|
Plant Physiol. (1999) 119: 241-248
The Down-Regulation of Mt4-Like Genes by
Phosphate Fertilization Occurs Systemically and Involves Phosphate
Translocation to the Shoots1
Stephen H. Burleigh and
Maria J. Harrison*
The Samuel Roberts Noble Foundation, Plant Biology Division, 2510 Sam Noble Parkway, Ardmore, Oklahoma 73402
 |
ABSTRACT |
Mt4 is a cDNA representing a
phosphate-starvation-inducible gene from Medicago
truncatula that is down-regulated in roots in response to
inorganic phosphate (Pi) fertilization and colonization by arbuscular
mycorrhizal fungi. Split-root experiments revealed that the expression
of the Mt4 gene in M. truncatula roots is down-regulated systemically by both Pi fertilization and colonization by arbuscular mycorrhizal fungi. A comparison of Pi levels in these
tissues suggested that this systemic down-regulation is not caused by
Pi accumulation. Using a 30-bp region of the Mt4 gene as
a probe, Pi-starvation-inducible Mt4-like genes were
detected in Arabidopsis and soybean (Glycine max L.),
but not in corn (Zea mays L.). Analysis of the
expression of the Mt4-like Arabidopsis gene,
At4, in wild-type Arabidopsis and pho1, a
mutant unable to load Pi into the xylem, suggests that Pi must first be
translocated to the shoot for down-regulation to occur. The data from
the pho1 and split-root studies are consistent with the
presence of a translocatable shoot factor responsible for mediating the
systemic down-regulation of Mt4-like genes in roots.
 |
INTRODUCTION |
Phosphate is an essential mineral nutrient for plant growth and
development and is acquired from the soil by Pi transporters located in
the roots (Bieleske, 1973 ). Translocation of phosphate within the plant
is predominantly unidirectional, moving from the root to the shoot via
the xylem; however, a considerable amount of phosphate is also
retranslocated to the root via the phloem (Jeschke et al., 1997 ). The
source is likely to be from both xylem-derived Pi and inorganic and
organic sources from old leaves (Schachtman et al., 1998 ). This
retranslocation process assists root growth (Smith et al., 1990 ) and
may help reduce the buildup of toxic levels of phosphate in the shoot
(Schjørring and Jensén, 1984 ).
The phosphate status of the shoot is known to control the root
processes involved in Pi uptake and its subsequent translocation; however, the precise mechanisms of this control are unknown). The
retranslocation of phosphate from the shoot to the root is likely to be
involved, acting as a feedback-regulatory mechanism responsible for
mediating the shoot control of phosphate levels within the plant (Drew
and Saker, 1984 ; Schjørring and Jensén, 1984 ; Marschner and
Cakmak, 1986 ). Feedback mechanisms regulating the movement of ions
between the root and the shoot have also been proposed for sulfate
(Jensén and König, 1982 ) and potassium (Pitman, 1977 ).
Retranslocated Pi and organic derivatives of phosphate (Hall and Baker,
1972 ) may have dual functions both as nutrients for root processes and
as signaling molecules (Drew and Saker, 1984 ). The precise points of
regulation in the root are unclear, although some evidence implies that
the loading of Pi in the xylem is central to the regulation of
phosphate flux in the plant (Drew and Saker, 1984 ). The Arabidopsis
mutant pho1 (Poirier et al., 1991 ) exhibits normal Pi uptake
rates from the soil to the root, but is blocked in the loading of Pi
into the xylem, which is genetic evidence for at least partial
regulation of Pi transport by xylem loading.
Plants respond to decreasing Pi in the environment by increased root
growth, increased expression of Pi transporters (Muchhal et al., 1996 ;
Leggewie et al., 1997 ; Liu et al., 1998b ), and alterations in
metabolism, including secretion of acid phosphatases (Lefebvre et al.,
1990 ) and RNAses (Bariola et al., 1994 ), which assist in the liberation
of Pi from the rhizosphere. Internally, phosphate retranslocation from
the shoot to the root increases (Lefebvre et al., 1990 ; Heuwinkel et
al., 1992 ; Jeschke et al., 1997 ). Recently, however, it has been shown
that in Pi-starved plants, a larger percentage of retranslocated
phosphate is returned to the shoot, indicating that phosphate cycling
occurs (Jeschke et al., 1997 ).
At the molecular level, relatively little is known about the
Pi-starvation response in plants and even less about its regulation. Phosphate-starvation-inducible Pi transporters (Muchhal et al., 1996 ;
Leggewie et al., 1997 ; Smith et al., 1997 ; Liu et al., 1998b ), RNAses
(Bariola et al., 1994 ), a -glucosidase (Malboobi and Lefebvre, 1997 ), and a number of genes of unknown function (Burleigh and Harrison, 1997 ; Liu et al., 1997 ) have been cloned and provide a
starting point from which to analyze the signal transduction pathways
involved. The molecular mechanisms by which the shoot regulates Pi
uptake and translocation are also unknown. As demonstrated by
pho2, an Arabidopsis mutant that accumulates toxic levels of Pi in the shoot (Delhaize and Randall, 1995 ), at least one plant gene
is involved in how plants sense or respond to shoot Pi levels.
One of the most widespread responses to Pi deprivation is the
development of an association with AM fungi. These obligate symbionts
share a symbiotic relationship with approximately 80% of angiosperm
species, enhancing plant growth by transferring Pi from the soil to the
plant. AM fungi have been forming associations with plants for at least
400 million years (Smith and Read, 1997). Consequently, the
co-evolution of Pi-acquisition strategies by plants and the AM fungal
symbiosis should be considered in the study of the Pi-starvation
response in plants.
We have previously cloned a cDNA (Mt4) from Medicago
truncatula, which is induced in roots in response to Pi starvation
(Burleigh and Harrison, 1997 ). The Mt4 gene is
down-regulated by both Pi fertilization and AM fungal colonization and
as such may provide the means to study these two closely linked
processes at the molecular level. The Mt4 cDNA is 0.5 kb (Burleigh and
Harrison, 1997 ) and shares sequence identity with a
Pi-starvation-inducible gene from tomato (Lycopersicon
esculentum L.), TPSI1 (Liu et al., 1997 ), although
identity is limited to a 30-bp sequence located in the center of both
transcripts. Both genes are composed of numerous short, overlapping
ORFs (Liu et al., 1997 ; Burleigh and Harrison, 1998 ), which is similar
to the structure of ENOD40, a plant gene encoding a peptide
signal involved in nodule development (van de Sande et al., 1996 ).
