plants the function of P450 hemoproteins in the
biosynthesis of hormones, lipids, and secondary compounds is better
documented than their role in the detoxification of exogenous chemicals
(Schuler, 1996 ). Nevertheless, they represent a potentially significant
metabolic sink for environmental contaminants (Sandermann, 1994 ), which
can be used for controlling herbicide tolerance and selectivity
(Werck-Reichhart, 1995 ), and could constitute a valuable potential for
bioremediation (i.e. the removal of toxic and persistent organic
compounds from industrial waste).
Like their animal counterparts, plant P450s are highly inducible by
chemicals such as drugs or pesticides (Bolwell et al., 1994 ; Schuler,
1996 ). Some of them respond more strongly than others to chemical
signals (Batard et al., 1995 , 1997 ; Moreland et al., 1995 ; Potter et
al., 1995 ). In animals the P450 isozymes having high
xenobiotic-metabolizing capacity are usually more responsive to
environmental chemical stimuli than those controlling the status of
important endocrine regulatory factors, the expression of the latter
being rather down-regulated by foreign chemicals (Waxman and Chang,
1995 ; Whitlock and Denison, 1995 ). In plants the activity of P450s
metabolizing xenobiotics such as alkoxycoumarins or herbicides is
usually strongly increased by treatments with exogenous chemicals
(Barret, 1995; Batard et al., 1995 ; Frear, 1995 ; Persan and Schuler,
1995 ; Potter et al., 1995 ), whereas P450s with basic physiological
functions, the best documented being cinnamate 4-hydroxylase, seem less
responsive to such treatments (Moreland et al., 1995 ; Batard et al.,
1997 ).
Because our objective was to characterize plant P450s with high
xenobiotic-metabolizing capacities, we designed strategies aimed at the
isolation of the forms that are the most inducible by exogenous
chemicals. On the basis of Mn2+
and AP inducibility, we recently isolated two cDNAs encoding P450s from
Jerusalem artichoke (Helianthus tuberosus) (Batard et al.,
1998 ; Cabello-Hurtado et al., 1998a ). One of them, CYP76B1, actively
dealkylates the model xenobiotic compound 7-ethoxy-coumarin after
expression in yeast (Batard et al., 1998 ). The other, CYP81B1, is a
fatty acid in-chain hydroxylase (Cabello-Hurtado et al., 1998a ). In
this paper we show that CYP76B1 is the most inducible of the P450s that
have been isolated from this plant, and that it metabolizes with high
turnover rates a wide range of xenobiotics, including herbicides of the
class of phenylureas. Phenylureas are twice dealkylated by the enzyme
and thereby converted into nonphytotoxic compounds. To our knowledge,
CYP76B1 is the first example of a plant P450 metabolizing with
high-efficiency herbicides and structurally diverse exogenous
compounds. Our data thus validate a possible strategy for the isolation
of the most effective detoxifying plant P450
enzymes.
 |
MATERIALS AND METHODS |
Chemicals
AP was from Merck; benzoic acid, salicylic acid, umbelliferone,
and 7-ethoxycoumarin were from Sigma. Other coumarin derivatives were
gifts from Dr. J.L. Rivière (Ecole Vétérinaire, Lyon, France). Resorufin derivatives were from Pierce.
Synthesis of [14C]ferulic acid, isoscopoletin,
and scopoletin was described by Cabello-Hurtado et al. (1998b) .
[3-14C]trans-Cinnamic acid was from
Isotopchim (Ganagobie, France), [1-14C]lauric acid was from Commissariat
à l'Energie Atomique (Gif-sur-Yvette, France), and
[1-14C]-capric acid and
[phenyl-U-14C]2,4-D were from Sigma.
[7-14C]Benzoic acid,
[1-14C]myristic acid,
[1-14C]palmitic acid,
[1-14C]stearic acid,
[1-14C]oleic acid, and
[1-14C]linoleic acid were from DuPont.
[14C]Geraniol and
[14C]-S-naringenin were kindly provided by Dr.
D. Hallahan (IACR, Rothamsted, UK) and Dr. G. Kochs (Institut
für Biologie II, Freiburg, Germany), respectively.
[Dichlorophenyl-U-14C]diclofop was kindly provided
by Hoechst (Frankfurt, Germany), [triazine-2-14C]chlorsulfuron by DuPont, and
[phenyl-U-14C]bentazon by BASF (Ludwigshafen,
Germany). [PhenylU-14C]chlortoluron, [phenyl-U-14C]isoproturon,
[triazine-U-14C]simazine, and reference metabolites were
generous gifts from Novartis (Basel, Swizerland).
Plant Material
Jerusalem artichoke (Helianthus tuberosus L. var. Blanc
commun) tubers were grown in an open field, harvested in November, and
stored in plastic bags at 4°C in the dark. For aging experiments, tubers were sliced (1.5 mm thick), washed, and aged for 48 h in aerated (4 L min 1) distilled water containing
35 mM DMSO, 20 mM AP, 8 mM sodium PB, 25 mM MnCl2, 1.7 mM
Flav, 100 µM NA, or 260 µM
B(a)P. The MnCl2 solution was adjusted
to pH 7.0. Water-insoluble compounds (Flav, NA, and B(a)P)
were added to the aging medium dissolved in DMSO (0.25% of the total
volume).
