Plant Physiol. (1999) 119: 489-496
Purification of the Trehalase GMTRE1 from Soybean Nodules
and Cloning of Its cDNA. GMTRE1 Is
Expressed at a Low Level in Multiple Tissues1
Roger A. Aeschbacher*,
Joachim Müller,
Thomas Boller, and
Andres Wiemken
Botanisches Institut, Universität Basel, Hebelstrasse 1, CH-4056 Basel, Switzerland
 |
ABSTRACT |
Trehalose
(
-D-glucopyranosyl-1,1-
-D-glucopyranoside),
a disaccharide widespread among microbes and lower invertebrates, is generally believed to be nonexistent in higher plants. However, the
recent discovery of Arabidopsis genes whose products are involved in
trehalose synthesis has renewed interest in the possibility of a
function of trehalose in higher plants. We previously showed that
trehalase, the enzyme that degrades trehalose, is present in nodules of
soybean (Glycine max [L.] Merr.), and we characterized the enzyme as an apoplastic glycoprotein. Here we describe the purification of this trehalase to homogeneity and the cloning of a
full-length cDNA encoding this enzyme, named GMTRE1
(G. max trehalase
1). The amino acid sequence derived from the open reading frame of GMTRE1 shows strong homology to known
trehalases from bacteria, fungi, and animals. GMTRE1 is
a single-copy gene and is expressed at a low but constant level in many
tissues.
 |
INTRODUCTION |
Trehalose
(
-D-glucopyranosyl-1,1-
-D-glucopyranoside),
a nonreducing disaccharide, is found in diverse organisms such as bacteria, fungi, and insects (Elbein, 1974
). It is commonly considered a storage compound but more recently has been recognized to function mainly as a protectant for maintaining vital structures in the cytosol
under stressful conditions such as extreme temperatures, drought, and
desiccation (Wiemken, 1990
; Ribeiro et al., 1997
; Crowe et al., 1998
).
It might do so by stabilizing membranes and protecting enzymes (Crowe
et al., 1984
; Hottiger et al., 1994
; Iwahasi et al., 1995). To date,
trehalose has not been found in vascular plants, except for the two
well-documented cases of the resurrection plant Selaginella
lepidophylla and Myrothamnus flabellifolia. However,
trehalase, the enzyme that specifically hydrolyzes trehalose, is
widespread among higher plants and is found in multiple tissues, despite the apparent lack of its substrate (for review, see
Müller et al., 1995a
).
Higher plants, whether or not they produce trehalose, live together
with a variety of microorganisms producing trehalose during most of
their life span, entering mutual or antagonistic symbioses. Trehalose
has been shown to be present in plants during interactions with various
microorganisms, including antagonistic, endomycorrhizal, and
ectomycorrhizal fungi and nitrogen-fixing bacteria (for review, see
Müller et al., 1995a
). Legume nodules have a much higher trehalase activity than normal roots (Müller et al., 1994
). We previously partially purified and characterized trehalase from soybean
(Glycine max L.) nodules as a 54-kD glycoprotein with both
broad pH and high temperature optima (Müller et al., 1992
). The
same type of enzyme was also found in sterile soybean cell and tissue
cultures, demonstrating that it is a plant enzyme.
Previously, we considered trehalase mainly in the context of plant
symbioses (Müller et al., 1995a
). However, recently, we and
others (Blázquez et al., 1998
; Vogel et al., 1998
) showed that
higher plants potentially have the capacity to synthesize trehalose. By
functional complementation of yeast mutants that are devoid of one of
the two trehalose-synthesizing enzymes, homologous activities for
trehalose-6-P synthases and trehalose-6-P phosphatases from Arabidopsis
were identified (Blázquez et al., 1998
; Vogel et al., 1998
).
Therefore, higher plants may be capable of metabolizing trehalose, as
highlighted recently (Goddijn and Smeekens, 1998
). The apparent lack of
accumulation of trehalose might be due to active trehalases that
rapidly hydrolyze any synthesized trehalose.
Understanding the role trehalase plays in trehalose metabolism is
imperative when trying to analyze the potential regulatory role of
trehalose or its metabolites, both in symbiosis and in the plant's own
development. We therefore decided to purify soybean trehalase and to
clone its cDNA.
 |
MATERIALS AND METHODS |
Molecular Biology Techniques
If not otherwise mentioned, standard molecular biology techniques
were performed according to the methods of Ausubel et al. (1992)
and
Sambrook et al. (1989)
.
