|
Plant Physiol. (1999) 119: 627-634
The Two Major Types of Plant Plasma Membrane
H+-ATPases Show Different Enzymatic Properties and Confer
Differential pH Sensitivity of Yeast Growth1
Hong Luo,
Pierre Morsomme, and
Marc Boutry*
Unité de Biochimie Physiologique, Université Catholique
de Louvain, Place Croix du Sud 2-20, B-1348 Louvain-la-Neuve,
Belgium
 |
ABSTRACT |
The proton-pumping ATPase
(H+-ATPase) of the plant plasma membrane is encoded by two
major gene subfamilies. To characterize individual
H+-ATPases, PMA2, an H+-ATPase isoform of
tobacco (Nicotiana plumbaginifolia), was expressed in
Saccharomyces cerevisiae and found to functionally
replace the yeast H+-ATPase if the external pH was kept
above 5.0 (A. de Kerchove d'Exaerde, P. Supply, J.P. Dufour, P. Bogaerts, D. Thinès, A. Goffeau, M. Boutry [1995] J Biol
Chem 270: 23828-23837). In the present study we replaced the
yeast H+-ATPase with PMA4, an H+-ATPase isoform
from the second subfamily. Yeast expressing PMA4 grew at a pH as low as
4.0. This was correlated with a higher acidification of the external
medium and an approximately 50% increase of ATPase activity compared
with PMA2. Although both PMA2 and PMA4 had a similar pH optimum
(6.6-6.8), the profile was different on the alkaline side. At pH 7.2 PMA2 kept more than 80% of the maximal activity, whereas that of PMA4
decreased to less than 40%. Both enzymes were stimulated up to 3-fold
by 100 µg/mL lysophosphatidylcholine, but this stimulation vanished
at a higher concentration in PMA4. These data demonstrate functional differences between two plant H+-ATPases expressed in the
same heterologous host. Characterization of two PMA4 mutants selected
to allow yeast growth at pH 3.0 revealed that mutations within the
carboxy-terminal region of PMA4 could still improve the enzyme,
resulting in better growth of yeast cells.
 |
INTRODUCTION |
The plasma membrane H+-ATPase plays a
pivotal role in plant physiology. By extruding protons from the cell,
an electrochemical gradient is created across the plasma membrane,
providing the driving force for ion and nutrient uptake, intracellular
pH regulation, maintenance of cell turgidity, and related phenomena
such as cell growth, organ and stomata movement, and salinity tolerance
(for review, see Serrano, 1989 ; Sussman, 1994 ; Michelet and Boutry, 1995 ; Palmgren, 1998 ).
The plant H+-ATPase is encoded by a multigene
family of approximately 10 genes (Harper et al., 1990 , 1994 ; Perez et
al., 1992 ; Ewing and Bennett, 1994 ). However, all of the
H+-ATPase genes that have been identified at the
cDNA level in several species can be classified into two subfamilies
according to their sequence identity. Divergence between these
subfamilies that represent the most highly expressed genes seems to
predate the evolution of current monocotyledonous and dicotyledonous
species (Moriau et al., 1993 ).
Biochemical characterization of individual
H+-ATPase isoforms and the unraveling of their
possible differences in structure, kinetics, and regulatory features
will help us understand the respective roles of the two major
H+-ATPase subfamilies. Unfortunately, this kind
of study is hindered in plants because of the simultaneous presence of
several isoforms within a single organ. However, the heterologous
expression of individual H+-ATPases in the yeast
Saccharomyces cerevisiae has provided a way of overcoming
this difficulty. Three Arabidopsis H+-ATPase
genes, AHA1, AHA2, and AHA3, all
belonging to the second subfamily, have been expressed in yeast
(Villalba et al., 1992 ; Palmgren and Christensen, 1994 ). AHA1 and AHA3
did not allow growth and AHA2 permitted slow growth when the yeast
H+-ATPase gene, under the control of a
Gal-induced promoter, was turned off. Characterization of the three
gene products that accumulated in ER-derived internal membranes
revealed quantitative differences in enzymatic properties (Palmgren and
Christensen, 1994 ).
On the other hand, pma2, a Nicotiana
plumbaginifolia H+-ATPase gene from the
first subfamily, complemented a strain of S. cerevisiae deprived of its H+-ATPase genes if the external
pH was kept above 5.0 (de Kerchove d'Exaerde et al., 1995 ). Therefore,
this expression system made it possible to characterize biochemically a
plant H+-ATPase in a purified plasma membrane
fraction devoid of contaminant yeast H+-ATPase.
It was thus important to test a N. plumbaginifolia isoform of the second subfamily in the same expression
system.
In the present study we show that the plant pma4 also
successfully replaced the yeast H+-ATPase gene
and supported yeast growth. However, in contrast to the strain
expressing pma2, which is unable to grow at an external pH
lower than 5.0, the yeast strain containing pma4 can grow at a pH as low as 4.0. Biochemical characterization of PMA4 and PMA2 revealed differences in enzymatic properties, pH sensitivity, and LPC
stimulation. In addition, we selected two pma4 mutants with
improved ATPase, which allow yeast growth at an external pH of 3.0.
 |
MATERIALS AND METHODS |
Chemicals
5-Fluoroorotic acid was purchased from PCR, Inc. (Gainesville,
FL), Na2ATP from Sigma, protease inhibitors from
Boehringer Mannheim, yeast extract from KAT (Ohly, Hamburg, Germany),
and yeast nitrogen base amino acids from Difco (Detroit, MI). All other
reagents were of analytical grade.
Plasmid Construction
The pma4 cDNA from Nicotiana
plumbaginifolia, cpma4 described by Moriau et al.
