Plant Physiol. (1999) 119: 101-110
Regulation of Ferulate-5-Hydroxylase Expression in Arabidopsis in
the Context of Sinapate Ester Biosynthesis1
Max Ruegger,
Knut Meyer2,
Joanne C. Cusumano, and
Clint Chapple*
Department of Biochemistry, Purdue University, West Lafayette,
Indiana 47907-1153
 |
ABSTRACT |
Sinapic
acid is an intermediate in syringyl lignin biosynthesis in angiosperms,
and in some taxa serves as a precursor for soluble secondary
metabolites. The biosynthesis and accumulation of the sinapate esters
sinapoylglucose, sinapoylmalate, and sinapoylcholine are
developmentally regulated in Arabidopsis and other members of the
Brassicaceae. The FAH1 locus of Arabidopsis encodes the enzyme ferulate-5-hydroxylase (F5H), which catalyzes the rate-limiting step in syringyl lignin biosynthesis and is required for the production of sinapate esters. Here we show that F5H expression
parallels sinapate ester accumulation in developing siliques and
seedlings, but is not rate limiting for their biosynthesis. RNA
gel-blot analysis indicated that the tissue-specific and
developmentally regulated expression of F5H mRNA is
distinct from that of other phenylpropanoid genes. Efforts to identify
constructs capable of complementing the sinapate ester-deficient
phenotype of fah1 mutants demonstrated that
F5H expression in leaves is dependent on sequences 3
of
the F5H coding region. In contrast, the positive regulatory function of the downstream region is not required for F5H transcript or sinapoylcholine accumulation in
embryos.
 |
INTRODUCTION |
Many investigations of plant metabolic pathways, gene regulation,
and DNA transposition have exploited the dispensable nature of
phenylpropanoid compounds. Most of these efforts have focused on
phlobaphenes and anthocyanins because these conspicuous pathway end
products have greatly facilitated genetic analyses. These investigations have resulted in the isolation and characterization of
genes encoding enzymes and transcription factors required for the
accumulation of these secondary metabolites (for review, see Dooner et
al., 1991
). In Arabidopsis phenylpropanoid metabolism gives rise to
flavonoids, lignin, and sinapic acid esters. Mutants of Arabidopsis
that are altered in flavonoid biosynthesis are collectively known as
transparent testa mutants because these mutations decrease
or eliminate the flavonoid-based condensed tannins that pigment the
seed coat. Some of these loci have been shown to encode biosynthetic
enzymes and others encode regulatory proteins (Koornneef, 1990
; Shirley
et al., 1995
). Although flavonoid biosynthesis in Arabidopsis has been
studied extensively at the genetic and molecular levels, much less is
known about the genes involved in the biosynthesis of sinapic acid
esters. Because these compounds are dispensable under laboratory
conditions (Chapple et al., 1992
), they provide additional targets for
the genetic analysis of phenylpropanoid metabolism.
Arabidopsis and other members of the Brassicaceae accumulate three
major sinapic acid esters, sinapoylglucose, sinapoylcholine, and
sinapoylmalate (Fig. 1) (Bouchereau et
al., 1991
; Chapple et al., 1992
), and the relative abundance of each of
these compounds is regulated developmentally during the plant's life
cycle (Strack, 1977
; Mock et al., 1992
; Lorenzen et al., 1996
).
Leaves contain only sinapoylmalate, whereas seeds accumulate primarily
sinapoylcholine and smaller amounts of sinapoylglucose. During seed
development de novo synthesis of sinapic acid leads to the production
of sinapoylcholine. Through a series of interconversion reactions that
are initiated upon imbibition, seed sinapoylcholine reserves provide
the phenylpropanoid moiety for the synthesis of sinapoylmalate in
expanding cotyledons. As seeds germinate, sinapoylcholine is hydrolyzed
to yield sinapic acid, which is then re-esterified by sinapic acid:UDPG
sinapoyltransferase to form sinapoylglucose. Sinapoylglucose is
subsequently converted to sinapoylmalate by the activity of
sinapoylglucose:malate sinapoyltransferase (Strack, 1982
; Lorenzen et
al., 1996
). These interconversions are complete at approximately d 6 of
seedling development, when de novo synthesis of sinapic acid
contributes to the accumulation of sinapoylmalate in developing
leaves.

View larger version (16K):
[in this window]
[in a new window]
| Figure 1.
The phenylpropanoid pathway and the pathways
leading to sinapate esters in Arabidopsis. CCoA OMT, Caffeoyl CoA
O-methyltransferase; C3H,
p-coumarate-3-hydroxylase; pCCoA 3H,
p-coumaroyl CoA-3-hydroxylase; SCE,
sinapoylcholinesterase; SCT, sinapoylglucose:choline
sinapoyltransferase; SGT, sinapic acid:UDPG sinapoyltransferase; SMT,
sinapoylglucose:malate sinapoyltransferase. The enzyme catalyzing the
step from sinapic acid to sinapoyl CoA is shown as "4CL?" to
reflect the uncertainty surrounding the identity of the protein
involved.
|
|
Sinapate esters can be visualized by their blue fluorescence under UV
light both in vivo and after TLC separation. The ease with which these
compounds can be detected has facilitated the isolation of mutants
defective in sinapate ester synthesis. These mutants have provided
insights into the biological function of sinapate esters, and have
enabled the isolation of genes involved in their synthesis. The best
studied of these mutants is the sinapoylmalate-deficient fah1 mutant (Chapple et al., 1992
). Experiments with
fah1 demonstrated that sinapoylmalate is an important UV-B
sunscreen in Arabidopsis (Landry et al., 1995
), and cloning of the
FAH1 gene revealed that it encodes F5H, a Cyt P450-dependent
monooxygenase required for the synthesis of sinapate esters and sinapic
acid-derived syringyl lignin (Meyer et al., 1996
). It has since been
shown that F5H catalyzes the rate-limiting step in syringyl lignin
biosynthesis, and that its expression determines the monomer
composition of the lignin in xylem and sclerified parenchyma (Meyer et
al., 1998
). Arabidopsis xylem cell walls contain only ferulic
acid-derived guaiacyl lignin, whereas the interfascicular parenchyma of
the rachis deposits syringyl lignin. When transformed with F5H
ectopic-overexpression constructs, plants deposit syringyl-rich lignin
in all cells that normally lignify, indicating that F5H is an important
regulatory site for hydroxycinnamic acid production, at least with
respect to lignin biosynthesis.