Plant Material
Nodules were harvested from soybean (Glycine max [L.]
Merr.) infected with Bradyrhizobium japonicum and grown in a
field in Oberwil, Switzerland. For auxin-induction experiments, the
soybean seeds were sterilized and axenically grown as described by
Müller et al. (1995b)
. For nodulation studies, soybean plants
were grown in Leonard jars and infected with B. japonicum
61-A-101 (Müller et al., 1992
). Pseudonodules were obtained by
cultivating soybean plants in the presence of nodulation (Nod) factors
isolated from B. japonicum 61-A-101, as described previously
(Staehelin et al., 1994
).
Southern Analysis
DNA used for Southern analysis and total RNA for reverse
transcription were prepared from soybean seedlings grown under sterile conditions. DNA was prepared using the Nucleon-Phytopure DNA isolation kit (Scotlab Limited, Lanarkshire, UK) with two additional
CHCl3 extractions in the procedure. Total DNA (10 µg) was digested with appropriate restriction enzymes and
separated in a 1% agarose gel. In the lane for undigested DNA only 5 µg of total DNA was loaded. The DNA was transferred to nylon
membranes (Boehringer Mannheim) using the Southern technique.
Hybridization and washings were done under moderate stringency
conditions (40°C hybridization temperature; washings in 0.1× SSC and
0.2% SDS at 60°C). The probe was a fragment that had been amplified
by PCR in the presence of digoxigenin-labeled deoxynucleotide
triphosphates, and hybridization was done in DIG Easy Hyb buffer
(Boehringer Mannheim). This 1.2-kb fragment was synthesized
using the primers o221 (5
-TTCGAAATCGCTGTCAATTATG-3
) and o194
(5
GAACCTCCTCACATGTACTG3
), covering position 115 to position 1328 of
the GMTRE1 cDNA. Detection of the signal was done using
disodium
3-(4-methoxyspiro[1,2-dioxyetane-3,2
-(5
-chloro)tricyclo[3.3.1.13,7]decan]-4-yl)phenyl
phosphate substrate (Boehringer Mannheim). A chemiluminescense screen
on a phosphor imager (Bio-Rad) was used for detection of the signal.
Enzyme Assays and Purification
Trehalase was assayed at pH 6.3 and soluble proteins were
determined as previously described (Müller et al., 1995b
). Nodule trehalase was extracted as described by Müller et al. (1992)
. For
ion-exchange chromatography on DEAE-Trisacryl (IBF Biotechnics, Villeneuve-la-Garenne, France), the column (100 mL, 5 cm in diameter) was equilibrated with Bis-Tris (Cl
) buffer (50 mM, pH 6.5). Trehalase was eluted with 100 mM
NaCl in the same buffer. Affinity chromatography on concanavalin
A-Sepharose and gel filtration on Superose 12 were performed as
previously described (Müller et al., 1992
). For affinity
chromatography on hydroxyapatite, purified hydroxyapatite
(Bio-Rad) was equilibrated with Bis-Tris (Cl
)
buffer (20 mM, pH 6.5). Trehalase was eluted using the same buffer containing 80 mM potassium phosphate. The final
ion-exchange chromatography was performed on Hi-Trap Q (Pharmacia)
equilibrated as described for the DEAE-Trisacryl column. The protein
used for the subsequent steps was eluted with 120 mM NaCl.
Protein and DNA Sequencing
The purified protein (usually 10-18 µg) was separated on a PAGE
gel (Laemmli et al., 1970), electroblotted to a PVDF membrane (Immobilon, Millipore), and stained with Coomassie blue R. The trehalase band was cut out and cleaved with trypsin. Tryptic peptides were separated by reverse-phased HPLC and sequenced by automated Edman
degradation (Sprenger et al., 1995
). Degenerate oligonucleotides of
about 20 bases were synthesized at a degeneracy of no more than
256-fold. Total RNA was extracted from soybean nodules and roots
treated with auxin (1 µM IAA for 4 d) using the
RNeasy kit (Qiagen, Basel, Switzerland). The RNA in this preparation
was reverse transcribed using a kit (Boehringer Mannheim) and an
oligo(dT) primer. PCR amplification was done using pairs of one forward and one reverse degenerate primer on this first-strand cDNA.