Whereas the functions of Mt4 and TPSI1 are
unknown, their sensitivity to Pi fertilization and their potential to
encode small peptides make them good candidates as signaling molecules
involved in the Pi-starvation response (Liu et al., 1997 ; Burleigh and
Harrison, 1998 ).
Here we present evidence for the systemic down-regulation of the
Mt4 gene by both Pi fertilization and AM colonization,
identify Mt4-like genes in Arabidopsis and soybean, and
demonstrate that At4 from Arabidopsis is not down-regulated
in the Pi-accumulation mutant pho1 in response to Pi
fertilization. From these results we propose that a translocatable
shoot factor may be involved in the Pi-mediated systemic
down-regulation of Mt4-like genes.
 |
MATERIALS AND METHODS |
Growth of Plants under Pi-Limiting and Pi-Sufficient Conditions
The plants used in the experiments were Medicago
truncatula Gaertn cv Jemalong, line A17, soybean (Glycine
max. L. cv Harisoy), corn (Zea mays L. cv Iochief),
tomato (Lycopersicon esculentum L. cv Rutgers), Arabidopsis
(Columbia ecotype), and the Arabidopsis Pi-accumulation mutant
pho1 (Poirier et al., 1991 ). Seeds of M. truncatula, soybean, corn, and tomato were germinated on filter paper for 1 week, planted in sterile Turface (A.H. Hummert Seed, St.
Louis, MO). Arabidopsis seeds were germinated and grown on sterile
sand. All of the plants were fertilized with one-half-strength Hoagland
solution (Arnon and Hoagland, 1940 ), pH 6.0, containing 0 ( Pi) or 1.0 mM (+Pi)
KH2PO4 and grown for 4 weeks before harvest. Root samples were harvested for the preparation
of RNA from all species, except Arabidopsis, for which whole plants
were harvested. Shoot samples were harvested for Pi assays for all but
the Arabidopsis samples.
To compare expression of At4 in leaves and roots of cv
Columbia and the pho1 mutant, the Arabidopsis plants used in
the experiment were germinated and grown in Metro Mix (Scott,
Marysville, OH) for 3 weeks. Approximately 20 plants per treatment were
transplanted to sterile sand in 11-cm pots, fertilized with
one-half-strength Hoagland solution (Arnon and Hoagland, 1940 ), pH 6.0, containing 0 ( Pi) KH2PO4 and grown for an
additional 3 weeks before harvest. Root and shoot samples were
harvested for the preparation of RNA.
Split-Root Experiments
For the Pi split-root experiments, seedlings were prepared and
grown in Turface for 10 d as described above. The roots of individual plants were separated into two equal parts, placed into
separate containers, fertilized weekly with nutrient solution containing either 0.02 mM (low Pi) or 1.0 mM
(high Pi) KH2PO4 (see Fig.
1), and grown for an additional 4 weeks. The controls included a
split-root treatment in which both halves of the root system received
low-Pi fertilizer and a split-root treatment in which both halves
received high-Pi fertilizer. At harvest, roots were frozen in liquid
nitrogen for RNA extraction. Root and shoot samples were also harvested
for Pi assays.

View larger version (66K):
[in this window]
[in a new window]
| Figure 1.
The systemic down-regulation of Mt4 by Pi
fertilization. A, Illustration of a split-root plant. B, Northern blot
of total RNA isolated from the roots of M. truncatula
grown in a split-root design with one-half of the root system receiving
high-Pi (+Pi half of split-root) and one-half receiving low-Pi ( Pi
half of split-root) fertilizer. In split-root controls both halves
received high-Pi (+Pi control) or low-Pi ( Pi control) fertilizer. The
blot was probed with a 32P-labeled Mt4 cDNA (top panel) and
a 32P-labeled pSR1-2B3 (18S rRNA, bottom panel).
|
|
The design of the mycorrhizal split-root experiment was identical to
that of the Pi split-root experiment, except that mycorrhizal spore
inoculum was added to one-half of the split-root system at the
initiation of the experiment, all treatments received fertilizer containing 0.02 mM
KH2PO4, and plants were
grown for 5 weeks before harvest. Details of plant inoculation and
quantitation of fungal colonization were described previously (Harrison
and Dixon, 1993 ). Glomus versiforme spores were collected
from colonized leek plants, surface-sterilized, washed three times in
sterile distilled water, quantified, and placed on the roots of
treatment plants at the initiation of the experiment. Included were two
replications of the mycorrhizal split-root treatment, a nonmycorrhizal
control, and a control in which one-half of the split-root system was
mock inoculated with the water used to prepare the fungal spore
inoculum. At harvest, roots were frozen in liquid nitrogen for RNA
extraction. Shoot samples were harvested for Pi assays. Root samples
were harvested and colonization assessed by the modified
gridline-intersect method, as described previously (Harrison and Dixon,
1993 ).
Southern- and Northern-Blot Analyses
The isolation of total RNA and genomic DNA was as described
previously (Burleigh and Harrison, 1997 ). The preparation of probes and
both Southern and northern blotting and hybridization were carried out
as described by Sambrook et al. (1989) using 1 and 10 µg of DNA and
RNA per treatment, respectively. Blots were hybridized at 42°C in
50% formamide, 4× SSPE, 1% SDS, 0.5× Denhardt's solution, and 100 µg mL 1 salmon-sperm DNA. The final washing
conditions were 2× SSPE, 1% SDS at 65°C. Northern blots were
hybridized with a labeled 18S rRNA probe (pSR1-2B3) (Eckenrode et al.,
1985 ) to provide a control for loading and transfer and to allow for
the comparison of expression levels between treatments of the same
blot.
RT-PCR
The RT-PCR technique used to identify At4 transcripts in RNA
preparations from roots, leaves, or whole plants of wild-type Arabidopsis and the mutant pho1 was carried out
according to the method of Kawasaki (1990) . One microgram
of total RNA was reverse transcribed using Superscript reverse
transcriptase (GIBCO-BRL) and
oligonucleotide-(dT)15 primers. These RT
reactions were then standardized based on their ribosomal cDNA content.
