Plant Physiol. Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Tegelen, L. J.P.
Right arrow Articles by Wullems, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Tegelen, L. J.P.
Right arrow Articles by Wullems, G. J.
Agricola
Right arrow Articles by van Tegelen, L. J.P.
Right arrow Articles by Wullems, G. J.

Plant Physiol. (1999) 119: 705-712

Purification and cDNA Cloning of Isochorismate Synthase from Elicited Cell Cultures of Catharanthus roseus

Léon J.P. van Tegelen, Paolo R.H. Moreno1, Anton F. Croes*, Robert Verpoorte, and George J. Wullems

Department of Experimental Botany, University of Nijmegen, Toernooiveld 1, 6525 ED Nijmegen, The Netherlands (L.J.P.v.T., A.F.C., G.J.W.); and Leiden/Amsterdam Center for Drug Research, Division of Pharmacognosy, Gorlaeus Laboratories, Leiden University, P.O. Box 9502, 2300 RA Leiden, The Netherlands (P.R.H.M., R.V.)

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

Isochorismate is an important metabolite formed at the end of the shikimate pathway, which is involved in the synthesis of both primary and secondary metabolites. It is synthesized from chorismate in a reaction catalyzed by the enzyme isochorismate synthase (ICS; EC 5.4.99.6). We have purified ICS to homogeneity from elicited Catharanthus roseus cell cultures. Two isoforms with an apparent molecular mass of 64 kD were purified and characterized. The Km values for chorismate were 558 and 319 µM for isoforms I and II, respectively. The isoforms were not inhibited by aromatic amino acids and required Mg2+ for enzyme activity. Polymerase chain reaction on a cDNA library from elicited C. roseus cells with a degenerated primer based on the sequence of an internal peptide from isoform II resulted in an amplification product that was used to screen the cDNA library. This led to the first isolation, to our knowledge, of a plant ICS cDNA. The cDNA encodes a protein of 64 kD with an N-terminal chloroplast-targeting signal. The deduced amino acid sequence shares homology with bacterial ICS and also with anthranilate synthases from plants. Southern analysis indicates the existence of only one ICS gene in C. roseus.

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

The shikimate pathway is a major pathway in primary and secondary plant metabolism (Herrmann, 1995). It provides chorismate for the synthesis of the aromatic amino acids Phe, Tyr, and Trp, which are used in protein biosynthesis, but also serves as a precursor for a wide variety of aromatic substances (Herrmann, 1995; Weaver and Hermann, 1997; Fig. 1a). Chorismate is also the starting point of a biosynthetic pathway leading to phylloquinones (vitamin K1) and anthraquinones (Poulsen and Verpoorte, 1991). The first committed step in this pathway is the conversion of chorismate into isochorismate, which is catalyzed by ICS (Poulsen and Verpoorte, 1991; Fig. 1b). Its substrate, chorismate, plays a pivotal role in the synthesis of shikimate-pathway-derived compounds, and its distribution over the various pathways is expected to be tightly regulated. Elicited cell cultures of Catharanthus roseus provide an example of the partitioning of chorismate. Concurrently, these cultures produce both Trp-derived indole alkaloids and DHBA (Moreno et al., 1994). In bacteria DHBA is synthesized from isochorismate (Young et al., 1969). Elicitation of C. roseus cell cultures with a fungal extract induces not only several enzymes of the indole alkaloid biosynthetic pathway (Pasquali et al., 1992) but also ICS (Moreno et al., 1994). Information concerning the expression and biochemical characteristics of the enzymes that compete for available chorismate (ICS, CM, and AS) may help us to understand the regulation of the distribution of this precursor over the various pathways. Such information is already available for CM (Eberhard et al., 1996) and AS (Poulsen et al., 1993; Bohlmann et al., 1995) but not for ICS.


View larger version (18K):
[in this window]
[in a new window]
  		Figure 1. a, Position of ICS in the plant metabolism. SA, Salicylic acid, OSB, o-succinylbenzoic acid. b, Reaction catalyzed by ICS.