A specific fragment of about 500 bp was obtained using the primers o128
5
-GARRAYGARTTYTGGAAYTC-3
and o130 5
-GCRAANACRTTYTGRTTYTG-3
, derived
originally from the peptides EYEFWNSDIHK and XEXQNQNVFAXNF. In the
succesful amplifications we used an excess of primers (100 µM) and 40 cycles. This specific 500-bp fragment was
identified in nodules as well as in auxin-treated root cDNA. Both
fragments were sequenced and found to be identical. DNA sequencing was
done on an automatic sequencer (Perkin-Elmer). Specific primers were synthesized and used to amplify both the 5
and 3
ends of the cDNA by
RACE experiments (Frohman et al., 1988
). We used oligo(dT) primers to
synthesize the cDNA for the RACE reactions and tailed the 5
end with
terminal transferase using deoxyguanidine triphosphates, as described
previously (Aeschbacher et al., 1995
). PCR reactions were then done on
a fraction of the cDNA using internal primers and a synthetic
oligonucleotide that hybridizes to deoxyguanosine stretches. The
5
end of the cDNA was reached after three successive rounds of 5
RACE. Finally, primers were used that map to the very 5
end of the
cDNA and to a position immediately 5
to the poly(A+) tail. Parallel PCR amplifications were
performed with these primers using a mixture of Pfu DNA
polymerase (Stratagene) and Taq polymerase I (Pharmacia;
ratio 5:1). One cDNA of 2.3 kb and, using a more internal primer, a
cDNA of 2.2 kb were amplified that were homologous in the 2.2-kb
overlapping part. For positions 1 to 46 of the GMTRE1 cDNA
only sequences obtained through RACE-PCR are available.
Sequence Analysis and Comparison
Sequence analysis was done using Genetics Computer Group (Madison,
WI) software. The homology comparisons were done with version 9.0 of
the program "PileUp" using the default conditions (gap creation
penalty, 12; gap extension penalty, 4).
RT-PCR
Tissue material and total RNA were prepared and cDNA was
synthesized as described above. cDNA preparations (1 µL) were used per PCR reaction in a total volume of 30 µL, and 36 cycles were performed. For amplification of actin, 32 cycles were performed. Actin
showed an identical expression pattern when cycled for 27 cycles only,
although the amounts obtained were lower. Primers used for the
amplification were designed to have similar annealing temperatures and
to span at least one intron to be able to distinguish the amplified
cDNA from any potential genomic DNA contaminants. Primers and cDNA
fragment sizes and accession numbers are: GMTRE1, primer
o221 5
-TTCGAAATCGCTGTCAATTATG-3
and o205
5
-GGTGGTTCACCTTGGGCAAGAA-3
(344 bp; this publication);
Nod26, o11 5
-CAATCCTGCTGTCACCATTG-3
and primer o12
5
-CACTCTTGGTAGTCTCACTC -3
(494 bp; accession no. X04782); and
Actin, o222 5
-GTTCTCTCCTTGTATGCAAGTG-3
and o223 5
-CCAGACTCATCATATTCACCTTTAG-3
(683 bp; accession no. V00450).
 |
RESULTS |
Trehalase Activity in Nodules and Pseudonodules
We measured trehalase activity in soybean nodules and
pseudonodules. As shown previously (Müller et al., 1992
), a
strong trehalase activity was found in nodules colonized by B. japonicum 61-A-101 (442 ± 51 µkat
g
1 protein). A similar high activity (353 ± 85 µkat g
1 protein) was found in
ineffective pseudonodules (fix
) obtained by
cultivating soybean plants in the presence of Nod factors isolated from
B. japonicum 61-A-101. The activity in nodules was 1.3-fold
higher than in pseudonodules.
Cloning of the Soybean Trehalase cDNA
Since a strong trehalase activity was found in soybean nodules, we
decided to purify this activity and to clone the trehalase cDNA on the
basis of partial amino acid sequences by RT-PCR. We purified the
nodules' trehalase activity using an optimized purification scheme
that is based on a partial purification of trehalase reported earlier
(Müller et al., 1992
). By including a hydroxylapatite-affinity chromatography step and a Hi-Trap Q ion-exchange chromatography step,
we were able to purify the trehalase 2600-fold (Table
I). With this level of purity, a single
band was visible on silver-stained SDS gels at about 66 kD (Fig.