(1993) , was cloned as a 3363-bp EcoRI restriction fragment
in the plasmid vector PTZ19U starting 105 bp upstream from the
initiation ATG of the PMA open reading frame and extending 353 bp
beyond the stop codon. Within the 5 untranslated region is a small,
5-codon upstream open reading frame located 83 nucleotides upstream
from the start of the PMA open reading frame. To prevent any potential
interference of the 5 and 3 untranslated regions in the expression of
the pma4 gene in yeast, these were eliminated by PCR.
In the 5 region we made use of a BamHI restriction site in
the plasmid and of a PstI site 371 nucleotides downstream of
the PMA4 initiation codon. Two oligonucleotides, one corresponding to
nucleotides 14 to +5 of the PMA4 translation initiation codon (CGCGGATCCGTGGAGCAGAGATGGC; the introduced BamHI
site is underlined), and the other complementary to nucleotides 445 to
427 downstream of the PMA4 translation initiation codon
(CGGCTTCCTGTTCACTCC), were synthesized to amplify the corresponding
region in between. This amplified fragment, digested with
BamHI and PstI, was then used to replace the
corresponding original BamHI-PstI fragment, producing a new 5 region without the upstream open reading
frame.
The same strategy was applied for the removal of the 3 untranslated
region using a HindIII site in the plasmid and an
AflII site 417 nucleotides upstream of the stop codon. Two
oligonucleotides, one corresponding to a sequence upstream of the
AflII site ( 369 to 351 upstream of the stop codon;
AGCATTATTTTCTACCTC) and the other complementary to nucleotides +18 to
+36 downstream of the stop codon
(CGCAAGCTTCCTCTCCCTTTCTTGTGT; the introduced
HindIII site is underlined), were synthesized for PCR
amplification. The amplified fragment was then introduced to replace
the original AflII-HindIII region. The correct
sequence of the modified pma4 cDNA was verified by
sequencing.
This modified pma4 was then released as a
BamHI-HindIII fragment and introduced into the
yeast Yeplac181 plasmid (bearing the 2µ origin of replication
and the LEU2 marker) containing the promoter region of the
yeast PMA1 gene (de Kerchove d'Exaerde et al., 1995 ). The
transcription-terminator region of the yeast PMA1 gene was
then released as a 1.2-kb XbaI fragment, blunted by Klenow
DNA polymerase, and inserted into the HindIII site (also blunted by the Klenow polymerase) of Yeplac181, yielding
2µp(PMA1)pma4.
Culture Conditions
Yeast was grown at 30°C in a rich medium containing 2% (w/v)
yeast extract and 2% Glu (YGlu medium) or Gal (YGal medium), or in a
synthetic medium containing 0.7% yeast nitrogen base without amino
acids, 0.11% drop mix (Treco, 1989 ), all of the amino acids except
those used for selection (His, Leu, Ura, and Trp), and 2% Glu
(MGlu-His,Leu,Ura,Trp) or 2% Gal (MGal-His,Leu,Ura,Trp). Solid media
also contained 2% agar (Difco). These media were supplemented with 20 mM K2HPO4 and
buffered to the pH indicated using HCl or KOH.
Yeast Strains
Several yeast strains were used in this study. YPS14-4 (Supply et
al., 1993 ) was the wild-type S. cerevisiae. YAK2 (de
Kerchove d'Exaerde et al., 1995 ) was deleted from its own
H+-ATPase genes, PMA1 and
PMA2, and survived with the yeast PMA1 under the
control of the GAL1 promoter in a centromeric plasmid PRS-316 (Sikorski and Hieter, 1989 ). YAKpma2 (de Kerchove
d'Exaerde et al., 1995 ) corresponds to YAK2, in which the centromeric
plasmid bearing the yeast PMA1 was replaced by a
multicopy plasmid bearing the plant pma2 cDNA under the
control of the yeast PMA1 promoter. The strain YAKpma4
was obtained as follows: YAK2 was transformed with
2µp(PMA1)pma4 (see above) and was plated on
MGal-His,Leu,Trp,Ura. Transformants were replicated on MGlu-His,Leu,Trp
medium containing 0.1% 5-fluoroorotic acid to delete the strain of the
URA3 plasmid pRS-316 containing the yeast PMA1
gene under the control of the GAL1 promoter. Loss of this
plasmid was verified by Southern-blot analysis. Yeast cells were
transformed after treatment with lithium acetate and PEG according to
the method of Ito et al. (1983) .
Selection of Mutants
Several single colonies of the YAKpma4 strain were inoculated
individually into 5 mL of YGlu medium, pH 5.5, and grown until they
reached the stationary phase. After centrifugation and resuspension in
200 µL of water, the yeast cells from each culture were plated onto
solid YGlu medium, pH 3.0. Spontaneous mutants growing under these
nonpermissive conditions appeared after 3 d at 30°C.
Sequencing of pma4 and Its Mutants
The 2µp(PMA1)pma4 plasmid from both
wild-type and mutant yeast strains was retrieved and transferred to
Escherichia coli. The plasmid DNA was sequenced using a
series of synthetic primers scattered throughout the pma4
gene. The wild-type and mutated 2µp(PMA1)pma4 were finally
reintroduced into the YAK2 strain to verify the phenotype they
conferred.
Plasma Membrane Preparation and Protein Determination
Plasma membranes were prepared according to the method of Goffeau
and Dufour (1988) . Yeast cells were grown in a 1.5-L culture (YGlu
medium) and harvested at a density of 80 × 106 to 100 × 106
cells/mL. The cell pellet was then washed three times with ice-cold water and resuspended (1.5 mL/g fresh weight) in 250 mM
sorbitol, 1 mM MgCl2, 50 mM imidazole, pH 7.5 (NaOH), 1 mM PMSF,
and 5 mM DTT. After disruption, subcellular fractionation,
and plasma membrane enrichment, the plasma membranes were finally
resuspended in 10 mM imidazole, pH 7.5 (NaOH), 1 mM MgCl2, and 1 mM PMSF,
and then divided into aliquots, frozen in liquid nitrogen, and stored
at 80°C. The protein concentration was determined using the
Bradford method (1976) with BSA as the standard.