We investigated F5H expression in Arabidopsis in the context
of sinapate ester biosynthesis. These experiments indicate that F5H transcript accumulation is regulated in a manner
distinct from that of other phenylpropanoid genes. Furthermore,
F5H expression in leaves is dependent on a regulatory domain
that is located 3
of the F5H stop codon, whereas its
expression in embryos is independent of this downstream element.
Although the pattern of F5H expression is consistent with a
role for F5H in the determination of sinapate ester content,
overexpression of F5H does not alter the temporal or
tissue-specific regulation of sinapate ester accumulation. Thus,
although F5H catalyzes the rate-limiting step in syringyl lignin
biosynthesis, these findings cannot be extrapolated to imply a
regulatory role for F5H in the biosynthesis of all sinapic acid-derived
metabolites.
The accession number for the sequence reported in this article is
AF068574.
 |
MATERIALS AND METHODS |
Plant Material and Growth Conditions
Arabidopsis plants were grown under a 16-h light/8-h
dark photoperiod in potting mix (ProMix, Premier Horticulture, Red
Hill, PA) at 22°C. For the growth of seedlings under axenic
conditions, seeds were surface-sterilized in 30% (v/v) commercial
bleach containing 0.07% (v/v) Triton X-100, rinsed, and sown on plates
containing modified Murashige-Skoog medium lacking ammonium nitrate, as
described previously (Lorenzen et al., 1996
).
RNA Analysis
For the isolation of RNA, plant tissues were harvested, frozen in
liquid nitrogen, and stored at
70°C until ready for extraction. Total RNA was isolated as described previously (Goldsbrough and Cullis,
1981
). Samples were electrophoretically separated, transferred to
membranes (Hybond N+, Amersham), hybridized at
65°C, washed, and exposed to film. DNA probes for the Arabidopsis
genes encoding 4CL (Lee et al., 1995
), C4H (Bell-Lelong et al., 1997
),
F5H (Meyer et al., 1996
), OMT (Arabidopsis expressed sequence tag no.
12052; clone no. 154J19T7), and PAL (PAL1, PAL2, and PAL3) (Wanner
et al., 1995
) were made using the DECAprime II system (Ambion,
Austin, TX).
DNA Analysis and Sequencing
Genomic Arabidopsis DNA carrying the F5H coding
sequence and 5
and 3
regulatory regions was subcloned into
pGEM-7Zf(+) (Promega) or pMBL18 (Nakano et al., 1995
) for manual
(Sequenase kit version 2.0 [United States Biochemical]) or automated
(model 373A sequencer [Applied Biosystems] or model ALF Express
sequencer [Pharmacia]) sequencing. The position of the T-DNA
insertion in the fah1-9 allele was determined by cloning and
sequencing a 0.5-kb PCR product made by amplification of the junction
between the T-DNA right border and the F5H
genomic DNA using the PCR primers GCCAACCACGCGCCTCATCT (F5H)
and GTCACCTTAGGCGACTTTTGA (T-DNA right border). The F5H transcription start site was determined by primer extension as described previously (Bell-Lelong et al., 1997
) using the primer GAGACGTCGTGGGATCTGATAG.
Construction of Transgenic Lines
Standard techniques were used for DNA manipulations (Sambrook et
al., 1989
). The isolation of cosmid pBIC20-F5H, the construction of
plasmids 35S-F5H and C4H-F5H, and the introduction of these three
constructs into the fah1-2 mutant line was described
previously (Meyer et al., 1996
, 1998
). The F5H(HX) construct was made
by ligating a 5.15-kb HindIII-XhoI fragment,
derived from pBIC20-F5H and containing the F5H promotor and
coding region, into the binary vector pGA482 (An, 1987
). This plasmid
was transformed into the fah1-2 mutant by vacuum
infiltration (Bent et al., 1994
), as described previously (Bell-Lelong
et al., 1997
). Two representative lines containing a single T-DNA
insertion were made homozygous and used for subsequent experiments.
Analysis of Sinapate Esters
Sinapate esters were extracted from plant tissues in 50% methanol
containing 0.75% (v/v) phosphoric acid. A 20-µL sample of each
extract was analyzed by HPLC on a C18 column
(Microsorb-MV, Rainin Instruments, Woburn, MA) using a gradient from
1.5% phosphoric acid to 35% acetonitrile in 1.5% phosphoric acid for
elution and UV detection at 335 nm. Sinapate esters were quantitated
using the extinction coefficient of sinapic acid. For TLC analyses, seed sinapate esters were extracted in 50% methanol and separated on
silica gel K6 TLC plates (Whatman) using a solvent mixture of
n-butanol, acetic acid, and water (5:2:3, v/v), and
visualized under UV light.
 |
RESULTS |
F5H Transcript Accumulation Is Distinct from That of
Other Phenylpropanoid Pathway Genes
To evaluate the tissue specificity of F5H expression,
the abundance of F5H transcript in various organs of
wild-type Arabidopsis was examined (Fig.
2). RNA-blot analysis using the
F5H cDNA (Meyer et al., 1996
) as a probe indicated that
F5H mRNA accumulated in all tissues examined. As a fraction
of total RNA, the highest level of F5H message was found in
the rachi, which is consistent with the role of F5H in lignin
biosynthesis. F5H expression in mature leaves was
substantially lower than that in older or younger leaves.

View larger version (70K):
[in this window]
[in a new window]
| Figure 2.
F5H transcript accumulation in tissues of
wild-type Arabidopsis. Total RNA was extracted from the tissues
indicated and probed with the F5H cDNA in RNA-blot
analysis. The bottom panel illustrates ethidium-bromide staining of
rRNA as a loading control.
|
|
To compare the expression of F5H with that of other
phenylpropanoid genes, we determined their mRNA levels in developing
light- and dark-grown seedlings and in seedlings grown in the dark for 4 d before transfer to the light. Except for a weak signal in 1-d-old seedlings, F5H transcript was nearly undetectable in
dark-grown seedlings and in light-grown plants before d 3 (Fig.