Isochorismate plays an important role in bacterial and plant metabolism as a precursor of o-succinylbenzoic acid, an intermediate in the biosynthesis of menaquinones (vitamin K2) (Weische and Leistner, 1985) and phylloquinones (vitamin K1; Poulsen and Verpoorte, 1991). In bacteria isochorismate is also a precursor of siderophores such as DHBA (Young et al., 1969), enterobactin (Walsh et al., 1990), amonabactin (Barghouthi et al., 1991), and salicylic acid (Serino et al., 1995). Although evidence from tobacco would indicate that salicylic acid in plants is derived from Phe via benzoic acid (Yalpani et al., 1993; Lee et al., 1995; Coquoz et al., 1998), it cannot be excluded that it is also synthesized from isochorismate. In the secondary metabolism of higher plants, isochorismate is a precursor for the biosynthesis of anthraquinones (Inoue et al., 1984; Sieweke and Leistner, 1992), naphthoquinones (Müller and Leistner, 1978), catalpalactone (Inouye et al., 1975), and certain alkaloids in orchids (Leete and Bodem, 1976).

ICS was first extracted and partially purified from crude extracts of Aerobacter aerogenes (Young and Gibson, 1969). Later, ICS activity was detected in protein extracts of cell cultures from plants of the Rubiaceae, Celastraceae, and Apocynaceae families (Ledüc et al., 1991; Poulsen et al., 1991; Poulsen and Verpoorte, 1992). Genes encoding ICS have been cloned from bacteria such as Escherichia coli (Ozenberger et al., 1989), Pseudomonas aeruginosa (Serino et al., 1995), Aeromonas hydrophila (Barghouthi et al., 1991), Flavobacterium K3-15 (Schaaf et al., 1993), Hemophilus influenzae (Fleischmann et al., 1995), and Bacillus subtilis (Rowland and Taber, 1996). Both E. coli and B. subtilis have two distinct ICS genes; one is involved in siderophore biosynthesis and the other is involved in menaquinone production (Daruwala et al., 1996, 1997; Müller et al., 1996; Rowland and Taber, 1996). The biochemical properties of the two ICS enzymes from E. coli are different (Daruwala et al., 1997; Liu et al., 1990). Sequence analysis has revealed that the bacterial ICS enzymes share homology with the chorismate-utilizing enzymes AS and p-aminobenzoate synthase, suggesting that they share a common evolutionary origin (Ozenberger et al., 1989).

Much biochemical and molecular data concerning the shikimate pathway in plants have accumulated in recent years (Schmid and Amrhein, 1995; Weaver and Hermann, 1997), but relatively little work has been done on ICS from higher plants. The enzyme has been partially purified from Galium mollugo cell cultures (Ledüc et al., 1991, 1997), but purification of the ICS protein to homogeneity has remained elusive, probably because of instability of the enzyme.

Our interests focus on the role of ICS in the regulation of chorismate partitioning over the various pathways. Furthermore, we studied ICS in C. roseus to gain insight into the biosynthesis of DHBA in higher plants (Moreno et al., 1994). In this paper we report the first purification, to our knowledge, of ICS to homogeneity from a plant source and the cloning of the corresponding cDNA.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Chemicals

Chemicals were of an analytical grade from Merck (Darmstadt, Germany). Barium chorismate (60% purity) was purchased from Sigma.

Cell Cultures

Catharanthus roseus (L.) G. Don cell cultures were grown in Murashige-Skoog medium (Murashige and Skoog, 1962) supplemented with 30 g/L Suc, as described previously (Moreno et al., 1993). Cell cultures were elicited with Pythium aphanidermatum (CBS, Baarn, The Netherlands) filtrate, as described by Moreno et al. (1993).

ICS Assay

ICS (EC 5.4.99.6) activity was determined according to the method of Poulsen et al. (1991) with slight modifications. The incubation mixture (250 µL) contained 0.1 M Tris-HCl, pH 7.5, 2 mM chorismate, 10 mM MgCl2, and enzyme extract (125 µL crude extracts, 10- to 100-µL column fractions). After the sample was incubated for 60 min at 30°C, the reaction was stopped by the addition of 62.5 µL of methanol:sec-butanol (1:1, v/v). The samples were centrifuged and analyzed by HPLC. Assay mixtures (250 µL) for determination of pH optima contained 190 µL of 0.2 M stock solutions of the various buffers (citrate, pH 4.0-6.0; Bis-Tris, pH 6.0-7.0; Tris-HCl, pH 7.0-9.0; and Gly, pH 9.0-10.0). All other assay components were dissolved in distilled water.