To assess ribosomal content, RT reactions were amplified by PCR using
the ribosomal primer pair NS1/NS21 (Simon et al., 1992 ) under
nonlimiting reaction conditions and the products separated by gel
electrophoresis, blotted, and probed with a
32P-labeled pSR1-2B3 cDNA (18S rRNA) (Eckenrode
et al., 1985 ). Band intensities were quantified using a phosphor imager
(Molecular Dynamics, Sunnyvale, CA). The standardized RT reactions were
then amplified by PCR using the Arabidopsis primer pair (see Fig. 4) and probed using either the 32P-labeled At4 cDNA
or a 32P-end-labeled oligonucleotide based on the
conserved sequence (GGAAAGGGCAACTTCGATCCTTTGGCATTT) of the Mt4 cDNA
sequence. The PCR reactions consisted of an initial denaturation step
at 94°C for 5 min followed by 26 (ribosomal cDNA) or 28 cycles (At4)
of melting at 94°C for 30 s, annealing at 48°C (ribosomal
cDNA) or 63°C (At4) for 30 s, and extension at 72°C for
30 s using a Geneamp 2400 thermal cycler (Perkin-Elmer). For a
comparison of At4 levels in roots and shoots, the PCR reactions with
the At4 primers were taken to 35 cycles. End labeling of the
oligonucleotide was carried out according to the method of Sambrook et
al. (1989) . Hybridization with the end-labeled oligonucleotide was
carried out at 55°C in 6× SSPE, 10 mM
NaH2PO4, 1 mM EDTA, 0.5% SDS, 100 µg/mL denatured salmon-sperm DNA, and 0.1% nonfat dry milk. The final washing conditions were 2× SSPE, 1% SDS at 42°C.

View larger version (76K):
[in this window]
[in a new window]
| Figure 4.
The nucleotide and translated amino acid sequences
of At4. Bases are numbered at right. Predicted ORFs are shaded. The
region of nucleotide identity with Mt4 from M. truncatula and TPSI1 from tomato is in bold italics. The primer
pair used in PCR experiments is underlined.
|
|
Pi Content Determinations
The Pi content of the roots and shoots was determined using a
phosphomolybdate colorimetric reaction according to the method of Chen
et al. (1956) . Tissue previously frozen in liquid nitrogen was powdered
using a mortar and pestle, air dried at 50°C, rehydrated in a
solution containing 1.4% ascorbic acid, 0.36% ammonium molybdate, and
4.2% H2SO4, incubated at
50°C for 30 min, and assayed at A800. The
Pi content was expressed as micrograms of Pi per milligram of dry
weight and three replicate samples were assayed for each treatment.
Although this method measures Pi, it should be noted that there is some
breakdown of labile phosphate esters during this assay (Ames, 1966 ).
 |
RESULTS |
Systemic Down-Regulation of Mt4 in Response to Pi Fertilization and
to Colonization by an AM Fungus
We initiated a series of split-root experiments to determine
whether the down-regulation of Mt4 by Pi fertilization occurs systemically. A M. truncatula plant was grown with its root
system divided equally between two containers and these received either low-Pi or high-Pi fertilizer (Fig. 1A).
The two halves of the root system were harvested separately and Mt4
transcript levels were assessed by northern-blot analyses. We were
unable to detect transcripts in either the high-Pi or the low-Pi half
of the split-root system (Fig. 1B). Mt4 transcripts were abundant in
roots in which both halves of the root system received low-Pi
fertilizer and were absent in roots in which both halves received
high-Pi fertilizer. This indicates that Pi fertilization of one-half of
the root results in the systemic down-regulation of Mt4 expression
throughout the whole root system.
The levels of Pi in the leaves reflected the two fertilization regimes
(Table I, experiment A). Pi levels were
relatively low in roots in which both halves of the root system
received low-Pi fertilizer and were relatively high in roots in which
both halves received high-Pi fertilizer. However, the treatment in which one-half of the split roots received low-Pi fertilizer and the
other half received high-Pi fertilizer had a differential response; the
half receiving low-Pi fertilizer did not accumulate high levels of Pi,
despite the accumulation of Pi in the fertilized half of the root
system and in the leaves. These results suggest that Pi accumulation
was not responsible for the systemic down-regulation of Mt4
gene expression.
View this table:
[in this window]
[in a new window]
|
Table I.
Pi levels in roots and shoots from the homolog (A)
and split-root experiments (B)
The Pi content was determined using a phosphomolybdate assay and is the
average of three determinations (n = 3). Numbers in
parentheses are SD values.
|
|
A similar experimental design was used to determine whether the
down-regulation of Mt4 by mycorrhizal colonization occurs systemically.
Transcript levels were high in split roots from an uncolonized plant,
as well as from a plant in which one-half of the root system was
inoculated with the spore wash (Fig. 2). Split roots in which one-half of the root system was colonized by the
AM fungus had low levels of Mt4 transcripts in both halves of the root
system, indicating that down-regulation of Mt4 transcripts by
mycorrhizal fungi also occurs systemically. This systemic
down-regulation of Mt4 expression was observed in two split-root plants
(Fig. 2). The level of fungal colonization in these two plants was 54% and 50% of the root length.

View larger version (58K):
[in this window]
[in a new window]
| Figure 2.
The systemic down-regulation of Mt4 by mycorrhizal
colonization. Northern blots of total RNA isolated from the roots of
M. truncatula grown in a split-root design with one-half
of the root system grown with (+F half of split-root) and one-half
grown without ( F half of split-root) G. versiforme
colonization for two plants (A and B). In split-root controls one-half
of the root system was mock inoculated or both halves were uncolonized
( F control). The blot was probed with a 32P-labeled Mt4
cDNA (top panel) and a 32P-labeled pSR1-2B3 (18S rRNA,
bottom panel).
|
|
The level of Pi in the leaves of a split-root plant in which one-half
of the root system was colonized by an AM fungus was approximately
equal to that of a plant in which both halves remained uncolonized
( Pi control) (Table I, experiment A). These results suggest that Pi
accumulation was not likely to be responsible for the observed systemic
down-regulation of Mt4 gene expression in mycorrhizal split
roots. Also, no visible growth differences were observed between the
treatments (data not shown). Enhanced Pi nutrition and growth effects
in mycorrhizal plants may not be detectable in experiments of short
duration or when growth conditions limit the ability of AM fungi to
adequately accumulate trace levels of Pi present in the substrate.