3A). In light-grown seedlings
F5H mRNA increased slowly over the remainder of the 10-d
experimental period. When dark-grown seedlings were shifted to light
conditions, F5H transcript levels increased during the next
6 d at approximately the same rate as in light-grown seedlings. This pattern of expression differed from that of the other genes examined. The mRNA of PAL1, PAL2, C4H,
OMT, and 4CL accumulated more rapidly than that
of F5H in light-grown seedlings, reaching maximal levels
within 4 d of planting (Fig. 3B). In etiolated seedlings mRNAs
corresponding to all of these genes were readily detectable, but were
generally lower than in light-grown plants. These transcripts still
reached maximal levels in the dark within 4 d of planting, but
then gradually decreased. In the shift experiments transcripts reached
maximal levels within 2 d after transfer to the light. Consistent
with a previous report (Wanner et al., 1995
), PAL3 mRNA
accumulation was undetectable at all time points tested (data not
shown).

View larger version (34K):
[in this window]
[in a new window]
| Figure 3.
Transcript accumulation of phenylpropanoid genes
during seedling development. Arabidopsis seedlings were germinated and
grown under aseptic conditions on modified Murashige-Skoog agar plates
(Lorenzen et al., 1996 ) in light (L; 16-h light/8-h dark photoperiod),
in darkness (D), or in darkness for 4 d before being shifted to
light conditions (D L). Total RNA was extracted on the days indicated
and RNA analysis was performed using probes from cDNAs of the indicated
genes. A, Total RNA from wild-type seedlings probed with the
F5H cDNA. The lower panel illustrates ethidium-bromide
staining of rRNA as a loading control. B, Total RNA from wild-type
seedlings probed with cDNAs corresponding to the phenylpropanoid genes
indicated. C, Total RNA from a fah1-2: F5H(HX)
transgenic line probed with the F5H cDNA. All blots were
exposed to film for 24 h except PAL2, which was exposed for
48 h.
|
|
Sinapoylmalate Accumulation in Seedlings Does Not Change in
Response to Constitutive Expression of F5H
To correlate the results of the previous expression analysis with
phenylpropanoid metabolism, the interconversion and biosynthesis of
sinapate esters was evaluated in germinating light- and dark-grown wild-type seedlings (Fig. 4). In
light-grown wild-type seedlings, the levels of sinapoylcholine
decreased to undetectable levels by d 3. Coincident with this decrease
in sinapoylcholine was a transient increase in sinapoylglucose, which
peaked between d 2 and 3. By d 4 sinapoylglucose levels had decreased
to nearly undetectable levels. Sinapoylmalate, which is undetectable in seeds, began to accumulate by d 2 and increased until at d 6 it was the
dominant sinapate ester. By this time its levels approximated the total sinapate ester content of seeds. Sinapoylmalate continued to increase in abundance each day thereafter, indicating that
de novo synthesis begins to contribute to the sinapate ester content of
wild-type seedlings at approximately d 6. In dark-grown wild-type
seedlings, the levels of sinapoylcholine and sinapoylglucose were found
to be nearly the same as in light-grown seedlings for the first 2 d after imbibition.

View larger version (25K):
[in this window]
[in a new window]
| Figure 4.
Accumulation of sinapate esters in wild-type and
transgenic fah1 Arabidopsis seedlings. Wild-type
seedlings and transgenic fah1-2 seedlings were grown on
modified Murashige-Skoog agar plates as described for Figure 3.
Sinapate esters were fractionated by HPLC, detected at 335 nm, and
quantitated using the extinction coefficient of sinapic acid. Each
point represents the average of three replicates of 10 seedlings
each ± SE. Top row, Seedlings grown in the light
(open symbols). Bottom row, Seedlings grown in the dark (solid lines,
solid symbols) or shifted from dark to light on d 4 (dotted lines, open
symbols). Circles, Sinapoylcholine; triangles, sinapoylglucose;
squares, sinapoylmalate.
|
|
During the next 8 d the levels of sinapoylglucose and, to a lesser
extent, sinapoylcholine remained elevated, and sinapoylmalate failed to
accumulate. The total sinapate ester content of dark-grown seedlings
never exceeded the levels found in seeds, suggesting that de novo
synthesis was not initiated under these conditions. When dark-grown
seedlings were transferred to the light on d 4, sinapoylglucose levels
decreased and sinapoylmalate levels increased gradually, indicating
that transfer to the light permitted the completion of the
interconversion phase and the onset of the de novo phase of sinapate
ester biosynthesis. In both light- and dark-grown seedlings transferred
to the light, the onset of de novo sinapate ester biosynthesis
coincided with the initiation of F5H mRNA
accumulation, which is consistent with the hypothesis that
F5H expression regulates the biosynthesis of these metabolites in developing Arabidopsis seedlings.
To test the hypothesis that de novo accumulation of sinapoylmalate in
seedlings is determined at the level of F5H expression, sinapate ester content was compared in light- and dark-grown transgenic seedlings constitutively expressing F5H (Fig. 4). If
F5H expression were rate limiting for de novo sinapoylmalate
biosynthesis, it would be expected that its constitutive expression
would cause a precocious accumulation of sinapoylmalate in light-grown
seedlings and possibly permit its accumulation in etiolated seedlings.
Instead, constitutive expression of F5H under the direction
of the CaMV 35S promoter in the fah1-2:35S-F5H transgenic
line (Fig. 5) had virtually no effect on
the onset of sinapoylmalate biosynthesis (Fig. 4). This result argues
that F5H expression is not a control point for the temporal
regulation of sinapoylmalate accumulation. Furthermore, the absence of
sinapoylmalate in dark-grown fah1-2:35S-F5H seedlings
suggests that additional light-dependent factors are required for
sinapoylmalate accumulation in etiolated seedlings.

View larger version (13K):
[in this window]
[in a new window]
| Figure 5.