Enzyme Extraction

Cells were harvested by suction 16 h after elicitation, washed once with water, immediately frozen in liquid nitrogen, and stored at -80°C. Six hundred grams of frozen cells was homogenized in a Waring blender equipped with a stainless steel bucket. Extraction buffer (1 mL; 0.1 M Tris-HCl, pH 7.5, 10% glycerol [v/v], 1 mM DTT, 0.2 mM PMSF, 10 mM leupeptin, and 1 mM EDTA) and 50 mg of PVP were added per gram fresh weight. After thawing, the homogenate was centrifuged at 10,000g for 30 min to remove cell debris. The supernatant is referred to as the crude extract.

Purification of ICS

All steps were performed at 4°C. The crude extract was cleared by filtration through a 200-µm glass-fiber filter. The filtrate was concentrated using a tangential flow ultrafiltration unit (Provario, PAL-Filtron, Breda, The Netherlands) equipped with a 30-kD cut-off membrane. Solid ammonium sulfate (30% saturation) was added to the extract. After the precipitate was stirred for 20 min it was removed by centrifugation at 10,000g for 30 min. More ammonium sulfate was added to the supernatant to 60% saturation. The precipitate was collected by centrifugation at 10,000g for 30 min. The pellet was dissolved in 50 mL of buffer A (20 mM triethanolamine-HCl, pH 7.5, 10% [v/v] glycerol, 1 mM DTT, and 0.2 mM PMSF), and solid KCl was added to a final concentration of 2 M. After the sample was centrifuged at 13,000g for 15 min, the supernatant was applied to a Phenyl-Sepharose CL-4B column (72 mL, 2.6 × 13.5 cm, Pharmacia) equilibrated in buffer B (buffer A plus 2 M KCl). After the column was washed with 300 mL of buffer B, ICS was eluted with a 700-mL linear gradient from buffer B to A, and then by 150 mL of buffer A, at a flow of 1 mL/min.

Fractions of 10 mL were collected, and those containing ICS activity were pooled and concentrated using the ultrafiltration unit. The concentrate was desalted by gel filtration over Sephadex G-25 columns (PD-10 columns, Pharmacia), equilibrated in buffer A, and applied to a 20-mL Blue A column (Amicon, Beverly, MA). After application the flow was stopped for 30 min to allow binding. The column was washed by reverse flow (0.25 mL/min) with 40 mL of buffer A. ICS was eluted in the same way with a 160-mL gradient from buffer A to 50% buffer B, and 4-mL fractions were collected. Fractions containing ICS activity were pooled, concentrated, and desalted on PD-10 columns equilibrated with buffer C (20 mM triethanolamine-HCl, pH 8.0, 5% [v/v] glycerol, and 1 mM DTT). The desalted sample was applied to a Mono-Q HR 5/5 column (Pharmacia) equilibrated in buffer C. The column was washed with 16 mL of buffer C and ICS was eluted with an 80-mL linear gradient from buffer C to D (buffer C plus 0.5 M KCl). The flow was 0.5 mL/min and fractions of 0.5 mL were collected.

Protein Analysis

Protein concentrations were determined in microtiter plates using the Bradford (1976) microassay method according to the manufacturer (Bio-Rad) with BSA as a standard. SDS-PAGE and native PAGE were carried out on a PhastSystem (Pharmacia) using precast 8% to 25% gradient gels, and proteins were visualized by silver staining (Davis et al., 1986).

Data Evaluation

Kinetic data were fitted to V = Vmax S/(Km + S), where Vmax is the maximum velocity, S is the substrate or cofactor concentration, and Km is the concentration giving a half-maximal rate, using the EZ-FIT curve-fitting computer program (Perella, 1988).

Peptide Sequencing

A band containing approximately 20 µg of ICS II was isolated from a native PAGE gel. The protein was digested with trypsin and the resulting peptides were separated with reverse-phase HPLC. Sequence analysis was carried with an automated sequenator (model 477A, PE, Applied Biosystems) according to protocols of the manufacturer.