RNA Isolation and RNA-Blot Hybridization
Isolation of total RNA and RNA-blot hybridization was performed as
described previously (Batard et al., 1998 ). The hybridization signal
was recorded and quantified with a phosphor imager (model BAS1000,
Fuji, Japan), using hybridization at 55°C to a 300-bp Capsicum
annuum 25S rRNA probe for standardization. The same membrane was
successively hybridized with the CYP81B1 (46% GC), CYP73A1 (47% GC),
CYP76B1 (43% GC), CYP81B1 (46% GC), and 25S rRNA probes (45 × 106 cpm in each case), respectively. It was
stripped by boiling in 0.1% SSC between successive hybridizations.
Slot-blot analysis was performed in the same conditions using 10 µg
of total RNA in each slot.
Expression in Yeast
The BamHI and EcoRI sites were introduced by
PCR just upstream of the ATG and downstream of the stop
codon of the CYP76B1 coding sequence using the primers
5 -ATATATGGATCCATGGATTTTCTTATAATAGTGAGTAC (sense) and
5 -TATATAGAATTCATGCTAGTTCAATGGTATTGGAACAACAC (reverse). The PCR mixture
was preheated for 2 min at 92°C before addition of 1 unit of
Pfu DNA polymerase (Stratagene). After 3 min of additional heating at 92°C, 30 cycles of amplification were carried out as follows: 1 min of denaturation at 92°C, 1 min of annealing at 52°C,
and 2 min of extension at 72°C. The reaction was completed by 10 min
of extension at 72°C. After BamHI/EcoRI
digestion, the 1470-bp coding sequence was inserted into the vector
pYeDP60 (Pompon et al., 1996 ). Transformation of the yeast
Saccharomyces cerevisiae W(R), WAT11 and WAT21, and yeast
growth were performed according to the method of Pompon et al. (1996) .
When indicated, 0.5 mM -aminolevulinic acid methyl ester
(Sigma) was added to the induction medium, or cells were stored at
4°C for 24 h before preparation of the microsomes. Yeast
microsomes were prepared as described in Batard et al. (1998) .
Production of Antibodies and Western-Blot Analysis
CYP76B1 4-His-tagged at the C terminus was generated
by PCR modification of its coding sequence using the
reverse primer
5 -TATATAGAATTCATGCTAATGATGATGATGGTTCAATGGTATTGGAACAACAC with sense
primer and PCR conditions as above. The modified protein was
expressed in yeast using the same procedure as for the wild type.
Microsomes were solubilized in 2% Triton X-114 followed by phase
partitioning as described previously (Gabriac et al., 1991 ). The
protein was purified on a Ni2+-loaded chelating
column (HiTrap, Pharmacia Biotech) using the procedure recommended by
the manufacturer, with elution in sodium phosphate 50 mM,
pH 7.4, containing 0.5 M NaCl and 1 M
imidazole. Polyclonal antibodies were raised in rabbits by successive
injections of one time with 16 µg and five times with 8 µg of
purified protein emulsified in Freund's complete and incomplete
adjuvants, respectively, and used for western-blot analysis as in
Werck-Reichhart et al. (1993) .
Enzyme Assays
7-Alkoxycoumarins and 7-alkoxyresorufins
O-dealkylation were measured by fluorometry
(Werck-Reichhart et al., 1990 ). The conversion of other molecules was
assayed by TLC or HPLC analysis of polar metabolites formed from
radiolabeled compounds (Cabello-Hurtado et al., 1998a , 1998b ).
NADPH-Cyt c reductase was assayed according to the
method of Benveniste et al. (1986) . Kinetic data were fitted using the
nonlinear regression program DNRPEASY (Duggleby, 1984 ).
Analytical Methods
Liquid chromatography-MS was performed by coupling a HPLC
system (model 140A, Perkin Elmer) on a VG BioQ triple quadrupole. The
separation on a reverse-phase column (300-5 C18 2 × 125 mm, Macherey-Nagel, Duren, Germany) was flow spliced via a stainless steel tee with approximately 1/15 of column effluent directed toward
the mass spectrometer, 14/15 directed toward the UV detector (model
496, Waters). The mass spectra were obtained by scanning from
m/z 300 1800 in 6 s with a cone voltage of 50 V.
Spectrophotometric measurements of P450 content and substrate binding
were performed as in Gabriac et al. (1991) . Protein was quantified
using the Bio-Rad protein assay.
 |
RESULTS |
CYP76B1 Is More Strongly Induced by Xenobiotics than Other P450s
Isolation of the CYP76B1 cDNA, based on PCR
amplification of a conserved P450 region from a library of AP-treated
Jerusalem artichoke tuber tissues, and subsequent selection of
AP-induced P450 cDNAs, has been described previously (Batard et al.,
1998 ). Two other P450 cDNAs were also isolated from Jerusalem
artichoke: cinnamate 4-hydroxylase CYP73A1 (Teutsch et al.,
1993 ) and fatty acid in-chain hydroxylase CYP81B1 (Cabello-Hurtado et
al., 1998a ). Increased accumulation of all three of the P450 mRNAs was
detected following treatment of tuber tissues with xenobiotics.
However, successive hybridizations of CYP76B1,
CYP73A1, and CYP81B1 probes with the same RNA gel
blot prepared with tuber tissues treated with different chemicals
(DMSO, MnCl2, AP, PB, Flav, NA, and
B(a)P) indicated that by far the highest increase in the
steady-state level of P450 transcripts was achieved in the case of
CYP76B1 (Fig. 1). Similar
results were obtained by parallel slot-blot hybridization analysis of
the same set of total RNA. Tuber tissues treated with chemicals, in
particular Mn2+ and AP, accumulated 2- to 6-fold
more transcripts coding for CYP76B1 than for CYP73A1 or CYP81B1.

