|
|
||||||||
|
Plant Physiol. (1998) 118: 743-750 RAPID COMMUNICATION
Systematic Reverse Genetics of Transfer-DNA-Tagged
Lines of
Arabidopsis1
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
We have developed an efficient reverse-genetics protocol that uses expedient pooling and hybridization strategies to identify individual transfer-DNA insertion lines from a collection of 6000 independently transformed lines in as few as 36 polymerase chain reactions. We have used this protocol to systematically isolate Arabidopsis lines containing insertional mutations in individual cytochrome P450 genes. In higher plants P450 genes encode enzymes that perform an exceptionally wide range of functions, including the biosynthesis of primary metabolites necessary for normal growth and development, the biosynthesis of secondary products, and the catabolism of xenobiotics. Despite their importance, progress in assigning enzymatic function to individual P450 gene products has been slow. Here we report the isolation of the first 12 such lines, including one (CYP83B1-1) that displays a runt phenotype (small plants with hooked leaves), and three insertions in abundantly expressed genes. The DNAs used in this study are publicly available and can be used to systematically isolate mutants in Arabidopsis.
The isolation and analysis of mutations provides one of the most
powerful approaches available for determining the biological function
of specific genes. Directed reverse-genetic screens, which require
sequence information from the genes of interest and the availability of
large numbers of individuals carrying foreign DNA sequences
(transposons or T-DNA) randomly inserted within the genome, provide an
alternative approach for ascertaining gene-product function. The
insertion disrupts and thereby inactivates individual genes. The
individual plants containing the disruption can be identified using a
PCR primer designed from the gene sequence of interest, combined with a
second PCR primer designed from the border sequence of the insertional
mutagen, in the strategy described here as T-DNA. Only genomic DNA of
lines containing insertional mutations in or near the gene of interest
will generate a PCR-amplification product. This method was first
applied in Drosophila melanogaster (Ballinger and Benzer,
1989 The P450 gene superfamily is a large and ancient gene family (Nelson et
al., 1996 Analysis of natural and induced mutations has been critical in our
appreciation of the diversity of P450 gene function. For instance,
mutations in the CYP1B1 gene are associated with primary congenital glaucoma in humans (Stoilov et al., 1997 Arabidopsis, with its large EST collection, growing genomic sequence
database and T-DNA insertion mutant population (summarized by
Azpiroz-Leehan and Feldmann, 1997 Tagged Lines and DNA Pools
Identification of P450 Genes in Public Databases
![]()
INTRODUCTION
Top
Abstract
Introduction
Methods
Results & Discussion
References
; Kaiser and Goodwin, 1990
) and has more recently been successfully
applied in other systems, including Caenorhabditis elegans,
petunia, maize, and Arabidopsis (Zwaal et al., 1993
; Bensen et al.,
1995; Koes et al., 1995
; McKinney et al., 1995
; Krysan et al., 1996
;
Mena et al., 1996
; Frey et al., 1997
).
). More than 500 P450 genes have been identified, and these
have been classified into more than 70 gene subfamilies (Nelson and
Strobel, 1987
; Nelson et al., 1996
). Higher eukaryotes typically have a
genomic complement of more than 100 P450 genes (Nelson et al., 1996
).
The P450 gene family has rapidly expanded and diversified during the
last 400 million years, partly as a consequence of chemical warfare
between the plant and its predators (Gonzalez and Nebert, 1990
). P450
gene duplications, conversions, and clustering provide evidence for
this rapid evolution (Nelson and Strobel, 1987
; Gonzalez and Nebert,
1990
). In addition to a limited number of fundamental functions shared
by different eukaryotes, such as the 14-
-demethylation of sterols
(Bak et al., 1997
), P450 genes have evolved to perform numerous diverse functions. In animals these include the metabolism of endogenous signaling molecules, such as steroid hormones (Nebert, 1991
), and
xenobiotic detoxification (Nelson and Strobel, 1987
; Gonzalez and
Nebert, 1990
; Nebert, 1991
). In plants P450 enzymes are involved in
more than 50 reactions (Bolwell et al., 1994
; Schuler, 1996
). Among
these reactions are the biosynthesis of structural macromolecules such
as lignin, and of plant growth regulators such as jasmonic acid, GAs,
and brassinosteroids. P450 enzymes also catalyze the metabolism of xenobiotics, as well as the biosynthesis of numerous secondary products, including alkaloids, terpenoids, and cyanogenic glucosides (Bolwell et al., 1994
; Schuler, 1996
). The roles of secondary metabolites in plants are largely undefined, but many are
hypothesized to play defensive roles.