Diagrammatic representation of the
F5H gene and F5H transgenes used in this
study. Exons are represented by open rectangles. A, F5H
genomic region. An inverted triangle indicates the location of a T-DNA
insertion in the fah1-9 mutant. B, Constructs used for
F5H expression analysis in the fah1-2
mutant background. 35S, CaMV 35S promoter; E, EcoRI; H,
HindIII; K, KpnI; S,
SacI; X, XhoI.
|
|
F5H Expression Does Not Determine Sinapoylmalate Distribution in
Mature Leaves
The distribution of sinapoylmalate in Arabidopsis leaves can be
visualized by examining plants under UV light. Sinapoylmalate leads to
a blue-green fluorescence in the adaxial epidermis, whereas the abaxial
epidermis fluoresces red. The adaxial surfaces of rosette leaves of
wild type, fah1-2, and the fah1-2 transgenic lines are indistinguishable when observed under white light (Fig. 6). Under UV light sinapoylmalate in
leaves of the wild-type and the fah1-2:35S-F5H and
fah1-2:C4H-F5H transgenic plants (Fig. 5) causes them to
appear blue-green. In contrast, the leaves of the fah1
mutant appear red because they lack sinapoylmalate (Chapple et al.,
1992
). These data are consistent with previous biochemical analyses
showing that the 35S-F5H and C4H-F5H constructs are capable of
complementing the fah1-2 mutant phenotype (Meyer et al.,
1996
, 1998
). Under UV illumination the abaxial surfaces of the
wild-type, mutant, and transgenic leaves appear red (Fig. 6),
indicating the absence of sinapoylmalate. Thus, ectopic
overexpression of F5H did not lead to the accumulation
of sinapoylmalate in the abaxial leaf epidermis. Although
F5H expression determines the spatial deposition of syringyl
units in lignifying tissues (Meyer et al., 1998
), this result
demonstrates that ectopic F5H expression is not sufficient
to lead to sinapoylmalate accumulation in the abaxial leaf epidermis.

View larger version (27K):
[in this window]
[in a new window]
| Figure 6.
Leaves of wild type, fah1-2, and
transgenic lines as viewed under visible and UV light. Top panel,
Adaxial leaf surfaces illuminated by visible light; middle panel,
adaxial leaf surfaces illuminated by UV light; bottom panel, abaxial
leaf surfaces illuminated by UV light (peak wavelength = 302 nm).
|
|
Sinapoylcholine Accumulation in Embryos Is Not Regulated at the
Level of F5H Transcription
We examined F5H transcript accumulation in
developing siliques of the wild type and various transgenic lines to
investigate whether F5H expression could be the control
point for sinapoylcholine biosynthesis in developing embryos (Fig.
7). For the collection of these data
total RNA was prepared from siliques of the primary inflorescence that
had been sampled in pairs, beginning with the first expanding silique.
F5H mRNA in transgenic fah1-2 plants can only be
the result of transgene expression, because the mutant lacks endogenous
F5H transcript (Meyer et al., 1996
). In the wild type F5H
mRNA was nearly undetectable in the first five silique pairs and
increased gradually thereafter. The pattern of F5H
expression was similar in the fah1-2:pBIC20-F5H line. In
contrast, a high level of F5H transcript was detected in the
youngest siliques of both the fah1-2:35S-F5H and the
fah1-2:C4H-F5H lines and this level remained relatively
constant over the course of silique development. To determine whether
the alteration of F5H expression had an effect on sinapate
ester biosynthesis, the accumulation of sinapoylcholine was examined in
comparable siliques (Fig. 8). As expected
from earlier studies (Chapple et al., 1992
), this compound was nearly
undetectable in the fah1-2 mutant. In the wild type,
sinapoylcholine was first detected in the fifth to seventh silique
pairs, and its accumulation paralleled the increase in F5H
expression. Although these data were consistent with a regulatory role
for F5H expression, overexpression of F5H had no
effect on the developmental onset of sinapoylcholine accumulation (Fig.
8). It seems unlikely that transcriptional regulation of F5H
is a control point for sinapoylcholine biosynthesis in embryos.

View larger version (74K):
[in this window]
[in a new window]
| Figure 7.
Accumulation of F5H transcript in
developing siliques. Siliques were collected in pairs from 5-week-old
plants of the lines indicated, beginning with the first expanding
silique. Total RNA was extracted and probed with the F5H
cDNA in RNA analysis. Blots were exposed to film for 24 h
(fah1-2:35S-F5H and fah1-2:C4H-F5H) or
48 h. The bottom panel illustrates ethidium-bromide staining of
rRNA as a loading control. Col, Arabidopsis ecotype Columbia.
|
|

View larger version (26K):
[in this window]
[in a new window]
| Figure 8.
Accumulation of sinapoylcholine in developing
siliques. Siliques were collected in pairs as described for Figure 7
and extracted in acidic 50% methanol. Sinapoylcholine was quantified
by HPLC as described for Figure 4. Each point represents the average of
three replicates of three silique pairs ± SE. Col,
Arabidopsis ecotype Columbia.
|
|
Sequences Downstream of the F5H Gene Are Required to
Complement the fah1 Mutant Phenotype
The pBIC20-F5H cosmid contains 2.5 kb of DNA upstream and
approximately 12.5 kb of DNA downstream of the F5H
coding region (Fig. 5) and complements both the sinapoylmalate and
syringyl lignin deficiencies of the fah1-2 mutant (Meyer et
al., 1996
). Similarly, transformation of the mutant with constructs in
which expression of the F5H gene is driven by the CaMV 35S
promoter (Odell et al., 1985
) or the Arabidopsis C4H promoter
(Bell-Lelong et al., 1997
) restores all of the wild-type phenotypes
(Meyer et al., 1996
, 1998
; this study). To further delimit the region of DNA sufficient to direct F5H gene expression, the plasmid
F5H(HX) (Fig. 5) was introduced into fah1-2 plants. Despite
having the same upstream DNA as pBIC20-F5H and the same amount of
downstream DNA as the 35S-F5H and C4H-F5H constructs, observation under
UV light of more than 50 independent transgenic lines indicated that F5H(HX) failed to complement the fah1-2 mutant phenotype
(Fig. 6; data not shown). To explore this observation further,
F5H mRNA abundance was examined in homozygous
fah1-2:F5H(HX) transgenic seedlings. These analyses
indicated that F5H transcript in fah1-2:F5H(HX) seedlings on d 1 (Fig. 3C) was similar to that in the wild type (Fig.