ATPase Assays
ATPase activity was assayed at 30°C in 50 µL of a medium
containing 6 mM MgATP, 1 mM free
Mg2+ (MgCl2), 50 mM Mes-NaOH, pH 7.0, 10 mM sodium azide (a
mitochondrial ATPase inhibitor), 0.2 mM Na molybdate (a
phosphatase inhibitor), 20 mM KNO3 (a
vacuolar ATPase inhibitor), and 4 µg of proteins. The reaction was
stopped after 12 min by the addition of 60 µL of 5% TCA, 30 µL of
50% NH4 molybdate (in 4 N
H2SO4), 30 µL of 1%
aminonaphthosulfonic acid, and 3% NaHSO3.
A700 was read after 15 min.
Km and Vmax
were determined using an ATP-regenerating system (100 µg/mL pyruvate
kinase and 5 mM PEP). The concentration of MgATP
varied between 40 µM and 10 mM. Km and
Vmax were determined using Eadie-Hofstee
plots. The optimal pH was determined as described above except that
three buffers were mixed (50 mM Mes, 50 mM Mops, and 50 mM Tris)
and adjusted to the pH indicated with HCl or NaOH. The amounts of ATP
and Mg2+ to be added to the reaction mixture at
the pH indicated were calculated as described by Wach et al. (1990) to
obtain the desired concentration of MgATP and
Mg2+. All data presented in the figures represent
the means ± SD of at least three
independent experiments using two separate membrane preparations.
Measurement of Glu-Induced Acid Efflux from Yeast Cells
Yeast cells were grown in a 100-mL culture (YGlu medium at pH 5.5 [YAKpma4] or 6.5 [YAKpma2]), harvested at the late-exponential phase, washed four times with ice-cold water, and stored on ice. For
each assay 109 cells were incubated in 10 mL of
250 mM sorbitol at 30°C in a vial with a magnetic barrel
and a pH electrode of a microprocessor pH meter
(Wissenschaftlich-Technische Werkstätten, Weiheim, Germany). Once
a stable pH baseline was established (after about 5 min), 250 mM Glu was added as an energy source and the external pH
was recorded over time.
SDS-PAGE
Proteins (30 µg) were suspended in a buffer containing 60 mM Tris-HCl, pH 6.8, 5% (w/v) glycerol, 1% (w/v) SDS, 10 mM DTT, 1 mM PMSF, 2 µg/mL each of leupeptin,
aprotinin, antipain, pepstatin, and chymotrypsin, and 0.005%
bromphenol blue. The samples were kept on ice for 15 min and
centrifuged at 12,000g (15,000 rpm) for 1 min (Biofuge 15, Heraleus Sepatech GmbH, Hanau, Germany). The supernatant was loaded
onto a 10% SDS-polyacrylamide gel using the Bio-Rad Mini-Protean II
system (Laemmli, 1970 ).
 |
RESULTS |
pma4 Supports Yeast Growth at Low pH
A cDNA clone for the N. plumbaginifolia pma4 gene was
placed on a yeast 2µ-derived multicopy plasmid under the
control of the strong and constitutive transcriptional promoter of
PMA1, the major S. cerevisiae
H+-ATPase gene. The plasmid was introduced into
the yeast strain YAK2 deleted from its own two
H+-ATPase genes, PMA1 and
PMA2, and surviving on Gal medium with a centromeric plasmid
carrying the yeast PMA1 controlled by the GAL1
promoter. Independent transformants obtained in a Gal medium were still
able to grow when shifted to a Glu medium, indicating that the plant
H+-ATPase allowed yeast growth. To eliminate the
potential residual expression of yeast PMA1 under control of
the GAL1 promotor and any recombination between the yeast
PMA1 and the plant pma4, we induced the loss of
the plasmid bearing the yeast PMA1 by spreading the
transformants on a Glu medium containing 5-fluoroorotic acid, which
becomes toxic in the presence of the URA3 gene present in the latter plasmid. Colonies (YAKpma4) growing in the presence of the
drug lost the URA3 plasmid containing the yeast
PMA1 gene, as confirmed by Southern-blot analysis (data not
shown).
The plant H+-ATPase PMA4 isoform was thus able to
sustain growth of cells devoid of yeast
H+-ATPase. Moreover, it allowed yeast growth at a
pH as low as 4.0 (YAKpma4; Fig. 1A),
whereas PMA2, a N. plumbaginifolia isoform belonging to the
first subfamily, could replace the yeast
H+-ATPase only if the pH medium was kept above
5.0 (YAKpma2; Fig. 1A). However, at a more alkaline pH (7.0) PMA2 still
allowed yeast growth, whereas PMA4 barely allowed growth. These
observations were confirmed by measurement of the duplication time in
liquid cultures (Fig. 1B). At the optimal pH (6.0), YAKpma2 and YAKpma4 grew 3.4- or 5.3-fold slower, respectively, than a wild-type yeast. At
a lower pH, however, YAKpma4 grew better than YAKpma2, confirming its
capacity to better sustain a low pH.

View larger version (69K):
[in this window]
[in a new window]
| Figure 1.