Preparation of PCR Template DNA

A cDNA library (a generous gift from Dr. J. Memelink) was constructed from mRNA isolated from C. roseus cell cultures 2 and 4 h after elicitation with yeast extract. The cDNA was prepared with the ZAP-cDNA synthesis kit (Stratagene) and cloned into the lambda ZAPII vector. A culture of Escherichia coli XL1-Blue, in the exponential growth phase was infected with this cDNA library and grown for 15 min without shaking. An equal volume of double-strength YT medium (Sambrook et al., 1989) was added, and the culture was grown for another 2 h at 37°C with shaking. The culture was incubated for 20 min at 72°C and centrifuged for 10 min at 14,000g. Phage DNA was precipitated from the supernatant with ethanol, redissolved in 200 µL of water, and used for PCR without further processing.

PCR

For PCR a degenerated sense primer (LPT42) against peptide 3 (Fig. 4) was designed with the sequence 5'-GCIGGICCIGTIGGITT(C/T)TT(C/T)GG(A/C/T/G)GG-3'. As an antisense primer, the T7 primer complementary to a lambda ZAPII vector sequence close to the poly(A+) tail of the cDNA was used.


View larger version (61K):
[in this window]
[in a new window]
  		Figure 4. Alignment of the ICS from C. roseus with the menaquinone-specific ICS from E. coli and the alpha -subunit of an AS from Ruta graveolens. The putative ICS from Arabidopsis recently deposited in the EMBL databank by H. Meng, G. Peter, and G. Pullman is included in the alignment for a comparison. Sequences shown are C. roseus ICS (C. r. ICS; accession no. AJ006065), Arabidopsis putative ICS (A. t. ICS1; accession no. AF078080), E. coli MenF (E. c. MenF; accession no. D90857), and R. graveolens ASalpha 2 (R. g. ASalpha 2; accession no. L34343; Bohlmann et al., 1995). Residues identical to those in C. roseus ICS are in bold, perfectly conserved residues are indicated with asterisks, and well-conserved residues are indicated with periods. Elements involved in Trp inhibition of AS (Caliguri and Bauerle, 1991; Bohlmann et al., 1995) are indicated with "<". Residues essential for AS activity (Caliguri and Bauerle, 1991; Bohlmann et al., 1995) are indicated with ">". Peptides isolated and sequenced from the purified C. roseus ICS are indicated with left-right-arrow .

PCR reactions were performed with 5 µL of template DNA, 100 µM deoxyribonucleotide triphosphates, 2 mM MgCl2, 20 pmol of the T7 primer, 200 pmol of the LPT42 primer, and 1 unit of Goldstar Taq polymerase (Eurogentec, Seraing, Belgium) in the buffer supplied by the manufacturer. PCR amplification was performed with 35 cycles of 1 min of denaturation at 94°C, 1 min of annealing at 61°C, and 3 min of elongation at 72°C, except for the last cycle when elongation was extended to 10 min. A 520-bp PCR product was isolated from a 1% agarose gel and cloned into the pCR2.1 vector (Invitrogen, San Diego, CA), resulting in pCRIS3.

cDNA Library Screening

For the C. roseus cDNA library, 450,000 plaque-forming units were screened with a 440-bp EcoRI/PvuII fragment of pCRIS3 labeled with [gamma -32P]ATP. Prehybridization and hybridization were performed at 58°C in 6× SSC containing 5× Denhardt's solution (Sambrook et al., 1989), 0.5% SDS, and 100 µg/mL herring-sperm DNA. Filters were washed in 0.5% SSC with 0.1% SDS at 58°C. Positive plaques were isolated and subjected to a second screening under the same conditions. Positive plaques from this second screening were excised in vivo according to the protocols of the manufacturer (Stratagene).

Sequence Analysis

cDNA clones were sequenced with 17-mer oligonucleotides using the Prism sequencing kit (Perkin-Elmer). The reaction products were resolved on an ABI PRISM 310 genetic analyzer (Perkin-Elmer). Sequences were analyzed using software from the University of Wisconsin Genetics Computer Group (Devereux et al., 1984).