1). The band was excised from the gel and
further processed by tryptic digestion. The obtained peptides were
sequenced and several internal peptide sequences were obtained. Degenerate primers corresponding to these peptides were used for PCR
amplifications of reverse-transcribed RNA from nodules. A cDNA fragment
of 500 bp was identified that contained a single open reading frame and
encoded additional peptides of the purified trehalase protein. The
complete cDNA sequence was obtained by RACE-PCR (Frohman et al., 1988
).
To reduce the probability of errors in the cDNA sequence, we
reamplified the complete coding region in two independent PCR reactions
using primers that lie outside of the open reading frame. The sequences
of both cDNAs were identical and we concluded that the identified cDNA
sequence is authentic.
View this table:
[in this window]
[in a new window]
|
Table I.
Purification procedure of nodule trehalase from
soybean
The flow chart shows the optimized procedure for trehalase
purification. As starting material, 888 g of soybean nodules was
extracted as described by Müller et al. (1992) . The individual
steps of the purification procedure are given with the amount of total
protein, total trehalase activity, specific trehalase activity, and the
purification factor obtained at that step.
|
|

View larger version (52K):
[in this window]
[in a new window]
| Figure 1.
Purified trehalase from soybean nodules. One
hundred nanograms of the the final elution (120 mM NaCl)
from the Hi-Trap Q column step were separated on a 10% SDS-Laemmli gel
and stained with silver. Sizes of the molecular mass markers are
indicated in kD (lane M). The marker and the purified protein ran on
the same gel, but an intervening lane was omitted.
|
|
The complete cDNA is 2123 nucleotides long and contains an open reading
frame from nucleotide 134 to nucleotide 1805. Upstream and downstream
of this open reading frame are multiple stop codons in all three
frames. There are two small open readings frames upstream of the
putative initiation codon, starting at nucleotides 7 and 38 of the
cDNA. However, these ATG codons are unlikely to be used as initiation
codons, as predicted by initiation codon-prediction programs (Genetics
Computer Group), and both are followed in-frame by stop codons after
three, and in the second case five, amino acids. If recognized as start
codons, only short peptides would be expressed from these ATG codons.
The gene encoding this cDNA was designated GMTRE1, for
Glycine
max trehalase 1 gene.
Protein Characteristics
The sequences identified from the major peptide fractions of the
purified protein fraction are 100% homologous to sequences in GMTRE1
(underlined residues in the GMTRE1 sequence in Fig. 2). However, an Asn is encoded instead of
a Ser at position 288 of the GMTRE1 protein. Since this position is a
potential N-glycosylation site (Fitchette-Lainé et
al., 1998
), it is likely that this site is glycosylated in the mature
protein, which resulted in a misinterpretation during the automated
Edman degradation (see ``Materials and Methods'').

View larger version (130K):
[in this window]
[in a new window]
| Figure 2.
Comparison of GMTRE1 with
other trehalases. Trehalases from several organisms were screened for
homologies (see ``Materials and Methods''). The trehalases used were:
GMTRE1 (this publication); ATTRE, Arabidopsis trehalase isolog
T19F06.15 (accession no. AC002343); Ecoptre: E. coli
periplasmic trehalase precursor TREA ECOLI (accession no.
P13428); Ecoctre: E. coli probable cytoplasmic trehalase
TREF ECOLI (accession no. P37196); Humtre: trehalase
[Homo sapiens] (accession no. AB000824); Rabtre:
trehalase precursor from rabbit: TREA RABIT (accession no.
P19813); Tentre: trehalase precursor Tenebrio molitor;
TREA TENMO (accession no. P32359); Bomtre: trehalase
precursor Bombyx mori TREA BOMMO)
(accession no. P32358); and Celtre: trehalase isolog from C. elegans (accession no. AF039713). Four additional trehalase
isologs from C. elegans also show strong homologies to
GMTRE1 but are not shown here. The underlined residues in GMTRE1
indicate the identified peptide sequences from the purified soybean
nodule trehalase.
|
|
The deduced protein sequence of GMTRE1 showed that the
protein is closely related to other trehalases. The predicted GMTRE1 protein is 557 amino acids long and thus has the same length as the
recently identified trehalase isolog T19F06.15 from Arabidopsis (accession no. AC002343). The predicted molecular mass of GMTRE1 is 56 kD.