Mt4-Like Genes in Arabidopsis and Soybean
Because a Pi-starvation-inducible homolog of Mt4 has been
described in tomato (Liu et al., 1997 ), we searched for
Mt4-like genes in other plant species to determine whether
they may be a widely conserved component of the Pi-deprivation
responses. RNA was prepared from whole Arabidopsis plants and from the
roots of soybean, corn, and tomato grown with either low-Pi or high-Pi fertilizer. Initial northern-blot analyses, in which the whole Mt4
sequence was used as a probe, detected only Mt4 transcripts in RNA from
Pi-starved M. truncatula (Fig.
3A). However, the use of a 30-bp
oligonucleotide probe, representing the sequence conserved between Mt4
and the tomato homolog TPSI1, enabled the detection of
Pi-starvation-inducible transcripts in Arabidopsis and soybean. These
transcripts were approximately 0.7 and 1.0 kb in length, respectively.
The 0.5-kb transcript identified in tomato corresponded to the size of
the TPSI1 transcript (Liu et al., 1997 ). Transcripts were not detected
in corn receiving either low-Pi or high-Pi fertilizer.

View larger version (40K):
[in this window]
[in a new window]
| Figure 3.
Detection of Mt4-like genes in
Arabidopsis, tomato, and soybean. A, Northern blot of total RNA
isolated from plants receiving either low-Pi ( Pi) or high-Pi (+Pi)
fertilizer. The blot was probed with the conserved sequence (Oligo),
the Mt4 cDNA, the At4 cDNA, or a 32P-labeled pSR1-2B3
(rRNA). B, Expression of At4 in Arabidopsis roots. RT-PCR products from
RNA extracted from leaves and roots of Pi-deprived Arabidopsis plants
(wild type and pho1 mutant) using At4-specific primers.
The blot was hybridized with 32P-labeled At4
cDNA.
|
|
The Pi levels of the soybean and corn leaves were consistent with the
two fertilization regimes: plants receiving low-Pi fertilizer had
relatively low Pi levels, whereas plants receiving high-Pi fertilizer
had relatively high Pi levels (Table I, experiment B). However, the
amount of Pi in the leaf tissue from the two tomato treatments was
similar, although plants receiving low-Pi fertilizer were stunted in
growth and the leaves were purple in color, which are classic symptoms
of Pi starvation. The Arabidopsis plants receiving low-Pi fertilizer
were also stunted relative to the plants receiving high-Pi fertilizer
(data not shown).
The Arabidopsis At4 Gene
To initiate studies of the Mt4-like gene in Arabidopsis
in which access to a number of mutants could provide the means to further characterize Mt4-like gene expression, we decided to
isolate the Arabidopsis cDNA identified in the previous northern-blot analyses. Using the 30-bp sequence conserved in Mt4 and TPSI1 as the
target sequence, we searched an Arabidopsis expressed sequence tag
database and identified a cDNA, which we named At4 (accession no.
AF055372). Sequence analysis revealed that At4 was 747 bp in length
(Fig. 4). This corresponds to the size of
the transcript identified in RNA isolated from Pi-starved Arabidopsis
plants using the conserved oligonucleotide probe (Fig. 3A). This
northern blot was stripped and reprobed with the At4 cDNA and it
hybridized to the same Pi-starvation-inducible transcript from
Arabidopsis (Fig. 3A). As observed with the Mt4 cDNA, the At4 cDNA did
not hybridize well to transcripts from other species. The Arabidopsis RNA used on this northern blot was prepared from whole Arabidopsis plants and, therefore, to determine whether At4 transcripts are present
in both the leaves and roots of Pi-deprived plants, RNA was prepared
from these tissues individually and the presence of the At4 transcript
was assessed by RT-PCR followed by hybridization with the At4 probe.
The At4 PCR product was detected in RNA samples from Arabidopsis root
tissue but not in RNA samples from leaves (Fig. 3B).
The At4 cDNA is predicted to contain numerous short, overlapping ORFs,
which is similar to Mt4 and TPSI1 (Fig. 4). However, none of the At4
ORFs share any amino acid identity with the ORFs of Mt4 or TPSI1. The
conserved nucleic acid sequence located between bp 451 and 472 of the
At4 transcript is potentially translated in two frames, but not the
conserved amino acid sequence, WKGQLR/LSFGI, found in both Mt4 and
TPSI1 (Fig. 5).

View larger version (10K):
[in this window]
[in a new window]
| Figure 5.
Comparison of the conserved nucleotide sequences
of Mt4 from M. truncatula, TPSI1 from tomato, and At4
from Arabidopsis. Perfectly conserved nucleotides are represented by
asterisks and well-conserved nucleotides are represented by dots.
|
|
A Southern blot of Arabidopsis genomic DNA revealed one copy of At4 in
the genome (Fig. 6). BalI
digestion resulted in two bands, as predicted by the presence of a
BalI site within the cDNA.

View larger version (79K):
[in this window]
[in a new window]
| Figure 6.
Southern blot of Arabidopsis genomic DNA.
Hybridization of a 32P-labeled At4 cDNA to a gel blot of
DNA digested with five different restriction enzymes. Size markers are
on the right.
|
|
Expression of At4 in the Pi-Accumulation Mutant pho1
The Arabidopsis pho1 mutant is impaired in its ability
to load Pi into the xylem and therefore to translocate Pi to the shoot (Poirier et al., 1991 ). To determine whether the down-regulation of
Mt4-like genes by Pi is dependent on Pi translocation to the shoot, we examined the expression of the At4 gene in the
pho1 mutant. Because of the limited amount of
pho1 tissue available, we used RNA extracted from whole
plants coupled with RT-PCR and hybridization with the At4 or conserved
oligonucleotide probe. As shown in Figure 3B, At4 is expressed in roots
and not in leaves, and therefore this approach measures expression in
the roots.