), and the cpd (CYP90A) and dwf4
(CYP90B) mutants of Arabidopsis have helped define the role
of brassinosteroids in plants (Szekeres et al., 1996
; Azpiroz et al.,
1998
; Choe et al., 1998
). However, for the vast majority of plant P450
genes, no information exists regarding their metabolic roles, which
means that it is impossible to predict the mutant phenotypes as
required by traditional procedures of "forward" genetic screening.
By way of explanation, P450 proteins with more than 40% identity are
included in the same family, designated with the prefix CYP, e.g. the
CYP90 family. Proteins with more than 60% identity are included in the
same subfamily, e.g. the CYP90 family contains the CYP90A and CYP90B
subfamilies. Individual members of a subfamily are further designated
with integers, e.g. CYP90A1 and CYP90A2 (Nelson et al., 1996
).
), and excellent genetics, provides a
model system with which to dissect plant P450 gene function. We
initiated a systematic screen for mutants of Arabidopsis P450 genes
tagged as a consequence of T-DNA insertion. We report here the
development of an efficient method of combinatorial screening and the
initial characterization, to our knowledge, of the first P450 mutant
lines obtained in this manner. This approach can be applied to any
single gene or to gene superfamilies.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Methods
Results & Discussion
References
). A C58C1Rif Agrobacterium tumefaciens strain carrying the 3850:1003 cointegrate plasmid conferring resistance to kanamycin was used to transform Arabidopsis ecotype Wassilewskija. The pooling strategy used in these experiments is outlined in Figure 1. Seeds from
"row" and "column" pools (n = 120) were sown in
flats, and plants (50-100 g fresh weight) were harvested at 3 weeks of
age and used to prepare DNA (Murray and Thompson, 1980
; McKinney et
al., 1995
). The plants were destarched by placing the flats in the dark
for 36 h before they were harvested. DNA concentration was
estimated by agarose gel electrophoresis of HindIII-digested
samples. DNA pools were adjusted to approximately 0.025 g/L and stored
at 4°C. The 120 DNA pools used in this work, and the transformants
used to make these pools, are available from ABRC (CD5-7). DNA from
"integer" pools (described below) was prepared by a modification of
the method of Cocciolone and Cone (1993)
. Pooled sterile seedlings were
frozen in liquid nitrogen and then powdered in 10-mL round-bottom tubes
with a glass rod. Extraction buffer (1.0 mL) was added, vortexed for
10 s, and mixed for 10 min, and then 0.5 mL of
Cl3CH/phenol was added and the solution was
vortexed for 10 s and shaken for 10 min. The preparations were
centrifuged for 10 min at the maximum speed in a desktop centrifuge,
and the aqueous solution was removed and added to a 1.5-mL centrifuge
tube. The DNA was precipitated with one-tenth volume of 3 M
sodium acetate and 0.6 volume of isopropanol, washed with 70% ethanol,
air dried for 15 min, and dissolved in 50 µL of TE (10 mM
Tris [pH 8.0], 1 mM EDTA).

View larger version (47K):
[in a new window]
Figure 1.
A, To generate the DNAs necessary for this
strategy, the seeds were first combined into subpools. Seeds from the
first 10 lines (1-10), the next 10 lines (11-20), etc., through 6000 lines were pooled to form 600 subpools. B, For each thousand lines
(Sheet Pool), the DNAs from the 100 subpools were mixed in a multiplex
array, to give 10 Pooled Column (PC) and 10 Pooled Row (PR) pools. The
pooled column and pooled row pools from all of the sheet pools were
then amalgamated to give 10 Column Superpools and 10 Row Superpools.