View larger version (53K):
[in this window]
[in a new window]
| Figure 1.
Relative increase in the steady-state level of
CYP76B1, CYP81B1, and
CYP73A1 transcripts induced by xenobiotics. RNA was
prepared from Jerusalem artichoke tuber tissues, sliced, and aged in
water or in solutions of different chemicals. The same RNA-blot
membrane (20 µg of total RNA in each lane) was successively
hybridized with CYP81B1, CYP73A1, and
CYP76B1 32P-radiolabeled probes.
Hybridization signals were quantified with a phosphor imager. Induction
is calculated by comparison with the signal recorded with RNA from
tissues aged in water. Induction obtained with Flav, NA, and
B(a)P, which were dissolved in DMSO, was compared with
that obtained for tissues treated with DMSO alone.
|
|
Optimized Expression of CYP76B1 in Yeast
The CYP76B1 coding sequence was expressed in three
engineered yeast strains, W(R), WAT11, and WAT21, which also expressed yeast or Arabidopsis P450 reductases ATR1 and ATR2, respectively, under
the transcriptional control of the same Gal-inducible promoter GAL10-CYC1 (Urban et al., 1997 ). The levels of expression of
CYP76B1 were compared in the different yeast strains after 12, 16, 24, and 36 h of induction with Gal, or continuously grown in the
presence of Gal. Highest expression was obtained using the WAT11 strain continuously grown in the presence of Gal, reaching 157 pmol
mg 1 microsomal protein (0.86% of microsomal
protein). Contrary to CYP81B1 (Cabello-Hurtado et al., 1998a ), CYP76B1
was expressed at a significant level in the presence of yeast
reductase, but its expression was consistently 15% to 40% lower in
WAT21 or W(R) than in WAT11 (Fig. 2).
Expression did not increase when -aminolevulinic acid was added to
the growth medium, and significantly decreased when cells were grown at
25°C or stored for 24 h at 4°C before extraction.

View larger version (35K):
[in this window]
[in a new window]
| Figure 2.
Comparison of the expression of CYP76B1 in yeast
strains coexpressing yeast [W(R)], Arabidopsis ATR1 (WAT11), or ATR2
(WAT21) reductases. A, CO/reduced versus reduced difference spectra
measured in microsomes of the three yeast strains after 16 h of
induction with Gal. Microsomal protein concentration in the cuvettes
was 900 µg mL 1. No P450 was detected in microsomes
prepared from the same yeast strains transformed with a void plasmid.
B, Western-blot analysis of the same microsomes. M,
Mr markers; HT, microsomes from Jerusalem
artichoke tuber treated with AP; V, microsomes from yeast transformed
with a void plasmid; 76, microsomes from yeasts transformed with
CYP76B1. Each lane was loaded with 20 µg of microsomal
protein.
|
|
CYP76B1 Metabolizes Several Classes of Exogenous Molecules
CYP76B1 was previously reported to dealkylate 7-ethoxycoumarin
(Batard et al., 1998 ). After optimized expression in yeast, its
metabolic capacity was more thoroughly investigated. Using transformed
WAT11 yeast microsomes, we first assayed for possible metabolism of a
number of endogenous molecules known or suspected to be substrates of
P450 oxygenases from Jerusalem artichoke tuber tissues. No metabolites
were formed from phenolics (cinnamate, benzoate, ferulate, naringenin,
scopoletin, and isoscopoletin), isoprenoids (geraniol, ABA, and
obtusifoliol), or fatty acids (capric, lauric, myristic, palmitic,
oleic, linoleic, and linolenic acids). We then tested different classes
of foreign compounds, including molecules previously shown to be
metabolized by the plant-tuber microsomes (Higashi et al., 1981 ;
Fonné, 1985 ; Fonné-Pfister et al., 1988 ;
Werck-Reichhart et al., 1990 ; Batard et al., 1995 ): B(a)P
and the drug AP, fluorescent alkoxycoumarins (7-methoxycoumarin, 7-propoxycoumarin, and 7-butoxycoumarin) and alkoxyphenoxazones (7-methoxy-resorufin, 7-ethoxyresorufin, 7-pentoxyresorufin, and 7-benzyloxyresorufin), and representative members of different classes
of herbicides (2,4-D, diclofop, chlorsulfuron, bentazon, dicamba,
chlortoluron, and isoproturon). In addition to 7-ethoxycoumarin, five
xenobiotics were actively converted into more polar metabolites (Table I). No metabolism was detected in
the absence of NADPH or in control microsomes prepared from yeast
transformed with a void plasmid.
View this table:
[in this window]
[in a new window]
|
Table I.