GMTRE1 is most homologous to the Arabidopsis trehalase isolog, with
59% of the amino acids identical in total (Fig. 2). It is worth noting
that soybean trehalase is more similar to trehalases in
Escherichia coli, human, rabbit, insects, and
Caenorhabditis elegans than to those from the yeast
Saccharomyces cerevisiae and other fungi. Therefore,
homologies are fewer and mainly restricted to four small blocks of
conserved residues that start at position 195 (PGSRFREVYYWDSY),
position 261 (RSQPP), and positions 586 (GGGGEY) and 596 (GFGW) of the
comparison presented in Figure 2. Overall homologies are small,
however, they extend along the entire length of the proteins with
blocks of amino acids, as well as single amino acids (e.g. D at
position 76, W at position 288, or G at position 411), shared among the
various trehalases.
Southern Analysis of GMTRE1
The genomic organization of GMTRE1 was analyzed by
Southern hybridization. In undigested DNA from plant material grown
under sterile conditions, the probe for GMTRE1 hybridized to
the high Mr genomic DNA (Fig.
3). In DNA digested individually with the restriction enzymes StuI, SacI, and
XbaI, single fragments of 20, 18, and 13 kb, respectively,
were detected. Digestion with the restriction enzyme SpeI
yielded two hybridizing fragments of 1.0 and 1.9 kb. This is most
likely due to a restriction site for SpeI within an intron
in GMTRE1. Since the hybridization was done under
moderate-stringency conditions, we concluded that there are no genes
closely related to GMTRE1 present in soybean and that
GMTRE1 is a single-copy gene in soybean.

View larger version (93K):
[in this window]
[in a new window]
| Figure 3.
Southern analysis of GMTRE1. The
sizes of DNA molecular size markers are indicated. uncut, Undigested
genomic DNA. Lanes labeled with StuI,
XbaI, SpeI, and SacI indicate the
complete digests of genomic DNA using the corresponding restriction
enzymes.
|
|
Expression of Trehalase
By RNA-blot analysis, we were unable to detect any signals from
GMTRE1 transcripts in total RNA prepared from roots, leaves, flowers, or nodules, indicating that GMTRE1 is
expressed at a low level in soybean. We therefore analyzed the
expression by RT-PCR. To design primers for RT-PCR reactions, we
amplified genomic DNA using sequence-specific primers of
GMTRE1. In that way we were able to identify a 144-bp-long
intron that maps to position 136/137 of the cDNA, immediately following
the start codon. For the RT-PCR experiments, we used primers
encompassing this intron to be able to distinguish the amplified cDNA
from any potential genomic DNA contamination.
Figure 4 shows that GMTRE1 is
expressed in several tissues at a similar level. Expression could be
detected in nodules, leaves, flowers, and roots. However, the
transcript of GMTRE1 did not appear to be induced in
nodules. Nod26, which was used as a control for nodulation,
was strongly induced in nodules. Actin was used as a constitutive
control and showed a similar expression in all of the tissues tested,
with perhaps a smaller level of expression in nodules. We therefore
conclude that GMTRE1 is expressed in multiple tissues at a
low but constant level.

View larger version (48K):
[in this window]
[in a new window]
| Figure 4.
Expression analysis of GMTRE1 in
different soybean tissues. The following tissues of soybean were used:
roots from 4-d-old plants (Roots), mature nodules (Nodules), mature
leaves (Leaves), flowers (Flowers), and roots from 3-month-old plants
(Old Roots). cDNA fragments of GMTRE1,
Nod26, and Actin were amplified by
RT-PCR, as described in ``Materials and Methods''. Ten microliters of
the amplified reactions were resolved by agarose gel electrophoresis
and analyzed under UV light. The sizes of the amplified PCR correspond
to the expected size of amplified cDNA products.
|
|
 |
DISCUSSION |
Purification of the Soybean Nodule Trehalase and Cloning of Its
cDNA
To date, trehalases in soybean have been identified in nodules,
calli, cell cultures, roots, leaves, and flowers (Müller et al.,
1995a
). This parallels trehalase activity in other leguminosae and in
other higher plants, in which trehalase in nonsymbiotic organs was
found in pollen, cell cultures, roots, and leaves (Müller et al.,
1992
). Here we show that ineffective pseudonodules also express
trehalase at a level similar to nodule tissue. This clearly demonstrates that the expressed trehalase is of soybean origin.