At4 transcripts were abundant in wild-type plants receiving low-Pi
fertilizer, but not in plants receiving high-Pi fertilizer, as
determined using either the At4 cDNA or the oligonucleotide based on
the conserved region as the probes (Fig.
7). In contrast, At4 transcripts were
abundant in pho1 plants receiving both low-Pi and high-Pi
fertilizer. These results were observed in two independent experiments
(Fig. 7). Thus, the At4 transcript is not down-regulated in response to
Pi in the pho1 mutant, suggesting that down-regulation is
dependent on the translocation of Pi to the shoot.

View larger version (55K):
[in this window]
[in a new window]
| Figure 7.
Southern blots of RT-PCR products derived from
wild-type Arabidopsis and the Pi-accumulation mutant
pho1. Total RNA was extracted from plants grown with
(+Pi) or without ( Pi) phosphate fertilization, reverse transcribed,
standardized, amplified by PCR using a primer pair based on the At4
sequence, blotted, and probed with either a 32P-labeled At4
cDNA (At4) or an end-labeled oligonucleotide identical to the conserved
sequence (Oligo) for two independent experiments (A and B).
|
|
 |
DISCUSSION |
The identification of Pi-starvation-inducible Mt4-like
genes in members of the Fabaceae, Solanaceae, and Brassicaceae families indicates that these genes are relatively widespread among dicots and
supports the hypothesis that these genes are a common component of the
Pi-starvation response. Surprisingly, these genes could only be
identified using a 30-bp probe, based on the region of identity between
the Mt4 and TPSI1 cDNAs, and were not detected when full-length cDNAs
were used as the probes. In contrast, we previously identified a
homolog of Mt4 in M. sativa by northern-blot analysis using
the entire Mt4 cDNA as a probe (Burleigh and Harrison, 1997 ). Likewise,
Liu et al. (1997) identified homologs of TPSI1 in other solanaceous
plants using the entire TPSI1 cDNA as a probe. As might be expected,
the homologs from closely related species share greater amino acid
identity than homologs from distantly related species. The inability to
detect an Mt4-like gene in corn, a representative monocot,
implies that these genes may have a relatively recent evolutionary
history. These results may reflect subtle differences in the mechanisms
that monocots and dicots use in their response to Pi starvation.
The At4 cDNA from Arabidopsis shares similarities with both Mt4 from
M. truncatula and TPSI1 from tomato: (a) all of these genes
are induced by Pi starvation, (b) they are single-copy genes, (c) their
transcripts range in size from approximately 0.5 to 0.7 kb, (d) they
are composed of numerous short, overlapping ORFs (8 for Mt4, 6 for
TPSI1, and 12 for At4), and (e) they share a short region of nucleic
acid identity located approximately in the middle of the transcript.
Although initially hypothesized to encode the conserved polypeptide
sequence WKGQLR/LSFGI, the absence of a corresponding ORF in At4 now
suggests that the function of this region may not be at the protein
level. Alternatively, the other nonconserved ORFs may be important. In
mammalian systems short, overlapping ORFs are sometimes present in the
5 untranslated regions of genes, where they play a role in the
translational regulation of a larger, translated ORF located at the 3
end of the transcript (Reynolds et al., 1996 ). ENOD40, a
plant gene encoding a growth regulator involved in nodule development
(van de Sande et al., 1996 ), is also composed of numerous short,
overlapping ORFs. It is interesting that the plant genes
ENOD40, Mt4, At4, and TPSI1
do not contain any obvious large ORFs at their 3 ends.
The pho1 mutant of Arabidopsis is unable to load Pi into the
xylem and therefore Pi translocation to the shoot is severely reduced
(Poirier et al., 1991 ). Examination of At4 expression in wild-type
plants and the pho1 mutant revealed that whereas Pi
fertilization resulted in the reduction of At4 transcripts in wild-type
Arabidopsis, Pi fertilization did not reduce At4 gene
expression in the pho1 mutant. These analyses suggest that the down-regulation of At4 in response to Pi fertilization is dependent
on the translocation of Pi to the shoot. Thus, our results not only
provide further support for the shoot control of root responses
involved in phosphate nutrition (Drew and Saker, 1984 ; Jeschke et al.,
1997 ), but also provide the first example, to our knowledge, of this
control operating at the level of gene expression.
Using a split-root technique we demonstrated that the down-regulation
of the Mt4 gene by mycorrhizal colonization was a systemic effect: colonization of one-half of a split-root system resulted in the
down-regulation of Mt4 expression in those roots and in the other half
of the roots not directly exposed to the fungus. However, in these
experiments, colonization did not significantly enhance the Pi status
of the plant, suggesting that Pi most likely was not involved in this
down-regulation. These results support our previous suggestion that the
down-regulation of the Mt4 gene in the roots of M. truncatula is controlled by two pathways that are at least
initially independent: one dependent on Pi fertilization and the other
dependent on root contact with AM fungi (Burleigh and Harrison, 1997 ).
The function of Mt4 in these two closely linked processes remains to be
determined.
Mt4 gene expression was also systemically down-regulated by
Pi fertilization. Liu et al. (1998a) have also recently reported that
Pi fertilization can systemically down-regulate TPSI1 and two Pi
transporters in tomato. We found that Pi did not accumulate in the
unfertilized half of the split roots, despite the accumulation of Pi in
the fertilized half of the root system and in the shoot. This is
similar to the findings of Drew and Saker (1984) , although in their
case it was a transitory response. Because of the absence of Pi
accumulation, we conclude that this nutrient was not directly responsible for the observed systemic down-regulation of Mt4 expression in the unfertilized half of the split roots. However, it is possible that the recycling of phosphate between the shoot and the root (Drew
and Saker, 1984 ; Jeschke et al., 1997 ), although not accumulating as Pi
in the Pi-starved half of the split-root system, may nonetheless have
caused the down-regulation of Mt4 gene expression in these roots. Alternatively, based on the results of both the pho1
and Pi split-root experiments, we suggest that the translocation of Pi
to the shoot results in the production or activation of a shoot factor
that is subsequently translocated to the root, where it down-regulates
Mt4-like genes. Whereas Pi itself is not likely the signal,
organic forms of phosphate, such as ATP (Ziegler, 1975 ), may act as
signaling molecules. The proposed shoot-derived signal molecule could
be a translocating activator of Mt4-like genes, whereby its
absence or inactivation as a result of high shoot phosphate levels
results in Mt4 down-regulation in the root. Several organic acids such
as malate, succinate, shikimate, and oxalate increase in phloem sap
during phosphate starvation (Dinkelacker et al., 1989 ; Hoffland et
al., 1992 ; Jeschke et al., 1997 ) and could be candidates for this
proposed factor. Finally, other shoot-derived molecules could be
influential, as is the case for certain amino acids that act as
signaling molecules in nitrogen uptake (Muller and Touraine, 1992 ).