Growth at different pH levels of yeast cells
expressing wild-type and mutant plant plasma membrane
H+-ATPases. A, The wild-type YPS14-4 strain (yeast
PMA1 under its own promoter), the recipient strain YAK2
(yeast PMA1 under the GAL1 promoter),
YAKpma2, YAKpma4, and the mutants T861N and Q882ochre were grown in
YGlu medium at pH 6.5 and spotted onto solid YGlu medium at pH 3.0, 4.0, 5.0, 6.0, and 7.0, and at pH 5.5 in the presence of 20 mM acetic acid (HAc). B, The indicated strains were
inoculated in liquid YGlu medium at pH 4.0, 5.0, 6.0, and 7.0, and the
cell number was scored periodically. The duplication time was
calculated during the exponential phase. ND, Not determined; , no
division.
|
|
Single Mutations of pma4 Conferred Growth at Low pH
We recently showed that point mutations in various domains of
N. plumbaginifolia pma2 expressed in yeast improved the
H+-pumping activity and conferred growth at pH
4.0 (Morsomme et al., 1996 , 1998 ). Because the wild-type N. plumbaginifolia pma4 already allowed yeast growth at pH 4.0, we
searched for mutants able to grow at pH 3.0. When independent colonies
were cultured at a permissive pH (5.5) and streaked on selective plates
at pH 3.0, five spontaneous mutants were obtained. The plasmid
containing the pma4 gene from YAKpma4 and each of the
selected mutants was retrieved and reintroduced into E. coli. The coding sequence of pma4 in the wild type and
each of the mutants was then determined using a series of synthetic
primers. In three cases, no modification of the pma4 gene
was found, indicating that genetic modification occurred elsewhere in
the plasmid or in the host genome (extragenic mutation). However, a
single nucleotide change within the pma4 gene did occur in
another two mutants (intragenic mutation). In the mutant T861N, a point
mutation (C to A) transformed the amino acid Thr-861 (ACT) into Asn
(AAT), whereas in the mutant Q882ochre, a point mutation (C to
T) created a stop codon at codon 882 (CAG to TAG), resulting in an
H+-ATPase shortened of the last 71 amino acids.
To determine whether the two mutations detected in the plant
pma4 were indeed responsible for improved growth, the
retrieved plasmids containing wild-type or mutant plant pma4
genes were reintroduced into the YAK2 strain, which was then depleted
of the centromeric-URA3 plasmid containing the yeast
H+-ATPase gene, as described above. The yeast
strains containing wild-type and mutant PMA4 were tested for
growth at various pH levels. Unlike YAKpma4, the two mutants grew at pH
3.0 and 7.0 (Fig. 1A). A preliminary interpretation of these data
suggested that the mutations that had occurred in T861N and Q882ochre
improved H+-ATPase functioning. To test this
hypothesis, we grew the different strains at pH 5.5 in the presence of
20 mM acetate. This weak acid is thought to
acidify the cytosol and prevent the growth of cells containing
partially defective H+-ATPase that is unable to
create a strong electrochemical H+ gradient
across the plasma membrane (McCusker et al., 1987 ). Only YPS14-4, a
wild-type yeast strain expressing its own
H+-ATPase genes, and the two mutants T861N and
Q882ochre were able to grow in the presence of acetate (Fig. 1A),
suggesting that their H+-ATPases function better.
We have seen so far that the plant pma4 allows yeast growth
at a lower pH than pma2 and that two pma4 mutants
allow growth at an even lower pH. These different growth properties
could be attributed to distinct amounts of
H+-ATPase assembled in the plasma membrane or to
distinct intrinsic enzyme properties. To clarify this point, plasma
membranes were purified from the various transformants and the proteins
were analyzed by SDS-PAGE (Fig. 2). Plant
H+-ATPases appeared as the major band in the
plasma membrane fraction. Their identity was confirmed by western-blot
analysis (data not shown). The Q882ochre
H+-ATPase had a lower apparent
Mr (approximately 90,000), in agreement with the nonsense mutation identified. The pattern shown by this mutant
also indicated that the major band observed in the other strains
integrally represents the H+-ATPase. Considering
the H+-ATPase amount, no large difference could
be identified between the strains, except for a slightly larger
quantity for YAKpma2 and Q882ochre. Therefore, better growth
performances could not be explained by a larger amount of
H+-ATPase in the plasma membrane. Therefore, we
compared the kinetic properties of the H+-ATPase
isoforms.

View larger version (96K):
[in this window]
[in a new window]
| Figure 2.
Electrophoretic analysis of plasma membrane
proteins of yeast cells expressing wild-type and mutant plant plasma
membrane H+-ATPases. Purified plasma membranes (30 µg)
prepared from YAKpma2, YAKpma4, and the two mutants Q882ochre and T861N
were analyzed by electrophoresis on a 10% polyacrylamide gel and
stained with Coomassie brilliant blue. Molecular mass markers (MW) are
shown on the left in kilodaltons.
|
|
PMA2 and PMA4 H+-ATPases Have Distinct Enzymatic
Properties
The apparent Km for MgATP and
Vmax for ATP hydrolysis were determined on
a purified plasma membrane fraction (Table
I). We observed a higher
Vmax for PMA4 compared with PMA2, whereas
their Km values were not significantly
different. Because the amount of PMA4 was slightly lower in the plasma
membrane fraction (Fig. 2), we conclude that the molecular activity for
the PMA4 H+-ATPase was clearly increased. A
decrease of Km and a further increase of
Vmax was observed for the two mutants
derived from YAKpma4 (Table I).
The pH dependence of H+-ATPase activity provided
another means of distinguishing the isoforms. Both PMA2 and PMA4 had a
similar pH optimum (around 6.6-6.8; Fig.
3). However, sensitivity to alkaline pH
was much more acute in PMA4. For example, at pH 7.4 the activity of
PMA2 was still around 80% of the optimum, whereas that of PMA4 decreased to less than 25%. The pH optima for both PMA4 mutants were
not modified but their activity did not decrease as sharply as that of
PMA4 at alkaline pH.