We have purified a soybean nodule trehalase 2600-fold to apparent
homogeneity, using an improved purification scheme including a
hydroxyapatite-affinity column and a Hi-Trap Q ion-exchange chromatography step. Microsequence analysis of the purified protein resulted in several peptide sequences derived from the nodule trehalase. Based on these sequences, we designed degenerate primers and
were able to clone the cDNA encoding the GMTRE1 gene by
performing RT-PCR experiments. GMTRE1 is a single-copy gene
as shown by the Southern analysis, which did not reveal any closely
homologous sequences.
GMTRE1 Encodes the Soybean Nodule
Trehalase
The analysis of the cDNA sequence shows that the ATG at position
134 is the initiation codon for the open reading frame. The two ATGs
present at positions 7 and 38 terminate in multiple stop codons and
therefore would give rise to only short open reading frames (if any).
Short open reading frames in the 5
-untranslated sequence of plant
genes are well known in plants (Aeschbacher et al., 1991
, 1995
), but
their function is unclear. GMTRE1 has the same predicted number of
amino acids as the trehalase isolog T19F06.15 from Arabidopsis and both
show homologies in the N terminus, again indicating that the
ATG134 is used as start codon.
GMTRE1 is most likely glycosylated. This is indicated by the
identification of a Ser at a potential gylcosylation site at position
288 during microsequencing, instead of the Asn predicted by the cDNA
sequence. This is likely to be an artifact of microsequencing, in which
the glycosyl residue attached to the Asn resulted in a
misinterpretation of the signal obtained in this cycle. Glycosylation of GMTRE1 is also highly likely because we were able to purify this
protein with a concanavalin A column, a selective adsorbent for
glycoproteins.
Glycosylation of GMTRE1 might explain the fact that we observed three
isoforms of nodule trehalase in IEF gels (data not shown) and a
molecular mass of GMTRE1 in SDS-PAGE gels (66 kD) that is bigger than
the predicted mass of 56 kD. In soybean suspension-cultured cells, we
found >80% of the total trehalase activity in the medium, suggesting
that the trehalase activity is secreted (data not shown).
GMTRE1 is strongly homologous to trehalases from diverse organisms,
including bacteria, insects, and mammals. These proteins have only a
30% to 40% identity, but they share conserved blocks dispersed over
the entire protein. These blocks are also found in GMTRE1, and since we
have cloned its cDNA based on a highly purified trehalase activity, we
conclude that the cloned GMTRE1 cDNA is indeed encoding the
purified functional nodule trehalase.
Expression of the GMTRE1 Gene
GMTRE1 is expressed at a low constitutive level in
several tissues, including roots and nodules, as well as phototrophic
tissue such as leaves and flowers. Although trehalase is about 10-fold more active in nodules than in roots (Müller et al., 1992
),
induction of GMTRE1 expression in nodules compared with
roots was not observed at the RNA level. Since the actin probe used as
a constitutive control showed a lower expression in nodules, a low
level of induction might still exist. However, such fine levels of
induction would have to be tested using a quantitative RT-PCR method.
Whether GMTRE1 expression might be posttranscriptionally
regulated awaits further examination.
The GMTRE1 expression pattern parallels the expression of
the recently identified Arabidopsis trehalase isolog
T19F06.15 (accession no. AC002343), in which we have found,
using RT-PCR, a low but constitutive level of expression in various
tissues as well (data not shown).
Trehalose Metabolism and Sugar Sensing
Production of trehalose in plants is of interest since trehalose
might be exploited as a stress-protective agent in vivo (Goddijn et
al., 1995
). Therefore, attempts have been made to produce trehalose in
higher plants. Tobacco and potato were transformed with trehalose-6-P synthase (otsA) and trehalose-6-P phosphatase
(otsB) genes from E. coli (Goddijn et al., 1997
).
However, the transgenic plants accumulated trehalose only in very low
amounts, if at all, and transgenic potatoes accumulated low amounts of
trehalose in microtubers only when cultured on validamycin A, a strong
inhibitor of trehalases. On the other hand, plants transformed with
trehalose-6-P synthase exhibited strong alterations in growth (Goddijn
et al., 1997
). Strong pleiotropic growth phenotypes were also observed
in tobacco plants transformed with trehalose-6-P synthase from yeast
(Romero et al., 1997
).