CYP76B1-dependent metabolism of xenobiotics
MCOD, ECOD, MROD, and EROD activities were determined fluorometrically
using 16 pmol of CYP76B1 per 2-mL assay. Demethylation of CTUDM and
IPUDM was tested using 14C-labeled substrates with
approximately 3 pmol of CYP76B1 in the 200-µL assays. Conversion was
estimated from the sum of the two polar metabolites detected after TLC
analysis. Data are means ± SD of two to four
determinations.
|
|
Characterization of the Phenylurea Metabolites
Microsomes from AP-treated Jerusalsem artichoke tuber, when
incubated with NADPH and chlortoluron, produce principally mono- and
di-N-dealkylated metabolites and minor amounts of the
ring-methyl hydroxylated compound (Fonné, 1985 ). It
was unclear whether these different metabolites were generated by a
single or several P450 enzymes. The products of CYP76B1-dependent
metabolism of chlortoluron and isoproturon were thus extensively
characterized. Both TLC and HPLC analysis of the metabolites, including
cochromatography with reference standards (not shown), suggested a
sequential conversion of the herbicide to mono- and di-dealkylated
derivatives. This was further confirmed by liquid
chromatography-MS analysis (Fig. 3). For both chlortoluron and
isoproturon, time-dependent and sequential formation of m/z
14 and 28 molecular ions was observed. To confirm the capacity of
CYP76B1 to catalyze the double dealkylation of chlortoluron, the
mono-demethylated derivative was purified by TLC from large-scale
incubations of transformed yeast microsomes with NADPH and
14C-chlortoluron. In the absence of chlortoluron,
its mono-N-demethylated derivative was actively dealkylated
by CYP76B1.

View larger version (30K):
[in this window]
[in a new window]
| Figure 3.
Products resulting from the CYP76B1-dependent
metabolism of chlortoluron and isoproturon. Approximately 8 pmol of
CYP76B1 in WAT11 yeast microsomes was incubated for 60 min at 30°C
with 500 µM substrate, 500 µM NADPH, 1 mM Glc-6-P, and 0.5 unit of Glc-6-P dehydrogenase in 200 µL of 0.1 M sodium phosphate, pH 7.4. Twenty microliters
of the acidified and centrifuged incubation medium was directly
analyzed by liquid chromatography-MS using a gradient of 3% to
60% B (100% acetonitrile, 0.08% TFA) in A (water, 0.1% TFA) in
65 min. Absorbance was monitored at 214 nm.
|
|
From fluorescence emission spectra of the products of alkoxycoumarin
and alkoxyresorufin metabolism with maxima at 460 (excitation at 380 nm) and 585 nm (excitation at 530 nm), respectively, it was assumed
that all compounds were O-dealkylated to form umbelliferone or 7-hydroxyresorufin. These products were, however, not further characterized.
Catalytic Parameters of the CYP76B1-Dependent Reactions
Methoxy- and ethoxyresorufins were the best substrates of CYP76B1,
with very high
kcat/Km of 237 and 165 min 1
µM 1, respectively, in microsomes
from the WAT11 yeast strain (Table II).
The second-best substrate was chlortoluron, the first dealkylation proceeding significantly faster than the second. The first
demethylation of isoproturon was slower than that of chlortoluron.
7-Ethoxycoumarin and 7-methoxycoumarin turned out to be the poorest
substrates of CYP76B1. In terms of turnover number, phenyl-ureas
were the fastest metabolized substrates of CYP76B1
(kcat of 803 and 147 min 1 for the first demethylation of
chlortoluron and isoproturon, respectively), the second
demethylation (kcat = 46 min 1 for monodemethyl-chlortoluron) being the
rate-limiting step for total detoxification of the herbicides.
View this table:
[in this window]
[in a new window]
|
Table II.
Catalytic parameters of the reactions catalyzed by
CYP76B1 in the presence of different P450 reductases
The CYP76B1 concentrations in the MCOD, ECOD, MROD and EROD
fluorometric assays were 1.5 or 2.1 nM, depending on the
coexpressed ATR1 or yeast reductases. In the CTUDM assays, the CYP76B1
concentrations were 1.7 nM (ATR1) and 8 nM
(yeast), respectively. It was 12 nM for the determination
of the catalytic parameters of monodemethyl-CTUDM, and 1.7 nM (ATR1) or 20 nM (yeast) in the IPUDM assays.
Products were quantified by direct TLC analysis of 100 µL of the
acidified incubation medium after 6 min of incubation at 30°C for the
CTUDM and IPUDM assays, and after 9 min of incubation for the
monodemethyl-CTUDM.
|
|
Influence of the P450 Reductases on CYP76B1 Activity
Preliminary results (Table I) indicated that the differences in
catalytic activity were larger than the differences in P450 expression
in the three yeast strains. Accordingly, the catalytic parameters of
xenobiotic metabolism were determined with CYP76B1 expressed in both
W(R) and WAT11 microsomes (Table II). The nature of the coexpressed
reductase did not influence the Km of the
reactions to any great extent, although Km
measured in the presence of the Arabidopsis reductase ATR1 were
consistently lower than those determined in presence of yeast
reductase. However, large changes in kcat
were observed depending on the origin of the coexpressed reductase. The
maximum velocities of oxygenation of all six substrates were about 3 times higher in the presence of ATR1. Catalytic parameters were also
measured in the presence of the other Arabidopsis reductase ATR2 with
methoxyresorufin as the substrate. They were not significantly different (Km = 0.185 µM;
kcat = 43 min 1)
from those determined with microsomes from WAT11.
The observed variations in kcat could
result from differences in reductase expression in the W(R) and WAT
yeast strains. We thus compared the velocities of NADPH-dependent Cyt
c reduction in microsomes from the three strains. The
reductase activity in microsomes from 76B1W(R) (0.74 ± 0.057 µmol min 1 mg 1) was
higher than in microsomes from transformed WAT11 and WAT21 (0.61 ± 0.023 and 0.60 ± 0.01 µmol min 1
mg 1, respectively). Differences in
kcat observed in our experiments are thus
likely to result from faster electron transfer between plant enzymes,
or from a plant reductase-induced change in CYP76B1 conformation or
stability.