When the sheet pool, column superpools, and row superpools containing
the positive amplicon are known, it is possible to define the mutant of
interest to a subpool of 10 lines.
). A word
search for P450 recovered a total of 81 candidate CYP sequences (release of January 7, 1997), which were reconfirmed by BLASTX analysis. Clones for these P450 genes were obtained from ABRC.
PCR Primers
GSPs were designed with the program PrimerSelect from the LaserGene software package (DNASTAR, Madison, WI). For each sequence, the forward primer was designed to be an average of 100 bp 5
of the
reverse primer to maximize coverage of the gene. When possible the
primers were designed to sequences in the middle of the gene or just
slightly 5
of the middle. To reduce the possibility that the primers
spanned intron/exon boundaries, primers with sequences most commonly at
the exon boundaries were eliminated: AGGT for forward primers and ACCT
for reverse primers. All GSPs were designed to anneal at 60°C.
Amplification of genomic DNA was used to confirm the suitability of the
P450 primer pairs. For five primer pairs, no product was detected by UV
visualization of ethidium bromide-stained agarose gels; these may
represent cases in which one of the P450 primers of interest is
interrupted by an intron. The left border (LB) and right border (RB)
primers used in these experiments were: LB102A,
GATGCAATCGATATCAGCCAATTTTAGAC, and RB16843,
GCTCATGATCAGATTGTCGTTTCCCGCCTT, respectively.
Hybridization Probes
Probes were prepared from both P450 plasmid and genomic sequences. The 50-µL reaction mixture contained 1 ng of pooled P450 plasmid (DNA from all available P450 clones [from ABRC] pooled together), 0.5 unit of Taq DNA polymerase (BRL), 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 50 M deoxyribonucleotide triphosphate, 2.5 M digoxigenin-UTP (Boehringer Mannheim), and 0.5 M forward and reverse primers designed against the LacZ flanking sequence of standard cloning vectors. To prepare probes from genomic DNA, a similar reaction mixture was used, except that 10 ng of genomic DNA as well as forward and reverse P450 GSP primer pairs were used in place of plasmid DNA and the vector primer pair, respectively. All products from plasmid and genomic amplifications were pooled and used in hybridization reactions; this pooled set of probes is referred to as the P450 superprobe.Control Reactions
The previously described act2-1 mutant line has a T-DNA in the 5
region of the gene (McKinney et al., 1995
and 600 bp 3
of the T-DNA
insertion, and are available from ABRC (primers sent with CD5-7).
PCR Reactions and Hybridizations
PCR reactions were set up at 4°C and a hot-start protocol was used, with the last component (either primers or DNA, depending on the screen) being added when the PCR block was at 72°C. The reaction mixture contained 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 100 M deoxyribonucleotide triphosphate, 50 M of each primer (forward or reverse and right border or left border), and genomic DNA. The PCR program comprised one cycle of 1 min at 95°C, followed by 43 cycles at 94°C for 30 s, at 60°C for 30 s, and at 72°C for 2 min, followed by a 10-min extension cycle at 72°C.Reverse Genetic Screening
In the primary screens, 100 to 300 ng of a DNA pool consisting of DNA from each of the 6000 lines was used in each PCR reaction. GSPs were arrayed in a 96-well format and were the last component added to the PCR reactions in the primary screen. An eight-channel pipet was used to add the primers. Primer pairs associated with positively hybridizing spots were tested for random priming by performing PCR without a T-DNA border primer; these were eliminated before the secondary screens.Identification of Mutant Phenotypes