3A), but that there was no subsequent increase in F5H mRNA.
Although sinapoylmalate is absent in mature fah1-2:F5H(HX)
plants, initial experiments demonstrated its presence in young seedlings (data not shown). To further explore these preliminary observations, the levels of sinapate esters were measured in developing fah1-2:F5H(HX) seedlings (Fig. 4). The sinapate ester
profile of these seedlings was nearly identical to that of the wild
type during the first 4 d of development. Thereafter,
sinapoylmalate levels remained constant, which is consistent with the
absence of F5H mRNA accumulation in seedlings of this
transgenic line (Fig. 3C) and the requirement of F5H
expression for de novo sinapoylmalate biosynthesis.
fah1-2:F5H(HX) seeds (d 0) contained wild-type levels of sinapoylcholine. These data indicate that F5H must have
been expressed during the development of the embryos within these
seeds. As predicted by the presence of sinapoylcholine in
fah1-2:F5H(HX) seeds (Fig. 4), developing siliques also
accumulated sinapoylcholine (Fig. 8) and F5H transcript
(Fig. 7). The high level of F5H expression in this line is
likely the result of a transgene positional effect, because a second
fah1-2:F5H(HX) line accumulated approximately wild-type
levels of F5H transcript in maturing siliques (data not
shown).
Our results indicate that the 630 bp of 3
DNA in the 35S-F5H, C4H-F5H,
and F5H(HX) constructs was sufficient for expression and mRNA stability
in leaves when F5H was driven with a heterologous promoter,
but in vegetative tissue F5H expression required additional downstream DNA in the context of its own promoter. From these data we
conclude that an element in this downstream DNA functions as a positive
regulator of gene expression. In contrast, the presence of F5H
transcript (Fig. 7) and sinapoylcholine (Fig. 8) in
fah1-2:F5H(HX) embryos indicates that the F5H
3
-flanking DNA is not required for F5H expression in
developing embryos.
A T-DNA Insertion in the Downstream DNA of the
fah1-9 Allele Results in a Phenotype That Is Similar to
That of the fah1-2:F5H(HX) Transgenic Line
To determine how the T-DNA insertion in the
fah1-9 allele leads to the mutant phenotype (Meyer et
al., 1996
), its position was determined by the cloning and sequencing
of a PCR product made from the T-DNA right border-F5H
junction. The T-DNA right border was found to be 283 bp 3
of the
F5H stop codon and 38 bp downstream of the F5H
polyadenylation site (Fig. 5). This observation suggested that the
T-DNA may interfere with the regulatory functions of the F5H
3
DNA. Because the 3
-flanking DNA is not required for F5H
expression in embryos, this hypothesis would predict that the
F5H gene would be transcribed in fah1-9 embryos
and would permit sinapate ester accumulation. Indeed, sinapoylcholine
is present at approximately wild-type levels in fah1-9 seeds
(Fig. 9). Together with the observation
that fah1-9 homozygotes fail to accumulate sinapoylmalate in
leaves, these results provide independent genetic evidence for the
regulatory role of the 3
region of the F5H gene and its
tissue-specific function.

View larger version (47K):
[in this window]
[in a new window]
| Figure 9.
Sinapate ester accumulation in seeds of the
fah1-9 mutant. Seed extracts were separated by TLC and
photographed under UV light. Col, Arabidopsis ecotype Columbia; WS,
Arabidopsis ecotype Wassilewskija.
|
|
 |
DISCUSSION |
Tracheophytes accumulate myriad phenylpropanoid derivatives that
range from taxon-specific flavonoids and simple phenylpropanoid glucosides and esters to the more complex and ubiquitous
phenylpropanoid polymer lignin. The sinapic acid esters sinapoylmalate
and sinapoylcholine are most commonly found in members of the
Brassicaceae. In Arabidopsis these compounds provide convenient
endogenous fluorescent reporters of the activity of the phenylpropanoid
pathway and the enzymes specific to sinapate ester biosynthesis. Using
these markers in combination with conventional molecular approaches, we
have demonstrated that F5H expression is modulated
independently of other phenylpropanoid pathway genes in Arabidopsis,
but does not regulate sinapate ester accumulation. These studies have
also shown that F5H expression involves a regulatory element
located 3
of its stop codon, a feature not previously associated with
phenylpropanoid pathway gene regulation.
Comparison of F5H Expression with That of Other Phenylpropanoid
Genes
The core phenylpropanoid biosynthetic genes (PAL,
C4H, and 4CL) are expressed at relatively high
basal levels even in dark-grown plants, and these transcripts increase
in response to light and wounding (Hahlbrock and Scheel, 1989
; Ohl et
al., 1990
; Logemann et al., 1995
; Bell-Lelong et al., 1997
; Mizutani et
al., 1997
). In contrast, the basal level of F5H expression
in etiolated seedlings is very low compared with that of light-grown
seedlings. In this respect F5H mRNA accumulation resembles
that of the Arabidopsis flavonoid biosynthetic genes encoding chalcone
synthase, chalcone isomerase, and dihydroflavonol reductase in
developing dark-grown seedlings (Kubasek et al., 1992
). The regulation
of F5H is distinct, however, because in light-grown
seedlings transcript levels for these three flavonoid genes peak at
d 3 to 4 of growth and then decrease to nearly undetectable levels. The
expression of PAL, C4H, OMT, and
4CL shows a similar increase at d 4, although their transcripts persist at higher levels than those of the flavonoid genes
during the next week of growth (Kubasek et al., 1992
; this study). In
contrast, F5H mRNA accumulates continuously for the first
10 d of seedling development.
In mature plants F5H mRNA was found in all organs examined,
but was most abundant in the rachis, which is consistent with the role
of F5H in the lignification of the sclerified interfascicular parenchyma. F5H transcript was also abundant in young
leaves, where it is required for the synthesis of UV-protective
sinapoylmalate during leaf expansion. The relatively low levels of
F5H mRNA in mature leaves may suggest that the
sinapoylmalate synthesized in young leaves is relatively stable and can
serve as a UV protectant during the lifetime of the leaf.
Alternatively, it may indicate that the F5H protein has a long
half-life and can support continued synthesis of sinapoylmalate.