Other Phenylurea Herbicides
Metabolism of both chlortoluron and isoproturon suggests that
other herbicides of the class of phenylureas could be substrates as
well. Therefore, we tested the binding of a set of related molecules in
the active site of CYP76B1. The binding of substrates into the
catalytic site of a P450 usually induces a shift of the absorption
maximum, redox potential, and iron spin state (Raag and Poulos, 1989 ),
resulting from the displacement of the water molecule that serves as
the sixth ligand of the heme iron. Substrate binding is easily detected
by difference spectroscopy, resulting in the formation of a so-called
type I spectrum with a maximum at 390 nm and a trough at 420 nm
(Jefcoate, 1978 ). The variation of the difference absorbance
A390-420 versus substrate concentration
allows the calculation of an apparent dissociation constant
(KS). A high
Amax induced by the ligand is usually an indication of correct ligand positioning for catalysis. Therefore, the
high Amax induced by the binding of the
molecules in Table III suggests that a
similar positioning of the dimethylurea function close to heme iron and
favorable to catalysis is maintained for many phenyl-ureas.
Affinity for the active site seems to be largely governed by the
substituents on the phenyl ring, the presence of ring-deactivating
halogens being more favorable than methyl or other potentially
activating substituents. Replacement of one of the N-methyls
by a hydroxymethyl group also seems to favor the binding of the
molecules in the active site of CYP76B1.
View this table:
[in this window]
[in a new window]
|
Table III.
Binding parameters of the spectra induced upon
fixation of phenylureas in the active site of CYP76B1
The CYP76B1 concentration was 60 nM in the assays.
Difference spectra were recorded after addition of increasing
concentrations of ligands to the sample cuvette. An equal volume of the
herbicide solvent DMSO was added to the reference.
Ks and Amax at
saturating ligand concentrations were calculated from the
double-reciprocal plots of A(390-420nm)
versus substrate concentrations.
|
|
 |
DISCUSSION |
Oxidative N-demethylation of phenylureas, described by
Frear and coworkers as early as 1969, together with kaurene
hydroxylase, were the two first P450-dependent reactions characterized
in higher plants. This pioneer work supported the idea that several
phenylurea derivatives might be substrates of the same P450 enzyme, and
that this P450 might be able to carry out the double dealkylation
of the molecules. The involvement of P450 in the
Ndemethylation of chlortoluron was first demonstrated
using microsomes from Jerusalem artichoke tuber treated with PB
(Fonné, 1985 ). Subsequent reports indicated that at least one
other P450, found mostly in cereals, metabolized chlortoluron via
hydroxylation on its ring-methyl (Ryan et al., 1981 ;
Fonné-Pfister and Kreuz, 1990 ; Mougin et al., 1990 ). Both double
N-dealkylation and ring-methyl hydroxylation of the
herbicide lead to inactive compounds (Ryan et al., 1981 ; Ryan and Owen,
1982 ). Plant tolerance to phenylurea and selectivity of these
herbicides thus rely on the presence and relative expression of at
least two P450 oxygenases.
We show here that CYP76B1 catalyzes the mono- and
di-N-demethylation of both chlortoluron and isoproturon.
Other phenylureas bind to its active site with high affinity. Their
positioning close to the heme iron is favorable to catalysis. Such
binding parameters, together with preliminary analysis of metabolites (not shown), indicate that CYP76B1 dealkylates most phenylureas, including the methoxylated forms such as monolinuron or chlorbromuron. The Ks of CYP76B1 for diuron (20 µM) is very similar to the Km previously reported for diuron demethylation (15 µM) in
cotton seedling hypocotyl microsomes (Frear et al., 1969 ). This
suggests that CYP76B1 may be the Jerusalem artichoke ortholog of the
phenylurea dealkylase originally characterized by Frear et al. (1969)
in cotton.
A few other P450s have previously been reported to metabolize
chlortoluron. Recombinant human CYP1A1 (Shiota et al., 1994 ) and CYP3A4
(Mehmood et al., 1995) have low regiospecificity and catalyze both
N-demethylation and ring-methyl hydroxylation of the
herbicide. Although turnover numbers were not reported, available data
indicate moderate efficiency. Two yeast-expressed plant enzymes, CYP73A1 (Pierrel et al., 1994 ) and CYP81B1 (Cabello-Hurtado et al.,
1998a ), were also reported to catalyze ring-methyl hydroxylation of
chlortoluron. In both cases, however, the reaction was extremely slow.
This contrasts with the very fast N-demethylation observed with CYP76B1. Turnover rates found for the first demethylation of
chlortoluron and isoproturon (803 and 147 min 1)
compare favorably to the turnover measured with physiological substrates. Even the second demethylation, which is the slow step for
complete detoxification of chlortoluron, proceeds with a relatively high kcat of 46 min 1. CYP76B1 is thus expected to be a major
phenylurea metabolizing P450 in higher plants, and probably plays a
significant role in the detoxification and selectivity of this broad
class of PSII inhibitors. Phenyl-ureas have been widely used for
selective weed control in cereal crops and are considered serious
environmental contaminants. It may thus provide a strategy for
bioremediation of contaminated sites.