Fifty plants from each of the 12 putative mutant lines were grown in soil and screened for visible alterations in phenotype. In the one case in which a line had a visibly altered phenotype and the insertion was located between the GSPs, it was possible to test for linkage of the T-DNA insertion and the phenotypically mutant locus by testing for the presence of wild-type chromosomes in mutant plants. One leaf from each of 12 mutant plants and an equal number of wild-type plants were pooled separately, and DNA was extracted. Reactions were set up using approximately 10 ng of DNA. If the recessive mutant phenotype is caused by T-DNA insertion, no copies of the wild-type allele should be found in the DNA pool from the mutants. Tandem T-DNA insertions, typically 34 to 68 kb in length, preclude amplification of the gene in mutant alleles. For lines lacking a visible alteration in the phenotype, homozygous kanamycin-resistant lines were selected and analyzed for phenotypic alterations and for disruptions in the P450 gene of interest.Sequencing PCR Products
Products for sequencing were amplified as follows: a 1-min cycle at 95°C, followed by 30 or 35 cycles at 94°C for 30 s, at 60°C for 30 s, and at 72°C for 2 min, followed by a 10-min extension cycle at 72°C. PCR products were separated on agarose gels, reamplified, purified using Promega Wizard columns, and sequenced.| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
Examination of the TIGR Arabidopsis database (Rounsley, et al.,
1996
; http://www.tigr.org/tdb/at/at.html) allowed identification of 81 unique P450 ESTs and contigs. This database is estimated to represent
about one-half of all of the expressed genes in the genome, suggesting
that the final number of P450 genes may exceed 160. We designed forward
(F) and reverse (R) GSPs to 70 of these P450 sequences. When
full-length Arabidopsis P450 cDNA sequences were in the database, we
used those sequences for primer design; these include
CYP83A1, CYP86A1, and CYP90A1. Because
we expected that within our current population of 6000 Arabidopsis
lines a small percentage of P450 genes would carry T-DNA inserts
(Krysan et al., 1996
), we first determined the detection limit of the screening protocol. These control experiments established that the
act2-1 allele, a previously isolated T-DNA mutant (McKinney et al., 1995
), could be detected by PCR in a single DNA pool prepared from all 6000 lines (data not shown). This allowed an efficient primary
screen to be performed in which all 6000 lines could be screened
at one time to determine which of the P450 genes contained mutations.
Received March 11, 1998;
accepted July 30, 1998.
Abbreviations:
ABRC, Arabidopsis Biological Resource Center
(Ohio State University, Columbus).
EST, expressed sequence tag.
GSP, gene-specific primer.
T-DNA, transfer DNA.
We thank Frans Tax and Richard Schneeberger for critical review
of the manuscript.
Azpiroz R,
Wu Y,
LoCascio,
JC,
Feldmann KA
(1998)
An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation.
Plant Cell
10:
219-230
Azpiroz-Leehan R,
Feldmann KA
(1997)
T-DNA insertion mutagenesis in Arabidopsis: going back and forth.
Trends Genet
13:
152-156
[CrossRef][Web of Science][Medline]
Bak S,
Kahn RA,
Olsen CE,
Halkier BA
(1997)
Cloning and expression in Escherichia coli of the obtusifoliol 14 alpha-demethylase of Sorghum bicolor (L.) Moench, a cytochrome P450 orthologous to the sterol 14 alpha-demethylases (CYP51) from fungi and mammals.
Plant J
11:
191-201
[CrossRef][Web of Science][Medline]
Ballinger DG,
Benzer S
(1989)
Targeted gene mutations in Drosophila.
Proc Natl Acad Sci USA
86:
9402-9406
Bensen RJ, Johal GS, Crane VC, Tossberg JT, Schnable PS, Meeley RB.
Briggs SP (1995) Cloning and characterization of the maize
An1 gene. Plant Cell 7: 75-84
Bolwell GP,
Bozak K,
Zimmerlin A
(1994)
Plant cytochrome P450.
Phytochemistry
37:
1491-1506
[CrossRef][Web of Science][Medline]
Choe S,
Dilkes BP,
Fujioka S,
Takatuso S,
Sakurai A,
Feldmann KA
(1998)
Arabidopsis DWF4 encodes a cytochrome P450 that mediates multiple steps of 22
Cocciolone SM,
Cone KC
(1993)
Pl-Bh, an anthocyanin regulatory gene of maize that leads to variegated pigmentation.
Genetics
135:
575-588
[Abstract]
Forsthoefel NR,
Wu Y,
Schulz B,
Bennett MJ,
Feldmann KA
(1992)
T-DNA insertion mutagenesis in Arabidopsis: prospects and perspectives.