The high levels of F5H mRNA in senescent leaves are more
difficult to explain, because sinapoylmalate levels are known to decline in older rosettes (Chapple et al., 1992
). High levels of
transcript in these leaves may reflect continued synthesis of
sinapoylmalate coupled with rapid turnover or fortuitous expression that is not correlated with secondary metabolite production caused by a
limitation imposed by another step in the biosynthetic pathway. The
high level of expression in roots is also surprising, because we have
not been able to detect substantial levels of sinapate-derived metabolites in this tissue (M. Ruegger and C. Chapple, unpublished results). C4H is also highly expressed in Arabidopsis roots
(Bell-Lelong et al., 1997
), suggesting that phenylpropanoid gene
expression is activated for the production of compounds that have not
yet been identified, perhaps because of secretion or transport to the
aerial portion of the plant. Alternatively, the levels of F5H expression in roots and senescent leaves may represent
stress induction of phenylpropanoid gene expression. We believe that this is unlikely because, although many experiments have demonstrated the wound inducibility of the core phenylpropanoid genes (Ohl et al.,
1990
; Bell-Lelong et al., 1997
; Mizutani et al., 1997
), we have been
unable to detect wound induction of F5H transcript (data not
shown).
F5H Is Not a Regulatory Site for Sinapate Ester
Biosynthesis
By using alternative promoters to overexpress
F5H, we have demonstrated that its transcription
regulates the flux of phenylpropanoid precursors through sinapic acid
and toward syringyl lignin in lignifying cells of Arabidopsis (Meyer et
al., 1998
). The same study also showed that xylem-targeted expression
of F5H was sufficient to permit the deposition of syringyl
lignin in cells that normally accumulate only guaiacyl lignin. In
contrast, although F5H expression parallels the accumulation
of sinapate esters in developing seedlings and siliques, overexpression
of F5H has no effect on the temporal regulation of their
appearance. Similarly, although sinapoylmalate is distributed in a
tissue-specific fashion, ectopic expression of F5H is not
sufficient to permit its accumulation in the abaxial epidermis. It
could be argued that, as in previous lignin-modification studies,
F5H expression must be targeted to the specific cells in
which sinapate esters are made and that our overexpression constructs
failed to do so. On the other hand, we believe that sinapate ester
synthesis is a cell-autonomous trait, and because C4H activity is
required for sinapate ester synthesis, the C4H promoter
should effectively target F5H expression to the correct
cells. Thus, although F5H expression does control the
biosynthesis of syringyl lignin, we conclude that it does not have a
general regulatory role in the production of sinapic acid-derived
metabolites.
These results leave open the question of how sinapate ester synthesis
is regulated in Arabidopsis. It seems unlikely that sinapoylmalate
synthesis is regulated by the activity of sinapoylglucose:malate sinapoyltransferase, because sinapoylglucose does not accumulate in
wild-type leaves. Sinapoylglucose:choline sinapoyltransferase may be a
regulatory point in sinapoylcholine synthesis, because low levels of
sinapoylglucose are found in seeds of the Columbia ecotype of
Arabidopsis. Free sinapic acid is found in neither seeds nor leaves,
suggesting that sinapic acid:UDPG sinapoyltransferase does not have a
regulatory role. Thus, steps earlier in the pathway probably regulate
the synthesis of sinapate esters. The light independence and rapid
accumulation of PAL, C4H, and OMT
mRNAs in developing seedlings make it unlikely that sinapate ester
synthesis is transcriptionally regulated within the phenylpropanoid
pathway. The expression pattern of these genes is very different from
the gradual and light-dependent increase in seedling sinapoylmalate content. The inability of F5H overexpression to alter
sinapoylcholine accumulation in siliques leads to a similar conclusion.
These data suggest that if sinapate ester biosynthesis is controlled
upstream of F5H, its regulation may be posttranscriptional in nature. Alternatively, transcriptional regulation may occur within
the shikimate pathway, which supplies Phe for phenylpropanoid biosynthesis. Finally, with regard to the adaxial specificity of
sinapoylmalate accumulation, the possibility that sinapate esters or
their precursors are synthesized and then transported to the upper
epidermis has not been excluded. Ectopic expression of F5H
would not be expected to alter a transport or source/sink mechanism
involved in such a movement of metabolites.
The Role of Downstream DNA in Gene Expression
The fah1-9 mutant and the fah1-2:F5H(HX)
transgenic lines failed to accumulate sinapoylmalate in their leaves.
In contrast, these same lines accumulated F5H transcript and
sinapoylcholine in developing siliques and seeds, indicating that the
3
-flanking DNA necessary for F5H expression in adult
tissues is not required for expression in embryos. A number of reports
have demonstrated the involvement of 3
-flanking DNA in plant gene
expression (Thornburg et al., 1987
; Dean et al., 1989
; Elliott et al.,
1989
; Dietrich et al., 1992
; Larkin et al., 1993
; Viret et al., 1994
;
Fu et al., 1995a
, 1995b
; Chinn et al., 1996
; Marshall et al., 1997
).
Downstream sequences have been shown to be required for gene expression
in response to wounding (Thornburg et al., 1987
), light (Viret et al.,
1994
), and Suc (Fu et al., 1995a
). They have also been shown to be
necessary for correct spatial expression either by activating (Dietrich
et al., 1992
; Larkin et al., 1993
) or repressing (Viret et al., 1994
)
gene expression. Certain 3
-flanking sequences are thought to act at
the level of transcriptional regulation (Dean et al., 1989
; Larkin et
al., 1993
; Viret et al., 1994
), whereas others are thought to affect
mRNA stability (Elliott et al., 1989
) or chromatin structure (Chinn et
al., 1996
).
The requirement for 3
-flanking sequences in F5H expression
further differentiates the regulation of F5H from that of
other phenylpropanoid genes. Thus, the regulatory factors that control F5H expression in Arabidopsis may be independent of those
that control upstream genes. This observation may be related to the fact that sinapate ester accumulation is taxonomically restricted, and
that sinapate-derived secondary metabolites are less common than
derivatives of hydroxycinnamic acids such as caffeic and ferulic acids.