Southern Hybridization of Plant DNA

DNA (20 µg) was extracted from leaves and digested with EcoRV or BamHI. The digest was electrophoresed on a 0.8% agarose gel. Southern blotting and hybridization were performed on a Hybond-N+ membrane as described by the manufacturer (Amersham). The full-length ICS cDNA was used as a probe.

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Purification of ICS

Cultures of C. roseus were elicited 5 d after inoculation, when the cells were in the exponential growth phase. Sixteen hours later, the cell mass was harvested (Moreno et al., 1994). The fungal elicitor induced ICS (EC 5.4.99.6) to a high level. ICS was purified from these cultures as summarized in Table I. Ammonium sulfate precipitation yielded good and reproducible fractionation without loss of ICS activity. Hydrophobic interaction chromatography on Phenyl-Sepharose produced good separation of ICS activity from more than 90% of the protein. Dye-affinity chromatography on a Blue A column proved to be a crucial purification step. This chromatographic step resulted in a 15-fold increase in specific activity.

 
View this table:
[in this window] [in a new window]
  		Table I. Purification of ICS from 600 g of elicited cells of C. roseus

Anion-exchange chromatography on a fast-protein liquid chromatography Mono-Q column was used as the next purification step. On this column ICS activity was separated into two peaks (ICS I and ICS II), as shown in Figure 2. The specific activities were increased 532- and 754-fold for ICS I and II, respectively, relative to the combined activities in the crude extract. ICS I and II had an activity ratio of 1:2, a number found in several independent purifications. Reinjection of either ICS resulted in the occurrence of only the injected ICS in the chromatogram, indicating that one isoform is not a breakdown product of the other.


View larger version (25K):
[in this window]
[in a new window]
  		Figure 2. Elution profile of the Mono-Q column used in the purification of ICS from elicited cell cultures of C. roseus.

After a final purification by native PAGE, ICS II was obtained in a pure form (Fig. 3b). Measurement of ICS activity in slices from neighboring nonstained lanes showed that only the band migrating at approximately 96 kD contained ICS activity. SDS-PAGE of ICS II revealed that this protein is about 64 kD (Fig. 3d). The purest Mono-Q fraction containing ICS I showed several bands on SDS-PAGE (Fig. 3c), as expected from the native PAGE separation (Fig. 3a). One of these bands is a protein of approximately 64 kD (Fig. 3a, arrow), the intensity of which correlated with the ICS activity in the various Mono-Q fractions tested.


View larger version (34K):
[in this window]
[in a new window]
  		Figure 3. Purified ICS isoforms from elicited cell cultures of C. roseus. Proteins were analyzed on a PhastSystem using precast 8% to 25% gradient gels. Proteins were visualized by silver staining (Davis et al., 1986). ICS I (left) and ICS II (right) were analyzed on native PAGE (a and b) and SDS-PAGE (c and d) gels. The positions of the molecular mass markers used are indicated in kD. The arrows indicate the position of the ICS protein bands.

Biochemical Characterization

Both isoforms showed an identical pH dependency with a broad pH optimum between 7.0 and 9.0 and 50% of the maximal activity at pH 6.5 and 10. The presence of Mg2+ was essential for product formation. Separate incubations with other divalent ions (Mn2+, Co2+, Ni2+, Ca2+, Zn2+, Ba2+, Cu2+, Cd2+, and Fe2+) in a concentration of 10 mM did not result in enzyme activity of either isoform. ICS activity of both isoforms was not inhibited by the presence of Tyr, Phe, or Trp in the assay mixture.

Kinetic studies of the ICS isoforms were carried out separately for each isoform with Mono-Q fractions completely free of AS and CM activities. The dependence of the activity on the chorismate concentration was determined at 10 mM MgCl2. Both isoforms showed standard Michaelis-Menten kinetics for chorismate. The Km values for chorismate were 558 ± 5 and 319 ± 41 µM for ICS I and II, respectively. Typical saturation curves were obtained for the enzyme activity of both isoforms as a function of Mg2+ concentration (2 mM chorismate). The saturation curves followed Michaelis-Menten kinetics, with Km values of 1.27 ± 0.36 and 1.63 ± 0.12 mM for ICS I and II, respectively.