The physiological function of CYP76B1 remains an intriguing question.
Phenylurea demethylase activity was found in many plants, both dicots
and monocots (Frear et al., 1969 ; Ryan et al., 1981 ; Fonné, 1985 ;
Fonné-Pfister and Kreuz, 1990 ; Mougin et al., 1990 ; Frear et al.,
1991 ). In cotton, activity was detected in leaves and roots and was
highest in etiolated hypocotyls (Frear et al., 1969 ). Several P450
families may contribute to phenylurea metabolism in different organs or
different plant species. It is also possible that several 76 orthologs,
isoforms, or variants participate to a different extent in the
metabolism of phenylureas. The first two CYP76 sequences were isolated
from eggplant (Toguri et al., 1993 ) without any assignment of a
possible function. A recent search of the sequence data banks reveals
the presence of 4 CYP76 genes clustered on the chromosome II of
Arabidopsis. The CYP76 family thus appears widespread and diversified
in higher plants. All of the identified substrates of CYP76B1 (Fig.
4) are planar aromatic molecules larger
than simple phenylpropanoids. The most closely related P450 enzymes are
CYP75 and CYP93, which are known or implied to metabolize flavonoids or
isoflavonoids (Holton et al., 1993 ; Schopfer and Ebel, 1998 ). Molecules
with a flavonoid-like structure are thus good potential substrates of
CYP76. Only naringenin has been tested so far and was not metabolized
by CYP76B1.
Our aim was to isolate plant P450s with high xenobiotic-metabolizing
capacities. We expected such P450s to be strongly inducible by
exogenous chemicals. In the case of CYP76B1, this assumption proved to
be correct. If the physiological substrate turns out to be a flavonoid,
strong induction by foreign chemicals could be a response to oxidative
stress related to the antioxidant properties of such molecules.
Alternatively, PB, AP, or Mn2+ could be mimicking
endogenous signals that specifically trigger events of plant
development or defense mechanisms. In this case, selective induction of
CYP76B1 will be more difficult to explain. However, it is possible that
enzymes corresponding to downstream portions of the secondary
metabolism are less restricted with respect to the selectivity of their
active site, and submitted to more specific regulation than P450s with
more pleiotropic functions in the upper parts of the pathways.
 |
FOOTNOTES |
1
This work was supported in part by the
Convention Groupement de Recherches et d'Etudes sur les
Génomes/Institut National de la Recherche Agronomique
"Complémentation de la levure par des gènes de
plantes." Y.B. was supported by the Ministère de la Recherche
et de l'Enseignement Supérieur, S.N. by a fellowship in
toxicology from the European Science Foundation, and F.C.H. by a
postdoctoral grant from the Spanish Ministerio de Agricultura, Pesca y
Alimentacíon.
*
Corresponding author; e-mail daniele.werck{at}ibmp-ulp.u-strasbg.fr;
fax 33-3-88-35-84-84.
Received May 28, 1998;
accepted July 27, 1998.
The accession number for the CYP76B1 sequence described in this article
is Y0992.
 |
ABBREVIATIONS |
Abbreviations:
AP, aminopyrine.
B(a)P, benzo(a)pyrene.
CTUDM, chlortoluron demethylase.
ECOD, 7-ethoxycoumarin O-deethylase.
EROD, 7-ethoxyresorufin O-deethylase.
Flav, flavone.
IPUDM, isoproturon demethylase.
MCOD, 7-methoxycoumarin
O-deethylase.
MROD, 7-methoxyresorufin
O-deethylase.
NA, naphthalic anhydride.
P450, Cyt P450.
PB, phenobarbital.
 |
ACKNOWLEDGMENTS |
We would like to thank Drs. D. Pompon and P. Urban for providing
the W(R), WAT11, and WAT21 yeast strains and the pYeDP60 expression
vector. We would also like to thank M.F. Castaldi for her technical
assistance and R. Kahn for the linguistic improvement of the
manuscript.
 |
LITERATURE CITED |
Barrett M
(1995)
Metabolism of herbicides by cytochrome P450 in corn.
Drug Metab Drug Interact
12:
299-315
[Medline]
Batard Y,
LeRet M,
Schalk M,
Zimmerlin A,
Durst F,
Werck-Reichhart D
(1998)
Plant J
14:
111-120
[CrossRef][Medline]
Batard Y,
Schalk M,
Pierrel MA,
Zimmerlin A,
Durst F,
Werck-Reichhart D
(1997)
Regulation of the cinnamate 4-hydroxylase (CYP73A1) in Jerusalem artichoke tubers in response to wounding and chemical treatments.
Plant Physiol
113:
951-959
[Abstract]
Batard Y,
Zimmerlin A,
Le Ret M,
Durst F,
Werck-Reichhart D
(1995)
Multiple xenobiotic-inducible P450s are involved in alkoxycoumarins and alkoxyresorufins metabolism in higher plants.
Plant Cell Environ
18:
523-533
[CrossRef]
Benveniste I,
Gabriac B,
Durst F
(1986)
Purification and characterization of the NADPH-cytochrome P450 (cytochrome c) reductase from higher-plant microsomal fraction.
Biochem J
235:
365-373
[Medline]
Bolwell GP,
Bozac K,
Zimmerlin A
(1994)
Plant cytochrome P450.