The hypothesis that a shoot signal is responsible for the
down-regulation of Mt4 gene expression will be further
tested.
 |
FOOTNOTES |
1
This work was supported by The Samuel Roberts
Noble Foundation.
*
Corresponding author; e-mail mjharrison{at}noble.org; fax
1-580-221-7380.
Received May 5, 1998;
accepted October 2, 1998.
 |
ABBREVIATIONS |
Abbreviations:
AM, arbuscular mycorrhizal.
ORF, open reading
frame.
RT, reverse transcription.
 |
ACKNOWLEDGMENTS |
The authors thank Drs. Melina Lopez-Meyer and Christian Dammann
for helpful discussions and for critical reading of the manuscript. We
thank Laura Blaylock for growing some of the Arabidopsis plants.
 |
LITERATURE CITED |
Ames BN
(1966)
Assay of inorganic phosphate, total phosphate and phosphatases.
Methods Enzymol
8:
115-118
Arnon DI,
Hoagland DR
(1940)
Crop production in artificial culture solutions and in soils with special reference to factors influencing yields and absorption of inorganic nutrients.
Soil Sci
50:
463-483
Bariola PA,
Howard CJ,
Taylor CB,
Verburg MT,
Jaglan VD,
Green PJ
(1994)
The Arabidopsis ribonuclease gene RNS1 is tightly controlled in response to phosphate limitation.
Plant J
6:
673-685
[CrossRef][Web of Science][Medline]
Bieleske RL
(1973)
Phosphate pools, phosphate transport and phosphate availability.
Annu Rev Plant Physiol
24:
225-252
Burleigh SH,
Harrison MJ
(1997)
A novel gene whose expression in Medicago truncatula roots is suppressed in response to colonization by vesicular-arbuscular mycorrhizal (VAM) fungi and to phosphate nutrition.
Plant Mol Biol
34:
199-208
[CrossRef][Web of Science][Medline]
Burleigh SH,
Harrison MJ
(1998)
A cDNA from the arbuscular mycorrhizal fungus Glomus versiforme with homology to a cruciform DNA-binding protein from Ustilago maydis.
Mycorrhiza
7:
301-306
[CrossRef]
Chen PS,
Toribara TY,
Warner H
(1956)
Microdeterminations of phosphorus.
Anal Biochem
28:
1756-1758
Delhaize E,
Randall PJ
(1995)
Characterization of a phosphate-accumulator mutant of Arabidopsis thaliana.
Plant Physiol
107:
207-213
[Abstract]
Dinkelacker B,
Römheld V,
Marschner H
(1989)
Citric acid excretion and precipitation of calcium citrate in the rhizosphere of white lupin (Lupinus albus L.).
Plant Cell Environ
12:
285-292
[CrossRef]
Drew MC,
Saker LR
(1984)
Uptake and long-distance transport of phosphate, potassium and chloride in relation to internal ion concentrations in barley: evidence of non-allosteric regulation.
Planta
160:
500-507
[CrossRef]
Eckenrode VK,
Arnold J,
Meagher RB
(1985)
Comparison of the nucleotide sequence of soybean 18S rRNA with the sequence of other small subunit rRNAs.
J Mol Evol
21:
259-269
Hall SM,
Baker DA
(1972)
The chemical composition of Ricinus phloem exudate.
Planta
106:
131-140
Harrison MJ,
Dixon RA
(1993)
Isoflavonoid accumulation and expression of defense gene transcripts during the establishment of vesicular-arbuscular mycorrhizal associations in roots of Medicago truncatula.
Mol Plant Microbe Interact
6:
643-654
Heuwinkel H,
Kirkby EA,
Le Bot J,
Marschner H
(1992)
Phosphorus deficiency enhances molybdenum uptake by tomato plants.
J Plant Nutr
15:
549-558
Hoffland E,
van den Boogaard R,
Nelemans JA,
Findenegg GR
(1992)
Biosynthesis and root exudation of citric and malic acid in phosphate-starved rape.
New Phytol
122:
675-680
Jensén P,
König T
(1982)
Development of regulation mechanisms for SO24 influx in spring wheat roots.
Physiol Plant
55:
459-464
Jeschke WD,
Kirkby EA,
Peuke AD,
Pate JS,
Hartung W
(1997)
Effects of P deficiency on assimilation and transport of nitrate and phosphate in intact plants of castor bean (Ricinus communis L.).
J Exp Bot
48:
75-91
Kawasaki ES
(1990)
Amplification of RNA.
In
MA Innis,
DH Gelfand,
JJ Sninsky,
TJ White,
eds, PCR Protocols: A Guide to Methods and Applications.
Academic Press, San Diego, CA, pp 21-27
Lefebvre DD,
Duff SMG,
Fife CA,
Julien-Inalsingh C,
Plaxton WC
(1990)
Response to phosphate deprivation in Brassica nigra suspension cells.
Plant Physiol
93:
504-511
[Abstract/Free Full Text]
Leggewie G,
Willmitzer L,
Riesmeier JW
(1997)
Two cDNAs from potato are able to complement a phosphate uptake-deficient yeast mutant: identification of phosphate transporters from higher plants.
Plant Cell
9:
381-392
[Abstract]
Liu C,
Muchhal US,
Raghothama KG
(1997)
Differential expression of TPS11, a phosphate starvation-induced gene in tomato.