Aust J Plant Physiol
19:
353-366
[Web of Science]
Frey M,
Chomet P,
Glawischnig E,
Stettner C,
Grun S,
Winklmair A,
Eisenreich W,
Bacher A,
Meeley RB,
Briggs SP,
and others
(1997)
Analysis of a chemical plant defense mechanism in grasses.
Science
277:
696-699
Frey MR,
Kliem,
Saedler H,
Gierl A
(1995)
Expression of a cytochrome P450 gene family in maize.
Mol Gen Genet
246:
100-109
[CrossRef][Medline]
Gonzalez FJ,
Nebert DW
(1990)
Evolution of the P450 gene superfamily: animal-plant `warfare,' molecular drive and human genetic differences in drug oxidation.
Trends Genet
6:
182-186
[CrossRef][Web of Science][Medline]
Kaiser K,
Goodwin SF
(1990)
"Site-selected" transposon mutagenesis of Drosophila.
Proc Natl Acad Sci USA
87:
1686-1690
Klucher KM,
Chow H,
Reiser L,
Fischer RL
(1996)
The AINTEGUMENTA gene of Arabidopsis required for ovule and female gametophyte development is related to the floral homeotic gene APETALA2.
Plant Cell
8:
137-153
[Abstract]
Koes R,
Souer E,
van Houwelingen A,
Mur L,
Spelt C,
Quattrocchio F,
Wing J,
Opperdijk B,
Ahmed S,
Maes T,
and others
(1995)
Targeted gene inactivation in petunia by PCR-based selection of transposon insertion mutants.
Proc Natl Acad Sci USA
92:
8149-8153
Krysan PJ,
Young JC,
Tax F,
Sussman MR
(1996)
Identification of transferred DNA insertions within Arabidopsis genes involved in signal transduction and ion transport.
Proc Natl Acad Sci USA
93:
8145-8150
McKinney EC,
Ali N,
Traut A,
Feldmann KA,
Belostotsky DA,
McDowell JM,
Meagher RB
(1995)
Sequence-based identification of T-DNA insertion mutations in Arabidopsis: actin mutants act2-1 and act4-1.
Plant J
8:
613-622
[CrossRef][Web of Science][Medline]
Mena M,
Ambrose BA,
Meeley RB,
Briggs SP,
Yanofsky MF,
Schmidt RJ
(1996)
Diversification of C-function activity in maize flower development.
Science
274:
1537-1540
Murray MG,
Thompson WF
(1980)
Rapid isolation of high molecular weight plant DNA.
Nucleic Acids Res
8:
4321-4325
Nebert DW
(1991)
Proposed role of drug-metabolizing enzymes: regulation of steady state levels of the ligands that affect growth, homeostasis, differentiation, and neuroendocrine functions.
Mol Endocrinol
5:
1203-1214
Nelson DR,
Koymans L,
Kamataki T,
Stegeman JJ,
Feyereisen R,
Waxman DJ,
Waterman MR,
Gotoh O,
Coon MJ,
Estabrook RW,
and others
(1996)
P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature.
Pharmacogenetics
6:
1-42
[Web of Science][Medline]
Nelson DR,
Strobel HW
(1987)
Evolution of cytochrome P-450 proteins.
Mol Biol Evol
4:
572-593
[Abstract]
Oppenheimer DG,
Herman PL,
Sivakumaran S,
Esch J,
Marks MD
(1991)
A myb gene required for leaf trichome differentiation in Arabidopsis is expressed in stipules.
Cell
67:
483-493
[CrossRef][Web of Science][Medline]
Rounsley SD,
Glodek A,
Sutton G,
Adams MD,
Somerville CR,
Venter JC,
Kerlavage AR
(1996)
The construction of Arabidopsis expressed sequence tag assemblies. A new resource to facilitate gene identification.
Plant Physiol
112:
1177-1183
[Abstract]
Schuler MA
(1996)
Plant cytochrome P450 monooxygenases.
Crit Rev Plant Sci
15:
235-284
Stoilov I,
Akarsu AN,
Sarfarazi M
(1997)
Identification of three different truncating mutations in cytochrome P4501B1 (CYP1B1) as the principal cause of primary congenital glaucoma (buphthalmos) in families linked to the GLC3A locus on chromosome 2p21.