Phytochemistry
37:
1491-1506
[CrossRef][Web of Science][Medline]
Cabello-Hurtado F,
Batard Y,
Salaün J,
P,
Durst F,
Pinot F,
Werck-Reichhart D
(1998a)
Cloning, expression in yeast and functional characterization of CYP81B1, a plant P450 which catalyzes in-chain hydroxylation of fatty acids.
J Biol Chem
273:
7260-7267
[Abstract/Free Full Text]
Cabello-Hurtado F, Durst F, Jorrin JV, Werck-Reichhart D (1998b)
Coumarins in Helianthus tuberosus: characterization, induced
accumulation and biosynthesis. Phytochemistry (in press)
Duggleby RG
(1984)
Regression analysis of nonlinear Arrhenius plots: an empirical model and a computer program.
Comput Biol Med
14:
447-455
[CrossRef][Medline]
Fonné R (1985) Intervention du cytochrome P450 des
végétaux supérieurs dans l'oxydation de
composés exogènes: l'aminopyrine et le chlortoluron. PhD
thesis. Université Louis Pasteur, Strasbourg, France
Fonné-Pfister R,
Kreuz K
(1990)
Ring-methyl hydroxylation of chlortoluron by an inducible cytochrome P450-dependent enzyme from maize.
Phytochemistry
9:
2793-2796
[CrossRef]
Fonné-Pfister R,
Simon A,
Salaün JP,
Durst F
(1988)
Xenobiotic metabolism in higher plants: involvement of microsomal cytochrome P450 in aminopyrine N-demethylation.
Plant Sci
55:
9-20
[CrossRef]
Frear DS
(1995)
Wheat microsomal cytochrome P450 monooxygenases: characterization and importance in the metabolic detoxification and selectivity of wheat herbicides.
Drug Metab Drug Interact
12:
329-357
[Medline]
Frear DS,
Swanson HR,
Tanaka FS
(1969)
N-demethylation of substituted 3-(phenyl)-1-methylureas: isolation and characterization of a microsomal mixed function oxidase from cotton.
Phytochemistry
8:
2157-2169
[CrossRef]
Frear DS,
Swanson HR,
Thalacker FW
(1991)
Induced microsomal oxidation of diclofop, triasulfuron, chlorsulfuron and linuron in wheat.
Pestic Biochem Physiol
41:
274-287
Gabriac B,
Werck-Reichhart D,
Teutsch GH,
Durst F
(1991)
Purification and immunocharacterization of a plant cytochrome P450: the cinnamic acid 4-hydroxylase.
Arch Biochem Biophys
288:
302-309
[CrossRef][Medline]
Guengerich FP (1995) Human cytochromes P450 enzymes. In
PR Ortiz de Montellano, ed, Cytochrome P450: Structure, Mechanism, and
Biochemistry, 2nd Ed. Plenum Press, New York, pp 367-390
Higashi K,
Nakashima K,
Karasaki Y,
Fukunaga M,
Mizuguchi Y
(1981)
Activation of benzo(a)pyrene by microsomes of higher plant tissues and their mutagenesis.
Biochem Internat
2:
373-380
Holton T,
Brugliera F,
Lester DR,
Tanaka Y,
Hyland CD,
Menting JGT,
Lu CY,
Farcy E,
Srevenson TW,
Cornish EC
(1993)
Cloning and expression of cytochrome P450 genes controlling flower colour.
Nature
366:
276-279
[CrossRef][Medline]
Jefcoate CR
(1978)
Measurement of substrate and inhibitor binding to microsomal cytochrome P450 by optical-difference spectroscopy.
Methods Enzymol
52:
258-279
[Medline]
Mehmoud Z, Kelly DE, Kelly SL (1995) Metabolism of the herbicide
chlortoluron by human cytochrome P4503A4. Chemosphere
11/12: 4515-4529
Moreland DE,
Corbin FT,
Fleischmann TJ,
McFarland JE
(1995)
Partial characterization of microsomes isolated from mung bean cotyledons.
Pest Biochem Physiol
52:
98-108
[CrossRef]
Mougin C,
Cabanne F,
Canivenc MC,
Scalla R
(1990)
Hydroxylation and N-demethylation of chlortoluron by wheat microsomal enzymes.
Plant Sci
66:
195-203
[CrossRef]
Persan MW,
Schuler MA
(1995)
Differential induction of cytochrome P450-mediated triasulfuron metabolism by naphthalic anhydride and triasulfuron.
Plant Physiol
109:
1483-1490
[Abstract]
Pierrel MA,
Batard Y,
Kazmaier M,
Mignotte-Vieux C,
Durst F,
Werck-Reichhart D
(1994)
Catalytic properties of the plant cytochrome P450 CYP73 expressed in yeast: substrate specificity of a cinnamate hydroxylase.
Eur J Biochem
224:
835-844
[Medline]
Pompon D,
Louerat B,
Bronine A,
Urban P
(1996)
Yeast expression of animal and plant P450s in optimized redox environment.
Methods Enzymol
272:
51-64
[CrossRef][Web of Science][Medline]
Potter S,
Moreland DE,
Kreuz K,
Ward E
(1995)
Induction of cytochrome P450 genes by ethanol in maize.
Drug Metab Drug Interact
12:
317-327
[Medline]
Raag R,
Poulos TL
(1989)
The structural basis for substrate-induced changes in redox potential and spin equilibrium in cytochrome P450CAM.