Plant Mol Biol
33:
867-874
[CrossRef][Web of Science][Medline]
Liu C,
Muchhal US,
Uthappa M,
Kononowicz AK,
Raghothama KG
(1998a)
Tomato phosphate transporter genes are differentially regulated in plant tissues by phosphorus.
Plant Physiol
116:
91-99
[Abstract/Free Full Text]
Liu H,
Trieu AT,
Blaylock LA,
Harrison MJ
(1998b)
Cloning and characterization of two phosphate transporters from Medicago truncatula roots: regulation in response to phosphate and to colonization by arbuscular mycorrhizal (AM) fungi.
Mol Plant Microbe Interact
11:
14-22
[Web of Science][Medline]
Malboobi MA,
Lefebvre DD
(1997)
A phosphate-starvation inducible -glucosidase gene (psr3.2) isolated from Arabidopsis thaliana is a member of a distinct subfamily of the BGA family.
Plant Mol Biol
34:
57-68
[CrossRef][Web of Science][Medline]
Marschner H,
Cakmak I
(1986)
Mechanism of phosphorus-induced zinc deficiency in cotton. II. Evidence for impaired shoot control of phosphorus uptake and translocation under zinc deficiency.
Physiol Plant
68:
491-496
Muchhal US, Pardo JM, Raghathama KG (1996) Phosphate transporters
from the higher plant Arabidopsis thaliana. Proc Natl Acad
Sci USA 93: 10519-10523
Muller B,
Touraine B
(1992)
Inhibition of NO3 uptake by various phloem-translocated amino acids in soybean seedlings.
J Exp Bot
43:
617-623
[Abstract/Free Full Text]
Pitman MG
(1977)
Ion transport in the xylem.
Annu Rev Plant Physiol
28:
71-88
[CrossRef]
Poirier Y,
Thoma S,
Somerville C,
Schiefelbein J
(1991)
A mutant of Arabidopsis deficient in xylem loading of phosphate.
Plant Physiol
97:
1087-1093
[Abstract/Free Full Text]
Reynolds K,
Zimmer AM,
Zimmer A
(1996)
Regulation of RAR 2 mRNA expression: evidence for an inhibitory peptide encoded in the 5 -untranslated region.
J Cell Biol
134:
827-835
[Abstract/Free Full Text]
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Schachtman DP,
Reid RJ,
Ayling SM
(1998)
Phosphorus uptake by plants: from soil to cell.
Plant Physiol
116:
447-453
[Free Full Text]
Schjørring JK,
Jensén P
(1984)
Phosphorus nutrition of barley, buckwheat and rape seedlings. I. Influence of seed-borne P and external P levels on growth, P content and 32P/31P-fractionation in shoots and roots.
Physiol Plant
61:
577-583
Simon L,
Lalonde M,
Bruns TD
(1992)
Specific amplification of 18S fungal ribosomal genes from vesicular-arbuscular endomycorrhia fungi colonizing roots.
Appl Environ Microbiol
58:
291-295
[Abstract/Free Full Text]
Smith FW,
Ealing PM,
Dong B,
Delhaize E
(1997)
The cloning of two Arabidopsis genes belonging to a phosphate transporter family.
Plant J
11:
83-92
[CrossRef][Web of Science][Medline]
Smith FW,
Jackson WA,
van den Berg PJ
(1990)
Internal phosphorus flows during development of phosphorus stress.
Aust J Plant Physiol
17:
451-464
Smith SE, Read DJ, eds (1997) Mycorrhizal Symbiosis. Academic
Press, San Diego, CA
van de Sande K,
Pawlowski K,
Czaja I,
Wieneke U,
Schell J,
Schmidt J,
Walden R,
Matvienko M,
Wellink J,
van Kammen A,
and others
(1996)
Modification of phytohormone response by a peptide encoded by ENOD40 of legumes and a nonlegume.
Science
273:
370-373
[Abstract]
Ziegler H
(1975)
Nature of transported substances.
In
HH Zimmermann,
JA Milburn,
eds, Transport in Plants. I. Phloem Transport. Encyclopedia of Plant Physiology, Vol 1.
Springer-Verlag, New York, pp 59-100
This article has been cited by other articles:

|
 |

|
 |
 
A. Jain, M. D. Poling, A. P. Smith, V. K. Nagarajan, B. Lahner, R. B. Meagher, and K. G. Raghothama
Variations in the Composition of Gelling Agents Affect Morphophysiological and Molecular Responses to Deficiencies of Phosphate and Other Nutrients
Plant Physiology,
June 1, 2009;
150(2):
1033 - 1049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-Y. Lin, S.-I Lin, and T.-J. Chiou
Molecular regulators of phosphate homeostasis in plants
J. Exp. Bot.,
April 1, 2009;
60(5):
1427 - 1438.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Fragoso, L. Espindola, J. Paez-Valencia, A. Gamboa, Y. Camacho, E. Martinez-Barajas, and P. Coello
SnRK1 Isoforms AKIN10 and AKIN11 Are Differentially Regulated in Arabidopsis Plants under Phosphate Starvation
Plant Physiology,
April 1, 2009;
149(4):
1906 - 1916.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-I Lin, S.-F. Chiang, W.-Y. Lin, J.-W. Chen, C.-Y. Tseng, P.-C. Wu, and T.-J. Chiou
Regulatory Network of MicroRNA399 and PHO2 by Systemic Signaling
Plant Physiology,
June 1, 2008;
147(2):
732 - 746.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. Hammond and P. J. White
Sucrose transport in the phloem: integrating root responses to phosphorus starvation
J. Exp. Bot.,
January 1, 2008;
59(1):
93 - 109.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Jain, M. D. Poling, A. S. Karthikeyan, J. J. Blakeslee, W. A. Peer, B. Titapiwatanakun, A. S. Murphy, and K. G. Raghothama
Differential Effects of Sucrose and Auxin on Localized Phosphate Deficiency-Induced Modulation of Different Traits of Root System Architecture in Arabidopsis
Plant Physiology,
May 1, 2007;
144(1):
232 - 247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Muller, M. Morant, H. Jarmer, L. Nilsson, and T. H. Nielsen
Genome-Wide Analysis of the Arabidopsis Leaf Transcriptome Reveals Interaction of Phosphate and Sugar Metabolism
Plant Physiology,
January 1, 2007;
143(1):
156 - 171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. LAMBERS, M. W. SHANE, M. D. CRAMER, S. J. PEARSE, and E. J. VENEKLAAS
Root Structure and Functioning for Efficient Acquisition of Phosphorus: Matching Morphological and Physiological Traits
Ann. Bot.,
October 1, 2006;
98(4):
693 - 713.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Aung, S.-I Lin, C.-C. Wu, Y.-T. Huang, C.-l. Su, and T.-J. Chiou
pho2, a Phosphate Overaccumulator, Is Caused by a Nonsense Mutation in a MicroRNA399 Target Gene
Plant Physiology,
July 1, 2006;
141(3):
1000 - 1011.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wasaki, T. Shinano, K. Onishi, R. Yonetani, J. Yazaki, F. Fujii, K. Shimbo, M. Ishikawa, Z. Shimatani, Y. Nagata, et al.