Hum Mol Genet
6:
641-647
Szekeres M,
Németh K,
Koncz-Kalman Z,
Mathur J,
Kauschmann A,
Altmann T,
Rédei GP,
Nagy F,
Schell J,
Koncz C
(1996)
Brassinosteroids rescue the deficiency of CYP090, a cytochrome P450, controlling cell elongation and de-etiolation in Arabidopsis.
Cell
85:
171-182
[CrossRef][Web of Science][Medline]
Zwaal RR,
Broeks A,
van Meurs J,
Groenen JTM,
Plasterk RHA
(1993)
Target-selected gene inactivation in Caenorhabditis elegans by using a frozen transposon insertion mutant bank.
Proc Natl Acad Sci USA
90:
7431-7435
View this table:
Table I.
Summary of T-DNA insertions detected with primers
designed from P450 genes and ESTs
The mutation numbers are used as abbreviations in Figure 2. All
insertions have left-border T-DNA at the T-DNA junction, except for
mutation 8, which has a right-border junction.
![]()
View larger version (8K):
[in a new window]
Figure 2.
Summary of the approximate positions of the T-DNA
insertions in the P450 genes. A prototypical P450 gene with just one
intron represented is shown (UTR, untranslated region; HBR, conserved
heme-binding region). The insertions, numbered from 1 to 13, are
described in Table I. The directions of the flags indicate the
orientations of the border primers relative to the GSPs used to
identify the insertion.
regions, four were in exons, one was in an intron, one
was in the 3
untranslated region of the corresponding mRNA (Fig. 2),
and three others were found at various distances 3
to the transcribed
region. The five insertions in either exons or introns are almost
certain to result in null mutations (Azpiroz-Leehan and Feldmann,
1997
). The insertional events in the 5
and 3
regions will require
further analysis to determine whether gene expression has been altered.
In other work, it has been found that T-DNA insertions approximately 1 to 2 kb 5
or 3
of the transcribed region can result in modified gene
expression and mutant phenotypes (Oppenheimer et al., 1991
; Klucher et
al., 1996
).
of a
CYP71B gene, there could be two T-DNA insertions that have
occurred in close proximity to linked P450 genes. A related set of
CYP71 genes, the CYP71C gene family of maize, has
also been observed to be clustered (Frey et al., 1995
). Further
analysis will be required to determine the structure of these
insertions.

View larger version (44K):
[in a new window]
Figure 3.
The phenotypes of 10-d-old soil-grown plants:
left, wild type; right, homozygote containing the
CYP83B1-1 mutant allele.
and 3
regions of the P450 gene to ensure complete coverage
of the predicted gene by the primers. Additionally, the knowledge of
the complete genomic sequence of the target gene will allow the
position of the insertion within the gene to be confirmed on the basis
of the size of PCR product(s). The methods we have described can also
be applied to any Arabidopsis gene or gene family. In particular, as
the amount of Arabidopsis sequence information in the public databases
grows, the number of genes that can be targeted will grow accordingly.
Furthermore, as more T-DNA lines are made available the probability of
successfully targeting the gene of interest grows; in this regard, the
6000 lines described here, as well as 6000 more lines donated by T. Jack (Dartmouth), are available from ABRC as seeds and pooled DNAs.
1
This work was supported by the National Science
Foundation-Department of Energy-U.S. Department of Agriculture (USDA)
Joint Program of Collaborative Research in Plant Biology (92-20332), by
USDA grant no. 9701472 to K.A.F., R.F., and D.W.G., and by the
University of Arizona Agricultural Experiment Station.
![]()
FOOTNOTES
2
Present address: Genomica Corp., 4001 Discovery
Drive, Suite 130, Boulder, CO 80303.
*
Corresponding author; e-mail feldmann{at}ag.arizona.edu; fax
1-310-825-5275.
![]()
ABBREVIATIONS
![]()
ACKNOWLEDGMENTS
![]()
LITERATURE CITED
Top
Abstract
Introduction
Methods
Results & Discussion
References
-hydroxylation in brassinosteroid biosynthesis.