View larger version (17K):
[in this window]
[in a new window]
| Figure 3.
pH dependence of ATP hydrolysis by purified
plasma membrane fractions prepared from YAKpma2, YAKpma4, Q882ochre,
and T861N measured as described in ``Materials and Methods'' at the
pH values indicated. ATPase activity is expressed as the percentage of
maximal activity observed for each strain. The mean specific activities
at the optimal pH were: 0.46 (PMA2), 0.60 (PMA4), 0.69 (T861N), and
1.01 (Q882ochre) µmol Pi min 1 mg 1.
|
|
LPC is a phospholipid that specifically stimulates plant
H+-ATPase (Palmgren et al., 1988 ). Maximal
stimulation for PMA2 (about 3-fold) was obtained at 200 µg/mL LPC
(Fig. 4). Stimulation of PMA4 occurred at
a lower LPC concentration but decreased above 50 µg/mL LPC. A more
dramatic effect was observed for both mutants; their
H+-ATPase was only slightly increased at low LPC
concentrations and became almost completely inhibited at 200 µg/mL
LPC.

View larger version (20K):
[in this window]
[in a new window]
| Figure 4.
Effect of LPC on H+-ATPase activity.
ATP hydrolysis was measured as described in ``Materials and Methods''
on purified plasma membrane fractions prepared from YAKpma2, YAKpma4,
Q882ochre, and T861N in the presence of the LPC concentrations
indicated, and is expressed as the percentage of activity observed in
the absence of LPC. Mean specific activities in the absence of LPC
were: 0.44 (PMA2), 0.61 (PMA4), 0.65 (T861N), and 1.14 (Q882ochre)
µmol Pi min 1 mg 1.
|
|
PMA2 and PMA4 H+-ATPases Confer Different Rates of
External Acidification
Acidification of the external medium of a yeast suspension has
usually been interpreted as a reflection of
H+-ATPase activity (Foury et al., 1977 ; Serrano
et al., 1986 ). Therefore, we recorded the rate of acidification of the
external medium induced by the addition of an energy source (Glu).
Although Glu might also operate as a regulator of the yeast
H+-ATPase (Eraso and Portillo, 1994 ), this is
unlikely for the plant enzymes expressed in yeast, because sequences
involved in Glu regulation in the yeast pump are not present in the
plant enzymes. Despite the similarity in their initial rate, the
steady-state level of acidification by the YAKpma4 strain exceeded that
of YAKpma2 (Fig. 5). The mutants T861N
and Q882ochre performed even better. These in vivo observations are in
agreement with the phenotypes observed on solid media at different pH
values (Fig. 1).

View larger version (11K):
[in this window]
[in a new window]
| Figure 5.
Acidification of the external medium by yeast
cells expressing plant H+-ATPase. Cells of YAKpma2,
YAKpma4, T861N, and Q882ochre were grown in YGlu medium, washed, and
incubated at 30°C for 5 min, and then Glu (250 mM) was
added and the pH was recorded.
|
|
 |
DISCUSSION |
All of the cDNA encoding for plasma membrane
H+-ATPases cloned so far from various organs of
plant species fall into two subfamilies according to their predicted
amino acid sequence identity. Therefore, we can assume that throughout
the whole plant these subfamilies account for the major part of the
expression of the H+-ATPase. It was not possible
to determine directly by means of plasma membranes prepared from plant
material whether the H+-ATPases encoded by these
two subfamilies had similar enzymatic properties. Indeed, in N. plumbaginifolia (Perez et al., 1992 ; Moriau et al., 1993 ), as in
tomato (Ewing and Bennett, 1994 ), transcripts for members of the two
subfamilies were found in all of the organs analyzed. However, within
an organ, expression might have been restricted to particular cell
types, as has already been shown for several genes in Arabidopsis (De
Witt et al., 1991 ; Harper et al., 1994 ) and N. plumbaginifolia (Michelet et al., 1994 ; L. Moriau, B. Michelet, P. Bogaerts, and M. Boutry, unpublished data). Heterologous expression in
the yeast S. cerevisiae appeared to be an alternative method
for comparing the basic properties of plant
H+-ATPases.
The pma2 gene, as the most highly expressed from the first
N. plumbaginifolia subfamily (Perez et al., 1992 ), had
already been characterized in this way (de Kerchove d'Exaerde et al., 1995 ). Here we have shown that PMA4, the unique member of the second
subfamily in N. plumbaginifolia, like PMA2, is able to replace the yeast H+-ATPase.
The present study provides several lines of evidence demonstrating that
PMA2 and PMA4 possess distinct enzymatic properties. Kinetic
differences were previously reported for three Arabidopsis H+-ATPases, AHA1, AHA2, and AHA3, which were also
expressed in yeast (Palmgren and Christensen, 1994 ). The
Km for ATP varied between 0.15 and 1.5 mM, and the Vmax
varied between 1.25 and 2.45 µmol Pi min 1
mg 1. Their pH optimum was similar (6.4-6.5),
but AHA3 was more sensitive to inactivation at lower pH values, whereas
AHA2 showed a slightly more rapid decrease of activity on the alkaline
side of the peak. AHA2 was stimulated by LPC to a larger extent (160%)
than AHA1 (60%) or AHA3 (50%) (Palmgren and Christensen, 1994 ). The
differences observed between N. plumbaginifolia PMA2 and
PMA4 are also related to kinetics, pH profile, and LPC activation. An
important observation was that PMA4, like AHA1, AHA2, and AHA3 (all
four belong to the same subfamily), showed a sharp decline in activity
above pH 7.0, whereas PMA2 had a much broader profile.