The causes of these growth alterations are unclear but the results
point toward a regulatory role for trehalose or its metabolic intermediates in plant sugar sensing and/or in plant development (Goodijn and Smeekens, 1998). Exogenous application of trehalose to
soybean roots affects Suc synthase and invertase activities (Müller et al., 1998
). Whether microorganisms might produce and secrete trehalose to alter the carbohydrate allocation of the plant to
their favor is, however, still unknown. Such a mechanism could
supersede the regulation of the plant's endogenous carbohydrate partitioning and make it independent of environmental conditions such
as light intensity and nutrient status. Since the soybean trehalase is
expressed in multiple tissues at a low level and is secreted, it might
have the function to protect the plant from exposure to exogenous
microbial trehalose.
Thus far, we have been unable to identify endogenous trehalose
production in soybean plants. However, the recent findings that higher
plants may potentially produce trehalose and that even minute amounts
of endogenously produced trehalose may have drastic effects on the
long-term development of the plant (Goddijn and Smeekens, 1998
)
indicate a possible endogenous function of trehalose and its degrading
enzyme, trehalase. Whether trehalose or its metabolic intermediates are
regulators involved in sugar sensing, or whether they are simply toxic
to plants and thus have to be removed by trehalases, awaits further
analysis.
 |
FOOTNOTES |
1
This work was supported by grants from the Swiss
National Science Foundation (no. 3100-042535.94 to A.W. and no.
3100-040837.94 to T.B.).
*
Corresponding author; e-mail aeschbacher{at}ubaclu.unibas.ch; fax
41-61-267-23-30.
Received August 25, 1998;
accepted November 3, 1998.
 |
ABBREVIATIONS |
Abbreviations:
RACE, rapid amplification of cDNA ends.
RT, reverse transcriptase.
 |
ACKNOWLEDGMENTS |
We thank our colleagues Dr. Z.-P. Xie, Dr. C. Staehelin, Dr.
K.-H. Bortlik, Dr. N. Sprenger, and Monica Alt (Botanisches Institut, Universität Basel, Switzerland) for their help with nodule
harvest. We also thank the following members of the institute: Dr. G. Vogel for collaboration, Dr. M. Lüscher for helpful discussions
concerning protein purification, N. Bürckert for initial help
with sequencing, and Dr. J. Oetiker and Dr. I. Sanders for critical
reading of the manuscript.
 |
LITERATURE CITED |
Aeschbacher RA,
Hauser MT,
Feldman K,
Benfey PN
(1995)
The SABRE gene is required for normal cell expansion in Arabidopsis.
Genes Dev
9:
330-340
[Abstract/Free Full Text]
Aeschbacher RA,
Schrott M,
Potrykus I,
Saul MW
(1991)
Isolation and molecular characterization of PosF21, an Arabidopsis thaliana gene which shows characteristics of a b-Zip class transcription factor.
Plant J
1:
303-316
[CrossRef][Web of Science][Medline]
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA,
Struhl K (1992) Short Protocols in Molecular Biology. Greene
Publishing Associates and John Wiley & Sons, New York
Blázquez MA,
Santos E,
Flores C-L,
Martínez-Zapater JM,
Salinas J,
Gancedo C
(1998)
Isolation and molecular characterization of the Arabidopsis TPS1 gene, encoding trehalose-6-phosphate synthase.
Plant J
13:
685-690
[CrossRef][Web of Science][Medline]
Crowe JH,
Carpenter JF,
Crowe LM
(1998)
The role of vitrification in anhydrobiosis.
Annu Rev Physiol
60:
73-103
[CrossRef][Web of Science][Medline]
Crowe JH,
Crowe LM,
Chapman D
(1984)
Preservation of membranes in anhydrobiotic organisms. The role of trehalose.
Science
223:
701-703
[Abstract/Free Full Text]
Elbein AD
(1974)
The metabolism of
,
-trehalose.
Adv Carbohydr Chem
30:
227-256
[CrossRef]
Fitchette-Lainé A-C, Denmai L-A, Lerouge P, Faye L (1998)
Analysis of N- and O-glycosylation of plant proteins. In C
Cunningham, AJR Porter, eds, Recombinant Proteins from Plants:
Production and Isolation of Clinically Useful Compounds. Humana Press,
Totowa, NJ, pp 271-290
Frohman MA,
Dush MK,
Martin GR
(1988)
Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer.