Transcriptomic analysis indicates putative metabolic changes caused by manipulation of phosphorus availability in rice leaves
J. Exp. Bot.,
June 1, 2006;
57(9):
2049 - 2059.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Sanchez-Calderon, J. Lopez-Bucio, A. Chacon-Lopez, A. Gutierrez-Ortega, E. Hernandez-Abreu, and L. Herrera-Estrella
Characterization of low phosphorus insensitive Mutants Reveals a Crosstalk between Low Phosphorus-Induced Determinate Root Development and the Activation of Genes Involved in the Adaptation of Arabidopsis to Phosphorus Deficiency
Plant Physiology,
March 1, 2006;
140(3):
879 - 889.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T.-J. Chiou, K. Aung, S.-I Lin, C.-C. Wu, S.-F. Chiang, and C.-l. Su
Regulation of Phosphate Homeostasis by MicroRNA in Arabidopsis
PLANT CELL,
February 1, 2006;
18(2):
412 - 421.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. W. Shane and H. Lambers
Systemic suppression of cluster-root formation and net P-uptake rates in Grevillea crithmifolia at elevated P supply: a proteacean with resistance for developing symptoms of 'P toxicity'
J. Exp. Bot.,
January 1, 2006;
57(2):
413 - 423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Franco-Zorrilla, A. C. Martin, A. Leyva, and J. Paz-Ares
Interaction between Phosphate-Starvation, Sugar, and Cytokinin Signaling in Arabidopsis and the Roles of Cytokinin Receptors CRE1/AHK4 and AHK3
Plant Physiology,
June 1, 2005;
138(2):
847 - 857.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Penaloza, G. Munoz, H. Salvo-Garrido, H. Silva, and L. J. Corcuera
Phosphate deficiency regulates phosphoenolpyruvate carboxylase expression in proteoid root clusters of white lupin
J. Exp. Bot.,
January 1, 2005;
56(409):
145 - 153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. HAMMOND, M. R. BROADLEY, and P. J. WHITE
Genetic Responses to Phosphorus Deficiency
Ann. Bot.,
September 1, 2004;
94(3):
323 - 332.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Arnholdt-Schmitt
Stress-Induced Cell Reprogramming. A Role for Global Genome Regulation?
Plant Physiology,
September 1, 2004;
136(1):
2579 - 2586.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Franco-Zorrilla, E. Gonzalez, R. Bustos, F. Linhares, A. Leyva, and J. Paz-Ares
The transcriptional control of plant responses to phosphate limitation
J. Exp. Bot.,
February 1, 2004;
55(396):
285 - 293.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Wu, L. Ma, X. Hou, M. Wang, Y. Wu, F. Liu, and X. W. Deng
Phosphate Starvation Triggers Distinct Alterations of Genome Expression in Arabidopsis Roots and Leaves
Plant Physiology,
July 1, 2003;
132(3):
1260 - 1271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-H. Wang, D. F. Garvin, and L. V. Kochian
Rapid Induction of Regulatory and Transporter Genes in Response to Phosphorus, Potassium, and Iron Deficiencies in Tomato Roots. Evidence for Cross Talk and Root/Rhizosphere-Mediated Signals
Plant Physiology,
November 1, 2002;
130(3):
1361 - 1370.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. G. Forde
The role of long-distance signalling in plant responses to nitrate and other nutrients
J. Exp. Bot.,
January 1, 2002;
53(366):
39 - 43.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. T. Mukatira, C. Liu, D. K. Varadarajan, and K. G. Raghothama
Negative Regulation of Phosphate Starvation-Induced Genes
Plant Physiology,
December 1, 2001;
127(4):
1854 - 1862.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. C. MacIntosh, C. Wilkerson, and P. J. Green
Identification and Analysis of Arabidopsis Expressed Sequence Tags Characteristic of Non-Coding RNAs
Plant Physiology,
November 1, 2001;
127(3):
765 - 776.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Ticconi, C. A. Delatorre, and S. Abel
Attenuation of Phosphate Starvation Responses by Phosphite in Arabidopsis
Plant Physiology,
November 1, 2001;
127(3):
963 - 972.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ning and J. R. Cumming
Arbuscular mycorrhizal fungi alter phosphorus relations of broomsedge (Andropogon virginicus L.) plants
J. Exp. Bot.,
September 1, 2001;
52(362):
1883 - 1891.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Rubio, F. Linhares, R. Solano, A. C. Martin, J. Iglesias, A. Leyva, and J. Paz-Ares
A conserved MYB transcription factor involved in phosphate starvation signaling both in vascular plants and in unicellular algae
Genes & Dev.,
August 15, 2001;
15(16):
2122 - 2133.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Haran, S. Logendra, M. Seskar, M. Bratanova, and I. Raskin
Characterization of Arabidopsis Acid Phosphatase Promoter and Regulation of Acid Phosphatase Expression
Plant Physiology,
October 1, 2000;
124(2):
615 - 626.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Abel, T. Nürnberger, V. Ahnert, G.-J. Krauss, and K. Glund
Induction of an Extracellular Cyclic Nucleotide Phosphodiesterase as an Accessory Ribonucleolytic Activity during Phosphate Starvation of Cultured Tomato Cells
Plant Physiology,
February 1, 2000;
122(2):
543 - 552.
[Abstract]
[Full Text]
|
 |
|
|
|