At the cellular level, the capacity to allow yeast growth seems to be a
major difference between the Arabidopsis and N. plumbaginifolia H+-ATPases. Among the three
AHA genes, only AHA2 was able to allow yeast
growth (to a very low degree) when the yeast
H+-ATPase controlled by a Gal-induced promoter
was silenced by shifting the cells from a Gal to a Glu medium (Palmgren
and Christensen, 1993 , 1994 ). On the contrary, both N. plumbaginifolia pma2 and pma4 complemented well enough
to allow definitive removal of the yeast
H+-ATPase gene. The origin of this functional
difference is not clear. It does not seem to be explained by
differences in ATPase activity, because the Arabidopsis
H+-ATPases displayed a 2- to 3-fold higher
specific ATPase activity than the N. plumbaginifolia PMA2 or
PMA4. However, a direct comparison has to be made with care because the
Arabidopsis H+-ATPases were characterized in the
ER-derived membranes where they accumulate, whereas PMA2 and PMA4 were
analyzed in a plasma membrane fraction. A more appropriate comparison
would thus require a quantitative analysis of
H+-ATPase in the same membrane fraction. A
different potential in H+-ATPase isoforms to be
directed to the plasma membrane might have a direct consequence on
their ability to allow yeast growth. Finally, we cannot exclude the
possibility that more trivial factors such as minor differences in the
expression system or growth media are responsible for the differences
in behavior between the Arabidopsis and N. plumbaginifolia
H+-ATPases.
The data clearly suggest that PMA4 performs better as an enzyme than
PMA2: the Vmax at the optimum pH is higher
and this is probably reflected at the cell level by the faster and
higher acidification of the external medium. The physiological
consequence of this is that pma4 still allowed yeast growth
at pH 4.0, whereas pma2 did not. This begs the question of
whether differences between PMA2 and PMA4 are linked to kinetic or
thermodynamic properties. To answer this, H+
pumping and the H+:ATP ratio should be measured.
For example, we might consider the possibility that PMA2 and PMA4
differ in their H+:ATP ratios. A ratio of 1.09 H+ pumped per ATP hydrolyzed was found for the
red beet plasma membrane H+-ATPase (Briskin et
al., 1995 ). However, this ratio might have been an average of data
provided by several isoforms expressed in the same organ.
The cells expressing PMA4 grew more slowly at pH 7.0 than at pH 6.0, which was not the case for PMA2. If we assume that in the yeast
transformant the pH of the growth medium exerted some influence on the
internal pH (Smith and Raven, 1979 ), the difficulty that YAKpma4 had in
growing at pH 7.0 might be explained by the sharp decrease in ATPase
activity above pH 6.6 observed for PMA4, whereas the activity-versus-pH
profile was much broader for PMA2.
A detailed examination of pma2 and pma4
expression at the cell level is being developed by means of a reporter
gene. Our current observations are that both are expressed in various
plant cell types, some of them common to both genes (L. Moriau, B. Michelet, P. Bogaerts, and M. Boutry, unpublished data). If this was
confirmed at the protein level, it would indicate that two different
isoforms might be found in the same cell. Such a situation might be
interesting if a large H+-ATPase activity is
required for activating intense transport, and also if different
H+-ATPase isoforms must respond to separate
regulatory systems. It has been proposed, and in some cases shown, that
H+-ATPases are involved in many physiological
functions, such as internal pH regulation, nutrient uptake, turgor
control, and cell elongation, and are regulated by various endogenous
or external factors (Serrano, 1989 ; Sussman, 1994 ; Michelet and Boutry,
1995 ; Palmgren, 1998 ).
An enzyme such as PMA4, which has a sharp alkaline pH profile, might be
well adapted to the regulation of the cytosolic pH (Smith and Raven,
1979 ). The difference in sensitivity to LPC observed for PMA2 and PMA4
might be another sign of differential regulation. LPC is considered to
be a natural regulator because its presence within the plasma membrane
may result from the activity of phospholipase A2
(Palmgren et al., 1988 ). Phospholipases act within regulatory pathways
such as that resulting in the wound response (Lee et al., 1997 ), and
thus might also intervene in the regulatory signaling leading to
H+-ATPase activation. The reduced stimulation
(PMA4) or even the strong inhibition (T861N and Q882ochre) found after
increasing the LPC concentration has not been observed for Arabidopsis
wild-type or mutant H+-ATPase (Palmgren and
Christensen, 1993 , 1994 ). The physiological implications of this are
not clear, although it might be an indication of differential
regulation of ATPase isoforms. For example, although a low LPC
concentration might be involved in displacing the C-terminal region
(Palmgren and Christensen, 1993 ), a high LPC concentration might
disrupt some interactions in the hydrophobic region of PMA4 and
consequently reduce its activity.
We previously characterized PMA2 mutants that allow yeast to grow at pH
4.0 (Morsomme et al., 1996 ). Although the YAKpma4 strain could already
grow at this pH, the discovery of two pma4 mutants that grew
at pH 3.0 showed that there was still room for improvement. Like the
majority of the mutants derived from YAKpma2, the two YAKpma4 mutants
were modified in their C-terminal regions. We previously showed that
the mutations in pma2 effectively changed the
H+-ATPase into an activated conformation,
possibly moving away from the C-terminal domain (Morsomme et al.,
1998 ). This presumably also applies to the PMA4 mutants, because the
mutation T861N in PMA4 is localized in one residue adjacent to the
mutation R865T identified in PMA2 (Morsomme et al., 1996 ). Moreover,
mutants of both enzymes lead to similar changes (e.g. increased enzyme activity, reduced LPC stimulation, and faster acidification of the
external medium).
The improved activity of wild-type PMA4 compared with PMA2 could be
explained by a change in conformation similar to that suggested for the
mutants. Thus, compared with PMA2, PMA4 would be at a more active
stage, but would still be subject to improvement by point mutations.
The activity difference between PMA2 and PMA4 might also reflect
differences in intrinsic properties between these enzymes that are not
necessarily relevant to the regulatory C-terminal region.
 |
FOOTNOTES |
1
This work was supported by the Interuniversity
Poles of Attraction Program (Belgian State Prime Minister's Office,
Federal Office for Scientific, Technical and Cultural Affairs), by the European Community's BIOTECH Program, and by the Belgian Fund for
Scientific Research.