Biochemistry
28:
917-922
[CrossRef][Medline]
Ryan PJ,
Gross D,
Owen WJ,
Laanio TL
(1981)
The metabolism of chlortoluron, diuron, and CGA 43057 in tolerant and susceptible plants.
Pestic Biochem Physiol
16:
213-221
Ryan PJ, Owen WJ (1982) The mechanism of selectivity of
chlortoluron between cereals and grassweeds. Proc Br Crop Prot
Conf-Weeds 317-323
Sandermann H Jr
(1994)
Higher plant metabolism of xenobiotics: the "green liver" concept.
Pharmacogenetics
4:
225-241
[CrossRef][Medline]
Schopfer CR,
Ebel J
(1998)
Isolation of elicitor-inducible cytochrome P450s of soybean (Glycine max L.) using differential display of mRNA.
Mol Gen Genet
258:
315-322
[CrossRef][Medline]
Schuler MA
(1996)
Rev Plant Sci
15:
235-284
Shiota N,
Nagasawa A,
Sakaki T,
Yabusaki Y,
Ohkawa H
(1994)
Herbicide-resistant plants expressing the fused enzyme between rat cytochrome P4501A1 (CYP1A1) and yeast NADPH-cytochrome P450 reductase.
Plant Physiol
106:
17-23
[Abstract]
Teutsch GH,
Hasenfratz MP,
Lesot A,
Stoltz C,
Garnier JM,
Jeltsch JM,
Durst F,
Werck-Reichhart D
(1993)
Isolation and sequence of a cDNA encoding the Jerusalem artichoke cinnamate hydroxylase, a major plant cytochrome P450 involved in the general phenylpropanoid pathway.
Proc Natl Acad Sci USA
90:
4102-4106
[Abstract/Free Full Text]
Toguri T,
Kobayashi O,
Umemoto N
(1993)
The cloning of eggplant seedling cDNA encoding proteins from a novel cytochrome P450 family (CYP76).
Biochim Biophys Acta
1216:
165-169
[Medline]
Urban P,
Mignotte C,
Kazmaier M,
Delorme F,
Pompon D
(1997)
Cloning, yeast expression, and characterization of the coupling of two distantly related Arabidopsis thaliana NADPH-cytochrome P450 reductases with P450 CYP73A5.
J Biol Chem
272:
19176-19186
[Abstract/Free Full Text]
Waxman DJ, Chang TKH (1995) Hormonal regulation of liver
cytochrome P450 enzymes. In PR Ortiz de Montellano, ed,
Cytochrome P450: Structure, Mechanism, and Biochemistry, 2nd Ed. Plenum
Press, New York, pp 391-417
Werck-Reichhart D
(1995)
Herbicide metabolism and selectivity: role of cytochrome P450.
Proc Br Crop Prot Conf-Weeds
3:
813-822
Werck-Reichhart D,
Batard Y,
Kochs G,
Lesot A,
Durst F
(1993)
Monospecific polyclonal antibodies directed against purified cinnamate 4-hydroxylase from Helianthus tuberosus: immunopurification, immunoquantitation, interspecies cross-reactivity.
Plant Physiol
102:
1291-1298
[Abstract]
Werck-Reichhart D,
Gabriac B,
Teutsch H,
Durst F
(1990)
Two cytochrome P450 isoforms catalyzing O-dealkylation of ethoxycoumarin and ethoxyresorufin in higher plants.
Biochem J
270:
729-735
[Medline]
Whitlock JP, Denison MS (1995) Induction of cytochrome P450
enzymes that metabolize xenobiotics. In PR Ortiz de
Montellano, ed, Cytochrome P450: Structure, Mechanism, and
Biochemistry, 2nd Ed. Plenum Press, New York, pp 367-390
This article has been cited by other articles:

|
 |

|
 |
 
G. A. Schoch, R. Attias, M. Belghazi, P. M. Dansette, and D. Werck-Reichhart
Engineering of a Water-Soluble Plant Cytochrome P450, CYP73A1, and NMR-Based Orientation of Natural and Alternate Substrates in the Active Site
Plant Physiology,
November 1, 2003;
133(3):
1198 - 1208.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Didierjean, L. Gondet, R. Perkins, S.-M. C. Lau, H. Schaller, D. P. O'Keefe, and D. Werck-Reichhart
Engineering Herbicide Metabolism in Tobacco and Arabidopsis with CYP76B1, a Cytochrome P450 Enzyme from Jerusalem Artichoke
Plant Physiology,
September 1, 2002;
130(1):
179 - 189.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. W. Persans, J. Wang, and M. A. Schuler
Characterization of Maize Cytochrome P450 Monooxygenases Induced in Response to Safeners and Bacterial Pathogens
Plant Physiology,
February 1, 2001;
125(2):
1126 - 1138.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. Siminszky, F. T. Corbin, E. R. Ward, T. J. Fleischmann, and R. E. Dewey
Expression of a soybean cytochrome P450 monooxygenase cDNA in yeast and tobacco enhances the metabolism of phenylurea herbicides
PNAS,
February 16, 1999;
96(4):
1750 - 1755.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. O. Latunde-Dada, F. Cabello-Hurtado, N. Czittrich, L. Didierjean, C. Schopfer, N. Hertkorn, D. Werck-Reichhart, and J. Ebel
Flavonoid 6-Hydroxylase from Soybean (Glycine max L.), a Novel Plant P-450 Monooxygenase
J. Biol. Chem.,
January 12, 2001;
276(3):
1688 - 1695.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|