A recombination or transposition event that positioned a regulatory
element downstream of the F5H-coding sequence early in the
evolutionary history of the Brassicaceae may have been critical to the
acquisition of the ability to express F5H and to accumulate
sinapic acid derivatives in leaf tissue.
The differential requirements for F5H expression in
seedlings and leaves versus embryos indicate that the 3
-flanking DNA may be a determining factor for tissue specificity. Although the mechanism underlying this activity remains to be characterized, our
preliminary results suggest that it is unlikely to involve mRNA
stabilization. The 35S-F5H and C4H-F5H constructs, both of which lack
the 3
DNA, lead to high levels of F5H mRNA in transformed plants (Meyer et al., 1996
, 1998
). These data suggest that the 3
region is not required for F5H transcript stability. On the other hand, these relatively strong promoters may compensate for the
absence of the stabilization provided by the 3
sequence, which might
be important in the context of the relatively weak F5H
promoter. Preliminary results indicate that the 3
DNA is required for
expression of an F5H promoter-driven GUS reporter gene in leaves and stems of adult plants, but is not required for
expression in embryos (M. Ruegger and C. Chapple, unpublished results).
These results also argue against a role for the 3
sequences in
transcript stability. By the addition of downstream restriction fragments to the F5H(HX) construct and complementation of the fah1 leaf phenotype, we have recently shown that sequences
that constitute this downstream regulatory element are contained within a 3326-bp region 3
of the F5H stop codon (M. Ruegger and C. Chapple, unpublished results).
The Utility of Sinapate Ester Accumulation as a Tool to Understand
Plant Gene Regulation
The ease of detection and dispensable nature of sinapate esters
make Arabidopsis an attractive model for the study of phenylpropanoid gene regulation. Although the requirement for 3
-flanking sequences has
been demonstrated for a number of plant genes, we are unaware of any
reports in which downstream cis-acting elements have been defined in detail or shown to be involved in phenylpropanoid gene expression. We believe that the study of secondary metabolism in
Arabidopsis, particularly with respect to F5H expression and sinapate ester accumulation, can provide critical insights into these
and other factors that regulate gene expression. The use of
F5H-containing transgenes for mutant complementation avoids issues associated with most reporter-gene experiments, such as stability of the transgene product and the elimination or altered spatial organization of cis-acting elements. Unlike many
reporter constructs, F5H transgenes contain a full
complement of cis-acting elements in their native
context. When introduced into the fah1 mutant, indirect but
quantitative assays of F5H activity and expression can be made by the
determination of sinapate ester content in embryos and leaves, and
syringyl lignin content in stems. Finally, the isolation of novel
sinapate ester-deficient mutants may lead to the identification of
trans-acting factors that regulate F5H and/or
other phenylpropanoid biosynthetic genes.
 |
FOOTNOTES |
1
This research was supported by the Division of
Energy Biosciences, U.S. Department of Energy (grant no.
DE-FG02-94ER20138 to C.C.), and by postdoctoral fellowships from the
Swiss National Science Foundation and the Alexander von Humboldt
Foundation (Feodor Lynen Fellowship) to K.M. This is journal paper no.
15, 853 of the Purdue University Agricultural Experiment
Station.
2
Present address: Shell Forestry Research Unit,
HRI East Malling, West Malling, Kent ME19 6BJ, United Kingdom.
*
Corresponding author; e-mail chapple{at}biochem.purdue.edu; fax
1-765-494-7897.
Received August 11, 1998;
accepted September 24, 1998.
 |
ABBREVIATIONS |
Abbreviations:
4CL, 4-hydroxycinnamoyl CoA ligase.
CaMV, cauliflower mosaic virus.
C4H, cinnamate-4-hydroxylase.
F5H, ferulate-5-hydroxylase.
OMT, caffeic acid/5-hydroxyferulic acid
O-methyltransferase.
PAL, Phe ammonia-lyase.
UDPG, UDP-Glc.
 |
LITERATURE CITED |
An G
(1987)
Binary Ti vectors for plant transformation and promoter analysis.
Methods Enzymol
153:
292-305
Bell-Lelong DA,
Cusumano JC,
Meyer K,
Chapple C
(1997)
Cinnamate-4-hydroxylase expression in Arabidopsis. Regulation in response to development and the environment.
Plant Physiol
113:
729-738
[Abstract]
Bent AF,
Kunkel BN,
Dahlbeck D,
Brown KL,
Schmidt R,
Giraudat J,
Leung J,
Staskawicz BJ
(1994)
RPS2 of Arabidopsis thaliana: a leucine-rich repeat class of plant disease resistance genes.
Science
265:
1856-1860
[Abstract/Free Full Text]
Bouchereau A,
Hamelin J,
Lamour I,
Renard M,
Larher F
(1991)
Distribution of sinapine and related compounds in seeds of Brassica and allied genera.
Phytochemistry
30:
1873-1881
[CrossRef]
Chapple CCS,
Vogt T,
Ellis BE,
Somerville CR
(1992)
An Arabidopsis mutant defective in the general phenylpropanoid pathway.
Plant Cell
4:
1413-1424
[Abstract/Free Full Text]
Chinn AM,
Payne SR,
Comai L
(1996)
Variegation and silencing of the Heat Shock Cognate 80 gene are relieved by a bipartite downstream regulatory element.
Plant J
9:
325-339
[Medline]
Dean C,
Favreau M,
Bond-Nutter D,
Bedbrook J,
Dunsmuir P
(1989)
Sequences downstream of translation start regulate quantitative expression of two petunia rbcS genes.
Plant Cell
1:
201-208
[Abstract/Free Full Text]
Dietrich RA,
Radke SE,
Harada JJ
(1992)
Downstream DNA sequences are required to activate a gene expressed in the root cortex of embryos and seedlings.
Plant Cell
4:
1371-1382
[Abstract/Free Full Text]
Dooner HK,
Robbins TP,
Jorgensen RA
(1991)
Genetic and developmental control of anthocyanin biosynthesis.
Annu Rev Genet
25:
173-199
[CrossRef][ISI][Medline]
Elliott RC,
Dickey LF,
White MJ,
Thompson WF
(1989)
cis-Acting elements for light regulation of pea ferredoxin I gene expression are located within transcribed sequences.