*
Corresponding author; e-mail boutry{at}fysa.ucl.ac.be; fax
32-10-47-38-72.
Received August 11, 1998;
accepted November 11, 1998.
 |
ABBREVIATIONS |
Abbreviation:
LPC, lysophosphatidylcholine.
 |
ACKNOWLEDGMENTS |
We are indebted to J. Nader and P. Gosselin for their excellent
technical assistance, and to Dr A. de Kerchove d'Exaerde for helpful
discussions during this study.
 |
LITERATURE CITED |
Bradford MM
(1976)
A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72:
248-254
[CrossRef][Web of Science][Medline]
Briskin DP,
Basu S,
Assman SM
(1995)
Characterization of the red beet plasma membrane H+-ATPase reconstituted in a planar bilayer system.
Plant Physiol
108:
393-398
[Abstract]
de Kerchove d'Exaerde A,
Supply P,
Dufour JP,
Bogaerts P,
Thinès D,
Goffeau A,
Boutry M
(1995)
Functional complementation of a null mutation of the yeast Saccharomyces cerevisiae plasma membrane H+-ATPase by a plant H+-ATPase gene.
J Biol Chem
270:
23828-23837
[Abstract/Free Full Text]
De Witt ND,
Harper J,
Sussman MR
(1991)
Evidence for a plasma membrane proton pump in phloem cells of higher plants.
Plant J
1:
121-128
[CrossRef][Web of Science][Medline]
Eraso PE,
Portillo F
(1994)
Molecular mechanism of regulation of yeast plasma membrane H+-ATPase by glucose.
J Biol Chem
14:
10393-10399
Ewing NN,
Bennett AB
(1994)
Assessment of the number and expression of P-type H+-ATPase genes in tomato.
Plant Physiol
106:
547-557
[Abstract]
Foury F,
Boutry M,
Goffeau A
(1977)
Efflux of potassium induced by DIO-9, a plasma membrane ATPase inhibitor in the yeast Schizosaccharomyces pombe.
J Biol Chem
252:
4577-4583
[Free Full Text]
Goffeau A,
Dufour JP
(1988)
Plasma membrane preparation from the yeast Saccharomyces cerevisiae.
Methods Enzymol
157:
528-533
[Medline]
Harper JF,
Manney L,
Sussman MR
(1990)
The Arabidopsis thaliana plasma membrane H+-ATPase multigene family.
J Biol Chem
265:
13601-13608
[Abstract/Free Full Text]
Harper JF,
Manney L,
Sussman MR
(1994)
The plasma membrane H+-ATPase gene family in Arabidopsis: genomic sequence of AHA10 which is expressed primarily in developing seeds.
Mol Gen Genet
244:
572-587
[Web of Science][Medline]
Ito H,
Fukuda Y,
Murata K,
Kimura A
(1983)
Transformation of intact yeast cells with alkali cations.
J Bacteriol
153:
163-168
[Abstract/Free Full Text]
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:
680-685
[CrossRef][Medline]
Lee S,
Suh S,
Kim S,
Crain RC,
Kwak JM,
Nam HG,
Lee Y
(1997)
Systemic elevation of phosphatidic acid and lysophospholipid levels in wounded plants.
Plant J
12:
547-556
[CrossRef]
McCusker JH,
Perlin DS,
Haber JE
(1987)
Pleiotropic plasma membrane ATPase mutations of Saccharomyces cerevisiae.
Mol Cell Biol
7:
4082-4088
[Abstract/Free Full Text]
Michelet B,
Boutry M
(1995)
The plasma membrane H+-ATPase, a highly regulated enzyme with multiple physiological functions.
Plant Physiol
108:
1-6
[Web of Science][Medline]
Michelet B,
Lukaszewicz M,
Dupriez V,
Boutry M
(1994)
A plant plasma membrane proton-ATPase gene is regulated by development and environment and shows signs of a translational regulation.
Plant Cell
6:
1375-1389
[Abstract]
Moriau L,
Bogaerts P,
Jonniaux JL,
Boutry M
(1993)
Identification and characterization of a second plasma membrane H+-ATPase gene subfamily in Nicotiana plumbaginifolia.
Plant Mol Biol
21:
955-963
[CrossRef][Web of Science][Medline]
Morsomme P,
Dambly S,
Maudoux O,
Boutry M
(1998)
Single point mutations distributed in ten soluble and membrane regions of the Nicotiana plumbaginifolia plasma membrane PMA2 H+-ATPase activate the enzyme and modify the structure of the C-terminal region.
J Biol Chem
273:
34837-34842
[Abstract/Free Full Text]
Morsomme P,
de Kerchove d'Exaerde A,
De Meester S,
Thinès D,
Goffeau A,
Boutry M
(1996)
Single point mutations in various domains of a plant plasma membrane H+-ATPase expressed in Saccharomyces cerevisiae increase H+-pumping and permit yeast growth at low pH.
EMBO J
15:
5513-5526
[Web of Science][Medline]
Palmgren MG
(1998)
Proton gradients and plant growth: role of the plasma membrane H+-ATPase.
Adv Bot Res
28:
1-70
Palmgren MG,
Christensen G
(1993)
Complementation in situ of the yeast plasma membrane H+-ATPase gene pma1 by an H+-ATPase gene from a heterologous species.
FEBS Lett
317:
216-222
[CrossRef][Web of Science][Medline]
Palmgren MG,
Christensen G
(1994)
Functional comparisons between plant plasma membrane H+-ATPase isoforms expressed in yeast.