Proc Natl Acad Sci USA
85:
8998-9002
[Abstract/Free Full Text]
Goddijn OJM,
Smeekens S
(1998)
Mini-review: sensing trehalose biosynthesis in plants.
Plant J
14:
143-146
[CrossRef][Web of Science][Medline]
Goddijn OJM,
Verwoerd TC,
Voogd E,
Krutwagen R,
de Graaf P,
van Dun K,
De Laat A,
Van den Elzen P,
Damm B,
Pen J
(1995)
Transgenic tobacco plants as a model system for the production of trehalose.
Plant Physiol
99:
1443-1448
Goddijn OJM,
Verwoerd TC,
Voogd E,
Krutwagen RWHH,
de Graaf PTHM,
Poels J,
van Dun K,
Ponstein AS,
Damm BJP
(1997)
Inhibition of trehalase activity enhances trehalose accumulation in transgenic plants.
Plant Physiol
113:
181-190
[Abstract]
Hottiger T,
De Virgilio C,
Hall MN,
Boller T,
Wiemken A
(1994)
The role of trehalose synthesis for the acquisition of thermotolerance in yeast. II. Physiological concentrations of trehalose increase the thermal stability of proteins in vitro.
Eur J Biochem
219:
187-193
[Medline]
Iwahashi H,
Obuchi K,
Fujii S,
Komatsu Y
(1995)
The correlative evidence suggesting that trehalose stabilizes membrane structure in the yeast Saccharomyces cerevisiae.
Cell Mol Biol
41:
763-769
[Web of Science][Medline]
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of the bacteriophage T4.
Nature
227:
680-685
[CrossRef][Medline]
Müller J,
Boller T,
Wiemken A
(1995a)
Trehalose and trehalase in plants: recent developments.
Plant Sci
112:
1-9
Müller J,
Boller T,
Wiemken A
(1995b)
Effects of validamycin A, a potent trehalase inhibitor, and phytohormones on trehalose metabolism in roots and nodules of soybean and cowpea.
Planta
197:
362-368
[Web of Science]
Müller J,
Boller T,
Wiemken A
(1998)
Trehalose affects sucrose synthase and invertase activities in soybean (Glycine max [L.] Merr.) roots.
J Plant Physiol
153:
255-257
[Web of Science]
Müller J,
Staehelin C,
Mellor RB,
Boller T,
Wiemken A
(1992)
Partial purification and characterization of trehalase from soybean nodules.
J Plant Physiol
140:
8-13
Müller J,
Xie Z-P,
Staehelin C,
Mellor RB,
Boller T,
Wiemken A
(1994)
Trehalose and trehalase in root nodules from various legumes.
Physiol Plant
90:
86-92
[CrossRef]
Ribeiro MJS,
Reinders A,
Boller T,
Wiemken A,
De Virgilio C
(1997)
Mol Microbiol
25:
571-581
[CrossRef][Medline]
Romero C,
Bellés JM,
Vayá JL,
Serrano R,
Culiáñez-Macià FA
(1997)
Expression of the yeast trehalose-6-phosphate synthase gene in transgenic tobacco plants: pleiotropic phenotypes include drought tolerance.
Planta
201:
293-297
[Medline]
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Sprenger N,
Bortlik K,
Brandt A,
Boller T,
Wiemken A
(1995)
Purification, cloning, and functional expression of sucrose:fructan 6-fructosyltransferase, a key enzyme of fructan synthesis in barley.
Proc Natl Acad Sci USA
92:
11652-11656
[Abstract/Free Full Text]
Staehelin C,
Granado J,
Müller J,
Wiemken A,
Mellor RB,
Felix G,
Regenass M,
Broughton WJ,
Boller T
(1994)
Perception of Rhizobium nodulation factors by tomato cells and inactivation by root chitinases.
Proc Natl Acad Sci USA
91:
2196-2200
[Abstract/Free Full Text]
Vogel G,
Aeschbacher RA,
Müller J,
Boller T,
Wiemken A
(1998)
Trehalose-6-phosphate phosphatases from Arabidopsis thaliana: identification by functional complementation of the yeast tps2 mutant.
Plant J
13:
673-683
[CrossRef][Web of Science][Medline]
Wiemken A
(1990)
Trehalose in yeast, stress protectant rather than reserve carbohydrate.
J Gen Mol Microbiol
58:
209-217