Plant Cell
1:
691-698
[Abstract/Free Full Text]
Fu H,
Kim SY,
Park WD
(1995a)
High-level tuber expression and sucrose inducibility of a potato Sus4 sucrose synthase gene require 5
and 3
flanking sequences and the leader intron.
Plant Cell
7:
1387-1394
[Abstract]
Fu H,
Kim SY,
Park WD
(1995b)
A potato Sus3 sucrose synthase gene contains a context-dependent 3
element and a leader intron with both positive and negative tissue-specific effects.
Plant Cell
7:
1395-1403
[Abstract]
Goldsbrough PB,
Cullis CA
(1981)
Characterization of the genes for ribosomal RNA in flax.
Nucleic Acids Res
9:
1301-1309
[Abstract/Free Full Text]
Hahlbrock K,
Scheel D
(1989)
Physiology and molecular biology of phenylpropanoid metabolism.
Annu Rev Plant Physiol Plant Mol Biol
40:
347-369
[CrossRef][ISI]
Koornneef M
(1990)
Mutations affecting the testa color in Arabidopsis.
Arabidopsis Inf Serv
28:
1-4
Kubasek WL,
Shirley BW,
McKillop A,
Goodman HM,
Briggs W,
Ausubel FM
(1992)
Regulation of flavonoid biosynthetic genes in germinating Arabidopsis seedlings.
Plant Cell
4:
1229-1236
[Abstract/Free Full Text]
Landry LG,
Chapple CCS,
Last R
(1995)
Arabidopsis mutants lacking phenolic sunscreens exhibit enhanced ultraviolet-B injury and oxidative damage.
Plant Physiol
109:
1159-1166
[Abstract]
Larkin JC,
Oppenheimer DG,
Pollock S,
Marks MD
(1993)
Arabidopsis GLABROUS1 gene requires downstream sequences for function.
Plant Cell
5:
1739-1748
[Abstract]
Lee D,
Ellard M,
Wanner LA,
Davis KR,
Douglas CJ
(1995)
The Arabidopsis thaliana 4-coumarate:CoA ligase (4CL) gene: stress and developmentally regulated expression and nucleotide sequence of its cDNA.
Plant Mol Biol
28:
871-884
[CrossRef][ISI][Medline]
Logemann E,
Parniske M,
Hahlbrock K
(1995)
Modes of expression and common structural features of the complete phenylalanine ammonia-lyase gene family in parsley.
Proc Natl Acad Sci USA
92:
5905-5909
[Abstract/Free Full Text]
Lorenzen M,
Racicot V,
Strack D,
Chapple C
(1996)
Sinapic acid ester metabolism in wild type and a sinapoylglucose-accumulating mutant of Arabidopsis.
Plant Physiol
112:
1625-1630
[Abstract]
Marshall JS,
Stubbs JD,
Chitty JA,
Surin B,
Taylor WC
(1997)
Expression of the C4 Me1 gene from Flaveria bidentis requires an interaction between 5
and 3
sequences.
Plant Cell
9:
1515-1525
[Abstract]
Meyer K,
Cusumano JC,
Somerville C,
Chapple CCS
(1996)
Ferulate-5-hydroxylase from Arabidopsis thaliana defines a new family of cytochrome P450-dependent monooxygenases.
Proc Natl Acad Sci USA
93:
6869-6874
[Abstract/Free Full Text]
Meyer K,
Shirley AM,
Cusumano JC,
Bell-Lelong DA,
Chapple C
(1998)
Lignin monomer composition is determined by the expression of a cytochrome P450-dependent monooxygenase in Arabidopsis.
Proc Natl Acad Sci USA
95:
6619-6623
[Abstract/Free Full Text]
Mizutani M,
Ohta D,
Sato R
(1997)
Isolation of a cDNA and a genomic clone encoding cinnamate 4-hydroxylase from Arabidopsis and its expression manner in planta.
Plant Physiol
113:
755-763
[Abstract]
Mock H-P,
Vogt T,
Strack D
(1992)
Sinapoylglucose:malate sinapoyltransferase activity in Arabidopsis thaliana and Brassica rapa.
Z Naturforsch
47c:
680-682
Nakano Y,
Yoshida Y,
Yamashita Y,
Koga T
(1995)
Construction of a series of pACYC-derived plasmid vectors.
Gene
162:
157-158
[CrossRef][ISI][Medline]
Odell JT,
Nagy F,
Chua N-H
(1985)
Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter.
Nature
313:
810-812
[CrossRef][Medline]
Ohl S,
Hedrick SA,
Chory J,
Lamb CJ
(1990)
Functional properties of a phenylalanine ammonia-lyase promoter from Arabidopsis.
Plant Cell
2:
837-848
[Abstract/Free Full Text]
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual, Ed 2.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Shirley BW,
Kubasek WL,
Storz G,
Bruggemann E,
Koorneef M,
Ausubel FM,
Goodman HM
(1995)
Analysis of Arabidopsis mutants deficient in flavonoid biosynthesis.
Plant J
8:
659-671
[CrossRef][ISI][Medline]
Strack D
(1977)
Sinapic acid ester fluctuations in cotyledons of Raphanus sativus.
Z Pflanzenphysiol
84:
139-145
Strack D
(1982)
Development of 1-O-sinapoyl-
-D-glucose:L-malate sinapoyltransferase activity in cotyledons of red radish (Raphanus sativus L. var. sativus).
Planta
155:
31-36
[CrossRef]
Thornburg RW,
An G,
Cleveland TE,
Johnson R,
Ryan CA
(1987)
Wound-inducible expression of a potato inhibitor II-chloramphenicol acetyltransferase gene fusion in transgenic tobacco plants.
Proc Natl Acad Sci USA
84:
744-748
[Abstract/Free Full Text]
Viret J-F,
Mabrouk Y,
Bogarad L
(1994)
Transcriptional photoregulation of cell-type-preferred expression of maize rbcS-m3: 3
and 5
sequences are involved.
Proc Natl Acad Sci USA
91:
8577-8581
[Abstract/Free Full Text]
Wanner LA,
Li G,
Ware D,
Somssich IE,
Davis KR
(1995)
The phenylalanine ammonia-lyase gene family in Arabidopsis thaliana.
Plant Mol Biol
27:
327-338
[CrossRef][Medline]