Plant Cell
10:
231-243
Copyright Clearance Center: 0032-0889/98/118//08
© 1998 American Society of Plant Physiologists
This article has been cited by other articles:
![]() |
A. N. Stepanova, J. M. Hoyt, A. A. Hamilton, and J. M. Alonso A Link between Ethylene and Auxin Uncovered by the Characterization of Two Root-Specific Ethylene-Insensitive Mutants in Arabidopsis PLANT CELL, August 1, 2005; 17(8): 2230 - 2242. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. B. Kim, H. Schaller, C.-H. Goh, M. Kwon, S. Choe, C. S. An, F. Durst, K. A. Feldmann, and R. Feyereisen Arabidopsis cyp51 Mutant Shows Postembryonic Seedling Lethality Associated with Lack of Membrane Integrity Plant Physiology, August 1, 2005; 138(4): 2033 - 2047. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. WOODWARD and B. BARTEL Auxin: Regulation, Action, and Interaction Ann. Bot., April 1, 2005; 95(5): 707 - 735. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. An, S. Lee, S.-H. Kim, and S.-R. Kim Molecular Genetics Using T-DNA in Rice Plant Cell Physiol., January 15, 2005; 46(1): 14 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. H. Nam and J. Li The Arabidopsis Transthyretin-Like Protein Is a Potential Substrate of BRASSINOSTEROID-INSENSITIVE 1 PLANT CELL, September 1, 2004; 16(9): 2406 - 2417. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K. Pandey, Y. H. Cheong, K.-N. Kim, J. J. Grant, L. Li, W. Hung, C. D'Angelo, S. Weinl, J. Kudla, and S. Luan The Calcium Sensor Calcineurin B-Like 9 Modulates Abscisic Acid Sensitivity and Biosynthesis in Arabidopsis PLANT CELL, July 1, 2004; 16(7): 1912 - 1924. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Settles, S. Latshaw, and D. R. McCarty Molecular analysis of high-copy insertion sites in maize Nucleic Acids Res., April 1, 2004; 32(6): e54 - e54. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lee, J. Kim, J.-S. Son, J. Nam, D.-H. Jeong, K. Lee, S. Jang, J. Yoo, J. Lee, D.-Y. Lee, et al. Systematic Reverse Genetic Screening of T-DNA Tagged Genes in Rice for Functional Genomic Analyses: MADS-box Genes as a Test Case Plant Cell Physiol., December 15, 2003; 44(12): 1403 - 1411. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhu, J. Nam, N. C. Carpita, A. G. Matthysse, and S. B. Gelvin Agrobacterium-Mediated Root Transformation Is Inhibited by Mutation of an Arabidopsis Cellulose Synthase-Like Gene Plant Physiology, November 1, 2003; 133(3): 1000 - 1010. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vandenbussche, J. Zethof, E. Souer, R. Koes, G. B. Tornielli, M. Pezzotti, S. Ferrario, G. C. Angenent, and T. Gerats Toward the Analysis of the Petunia MADS Box Gene Family by Reverse and Forward Transposon Insertion Mutagenesis Approaches: B, C, and D Floral Organ Identity Functions Require SEPALLATA-Like MADS Box Genes in Petunia PLANT CELL, November 1, 2003; 15(11): 2680 - 2693. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Naur, B. L. Petersen, M. D. Mikkelsen, S. Bak, H. Rasmussen, C. E. Olsen, and B. A. Halkier CYP83A1 and CYP83B1, Two Nonredundant Cytochrome P450 Enzymes Metabolizing Oximes in the Biosynthesis of Glucosinolates in Arabidopsis Plant Physiology, September 1, 2003; 133(1): 63 - 72. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sessions, E. Burke, G. Presting, G. Aux, J. McElver, D. Patton, B. Dietrich, P. Ho, J. Bacwaden, C. Ko, et al. A High-Throughput Arabidopsis Reverse Genetics System PLANT CELL, December 1, 2002; 14(12): 2985 - 2994. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Schultz, M. P. Rumsewicz, K. L. Johnson, B. J. Jones, Y. M. Gaspar, and A. Bacic Using Genomic Resources to Guide Research Directions. The Arabinogalactan Protein Gene Family as a Test Case Plant Physiology, August 1, 2002; 129(4): 1448 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Hartweck, C. L. Scott, and N. E. Olszewski Two O-Linked N-Acetylglucosamine Transferase Genes of Arabidopsis thaliana L. Heynh. Have Overlapping Functions Necessary for Gamete and Seed Development Genetics, July 1, 2002; 161(3): 1279 - 1291. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Samson, V. Brunaud, S. Balzergue, B. Dubreucq, L. Lepiniec, G. Pelletier, M. Caboche, and A. Lecharny FLAGdb/FST: a database of mapped flanking insertion sites (FSTs) of Arabidopsis thaliana T-DNA transformants Nucleic Acids Res., January 1, 2002; 30(1): 94 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Smolen and J. Bender Arabidopsis Cytochrome P450 cyp83B1 Mutations Activate the Tryptophan Biosynthetic Pathway Genetics, January 1, 2002; 160(1): 323 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Weterings, N. R. Apuya, Y. Bi, R. L. Fischer, J. J. Harada, and R. B. Goldberg Regional Localization of Suspensor mRNAs during Early Embryo Development PLANT CELL, November 1, 2001; 13(11): 2409 - 2425. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, K. H. Nam, D. Vafeados, and J. Chory BIN2, a New Brassinosteroid-Insensitive Locus in Arabidopsis Plant Physiology, September 1, 2001; 127(1): 14 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Eckardt New Insights into Auxin Biosynthesis PLANT CELL, January 1, 2001; 13(1): 1 - 3. [Full Text] |
||||
![]() |
S. Bak, F. E. Tax, K. A. Feldmann, D. W. Galbraith, and R. Feyereisen CYP83B1, a Cytochrome P450 at the Metabolic Branch Point in Auxin and Indole Glucosinolate Biosynthesis in Arabidopsis PLANT CELL, January 1, 2001; 13(1): 101 - 111. [Abstract] [Full Text] |
||||
![]() |
P. S. Springer Gene Traps: Tools for Plant Development and Genomics PLANT CELL, July 1, 2000; 12(7): 1007 - 1020. [Abstract] [Full Text] |
||||
![]() |
R. C. Meissner, H. Jin, E. Cominelli, M. Denekamp, A. Fuertes, R. Greco, H. D. Kranz, S. Penfield, K. Petroni, A. Urzainqui, et al. Function Search in a Large Transcription Factor Gene Family in Arabidopsis: Assessing the Potential of Reverse Genetics to Identify Insertional Mutations in R2R3 MYB Genes PLANT CELL, October 1, 1999; 11(10): 1827 - 1840. [Abstract] [Full Text] |
||||
![]() |
A. F. Tissier, S. Marillonnet, V. Klimyuk, K. Patel, M. A. Torres, G. Murphy, and J. D. G. Jones Multiple Independent Defective Suppressor-mutator Transposon Insertions in Arabidopsis: A Tool for Functional Genomics PLANT CELL, October 1, 1999; 11(10): 1841 - 1852. [Abstract] [Full Text] |
||||
![]() |
E. Speulman, P. L. J. Metz, G. van Arkel, B. te Lintel Hekkert, W. J. Stiekema, and A. Pereira A Two-Component Enhancer-Inhibitor Transposon Mutagenesis System for Functional Analysis of the Arabidopsis Genome PLANT CELL, October 1, 1999; 11(10): 1853 - 1866. [Abstract] [Full Text] |
||||
![]() |
C. Somerville and S. Somerville Plant Functional Genomics Science, July 16, 1999; 285(5426): 380 - 383. [Abstract] [Full Text] |
||||
![]() |
C. H. Hansen, L. Du, P. Naur, C. E. Olsen, K. B. Axelsen, A. J. Hick, J. A. Pickett, and B. A. Halkier CYP83B1 Is the Oxime-metabolizing Enzyme in the Glucosinolate Pathway in Arabidopsis J. Biol. Chem., June 29, 2001; 276(27): 24790 - 24796. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-F. Chuang and E. M. Meyerowitz Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana PNAS, April 25, 2000; 97(9): 4985 - 4990. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|