J Biol Chem
269:
3027-3033
[Abstract/Free Full Text]
Palmgren MG,
Sommarin M,
Ulvskov P,
Jorgensen PL
(1988)
Modulation of plant plasma membrane H+-ATPase from oat roots by lysophosphatidylcholine, free fatty acids and phospholipase A2.
Physiol Plant
74:
11-19
[CrossRef]
Perez C,
Michelet B,
Ferrant V,
Bogaerts P,
Boutry M
(1992)
Differential expression within a three-gene subfamily encoding a plasma membrane H+-ATPase in Nicotiana plumbaginifolia.
J Biol Chem
267:
1204-1211
[Abstract/Free Full Text]
Serrano R
(1989)
Structure and function of plasma membrane ATPase.
Annu Rev Plant Physiol Plant Mol Biol
40:
61-91
[CrossRef][Web of Science]
Serrano R,
Montesinos C,
Cid A
(1986)
A temperature-sensitive mutant of the yeast plasma membrane ATPase obtained by in vitro mutagenesis.
FEBS Lett
208:
143-146
[CrossRef]
Sikorski RS,
Hieter P
(1989)
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:
19-27
[Abstract/Free Full Text]
Smith FA,
Raven JA
(1979)
Intracellular pH and its regulation.
Annu Rev Plant Physiol
30:
289-311
[Web of Science]
Supply P,
Wach A,
Thinès-Sempoux D,
Goffeau A
(1993)
Proliferation of intracellular structure upon overexpression of the PMA2 ATPase in Saccharomyces cerevisiae.
J Biol Chem
268:
19744-19752
[Abstract/Free Full Text]
Sussman MR
(1994)
Molecular analysis of proteins in the plasma membrane.
Annu Rev Plant Physiol Plant Mol Biol
45:
211-234
[CrossRef][Web of Science]
Treco DA
(1989)
Basic techniques of yeast genetics.
In
FA Ausubel,
R Brent,
RE Kingston,
DD Moore,
JG Seidman,
JA Smith,
K Struhl,
eds, Current Protocols in Molecular Biology.
Wiley-Interscience, New York, pp 13.1.1-13.1.7
Villalba JM,
Palmgren MG,
Berberian GE,
Ferguson C,
Serrano R
(1992)
Functional expression of plant plasma membrane H+-ATPase in yeast endoplasmic reticulum.
J Biol Chem
267:
12341-12349
[Abstract/Free Full Text]
Wach A,
Ahlen J,
Gräber P
(1990)
The H+-ATPase of the plasma membrane of yeast.
Eur J Biochem
189:
675-682
[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
F. Gevaudant, G. Duby, E. von Stedingk, R. Zhao, P. Morsomme, and M. Boutry
Expression of a Constitutively Activated Plasma Membrane H+-ATPase Alters Plant Development and Increases Salt Tolerance
Plant Physiology,
August 1, 2007;
144(4):
1763 - 1776.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kanczewska, S. Marco, C. Vandermeeren, O. Maudoux, J.-L. Rigaud, and M. Boutry
Activation of the plant plasma membrane H+-ATPase by phosphorylation and binding of 14-3-3 proteins converts a dimer into a hexamer
PNAS,
August 16, 2005;
102(33):
11675 - 11680.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Lefebvre, H. Batoko, G. Duby, and M. Boutry
Targeting of a Nicotiana plumbaginifolia H+-ATPase to the Plasma Membrane Is Not by Default and Requires Cytosolic Structural Determinants
PLANT CELL,
July 1, 2004;
16(7):
1772 - 1789.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Luo, D. A. Scott, and R. Docampo
Trypanosoma cruzi H+-ATPase 1 (TcHA1) and 2 (TcHA2) Genes Complement Yeast Mutants Defective in H+ Pumps and Encode Plasma Membrane P-type H+-ATPases with Different Enzymatic Properties
J. Biol. Chem.,
November 8, 2002;
277(46):
44497 - 44506.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Muramatsu, A. Harada, Y. Ohwaki, Y. Kasahara, S. Takagi, and T. Fukuhara
Salt-Tolerant ATPase Activity in the Plasma Membrane of the Marine Angiosperm Zostera marina L.
Plant Cell Physiol.,
October 15, 2002;
43(10):
1137 - 1145.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Yan, Y. Zhu, C. Muller, C. Zorb, and S. Schubert
Adaptation of H+-Pumping and Plasma Membrane H+ ATPase Activity in Proteoid Roots of White Lupin under Phosphate Deficiency
Plant Physiology,
May 1, 2002;
129(1):
50 - 63.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Zhao, V. Dielen, J.-M. Kinet, and M. Boutry
Cosuppression of a Plasma Membrane H+-ATPase Isoform Impairs Sucrose Translocation, Stomatal Opening, Plant Growth, and Male Fertility
PLANT CELL,
April 1, 2000;
12(4):
535 - 546.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
F. Svennelid, A. Olsson, M. Piotrowski, M. Rosenquist, C. Ottman, C. Larsson, C. Oecking, and M. Sommarin
Phosphorylation of Thr-948 at the C Terminus of the Plasma Membrane H+-ATPase Creates a Binding Site for the Regulatory 14-3-3 Protein
PLANT CELL,
December 1, 1999;
11(12):
2379 - 2392.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Dambly and M. Boutry
The Two Major Plant Plasma Membrane H+-ATPases Display Different Regulatory Properties
J. Biol. Chem.,
March 2, 2001;
276(10):
7017 - 7022.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Maudoux, H. Batoko, C. Oecking, K. Gevaert, J. Vandekerckhove, M. Boutry, and P. Morsomme
A Plant Plasma Membrane H+-ATPase Expressed in Yeast Is Activated by Phosphorylation at Its Penultimate Residue and Binding of 14-3-3 Regulatory Proteins in the Absence of Fusicoccin
J. Biol. Chem.,
June 2, 2000;
275(23):
17762 - 17770.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|