cDNA Cloning of ICS

The protein band containing ICS II was isolated from a native PAGE gel and digested with trypsin, which yielded about 50 peptides. Five peptides were isolated and sequenced. One of these peptides (no. 3) displayed high homology to bacterial ICS sequences (Fig. 4). Therefore, a degenerated primer was designed against this peptide. PCR on a cDNA library of elicited cell cultures of C. roseus with this primer and the T7 primer, complementary to a lambda ZAPII sequence close to the poly (A+) tail of the cDNA, yielded a fragment of 520 bp. This fragment was cloned and sequenced and proved to contain the complete coding sequence for peptide 3, confirming that we had amplified part of an ICS cDNA. A 440-bp fragment of the amplified DNA was used to screen the cDNA library. Screening of 450,000 plaques identified 52 independent, positive plaques.

Twelve randomly chosen plaques were isolated and subjected to a second screening with the same 440-bp probe. This resulted in the identification of seven independent, positive plaques. These were excised in vivo and partially sequenced (400 bp). All clones contained the previously amplified sequence at the 3' end. The longest clone had an insert of approximately 2.1 kb and contained an ATG codon near the 5' terminal end. The region around this ATG (TCCAATGGC) closely resembled the consensus sequence for translation initiation in plants (Lütke et al., 1987). The ATG codon was preceded by a sequence (TTCTCTCTCTCTCTCTCTCTCTCCCATCCA) with an 11-fold repetition of TC, which is rather unusual for a coding sequence. These features all point to the conclusion that translation starts at this point in the sequence. The cDNA with a complete length of 2078 bp (accession no. AJ006065) contained an open reading frame of 1740 nucleotides encoding a protein of 580 amino acids. The calculated molecular mass was 64 kD and the pI was 7.7. All five peptide sequences obtained from the purified protein were present in the deduced amino acid sequence and are indicated in Fig. 4. The 3'-untranslated region was of varying lengths in different clones, which indicates that different polyadenylation sites were used in the process of poly(A+) tail attachment.

The predicted protein is approximately 30% identical (40% homologous) with ICS from bacteria, with the most homology in the C-terminal region (Fig. 4). There is also 30% homology (15% identity) between the ICS protein and the alpha -subunits of AS genes cloned from Arabidopsis (Nigoyi and Fink, 1992) and R. graveolens (Bohlmann et al., 1995; Fig. 4). Also, the homology is strongest in the C-terminal part of the protein.

ICS is probably a plastidic enzyme, since the N-terminal region has the characteristics of a chloroplast transit peptide, i.e. a high number of basic amino acids, Ser residues, and hydroxylated amino acids (Von Heijne et al., 1989). There is no obvious cleavage site (Gavel and Von Heijne, 1990).

Figure 5 shows a Southern blot of C. roseus leaf DNA probed with the complete ICS cDNA. The DNA was digested with enzymes that did not cut in the cDNA. A single prominent, hybridizing band was detected in all of the lanes. This indicates that there is only one ICS gene in C. roseus.


View larger version (24K):
[in this window]
[in a new window]
  		Figure 5. Copy number of the ICS gene in C. roseus. DNA from leaves was digested with EcoRV (E) or BamHI (B), separated, and blotted onto a Hybond-N+ membrane. Hybridization was done with the full-length ICS cDNA.

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

Using a six-step purification method, we purified to homogeneity, for the first time to our knowledge, an ICS from a plant source. Sequence information from the protein led to isolation of a cDNA for ICS.

The biochemical characteristics such as substrate affinity, pH optimum, and cofactor requirements of ICS from C. roseus are similar to those in Galium mollugo (Ledüc et al., 1997) and Rubia tinctorum (L.J.P. van Tegelen, unpublished results). The ICS in C. roseus exists in two isoforms. The identical ratios between the isoforms in several independent purifications and their stability upon reinjection indicate that the dual state is not an artifact from the purification procedure. In elicited R. tinctorum cell cultures, ICS is also present in two isoforms, although in a different ratio (L.J.P. van Tegelen, unpublished results). In G. mollugo only one ICS activity was found (Ledüc et al., 1997). The bacteria B. subtilis and E. coli have two ICS proteins encoded by separate genes (Daruwala et al., 1996; Müller et al., 1996; Rowland and Taber, 1996). The ICS proteins have different functions, one in the biosynthesis of siderophores and the other in the biosynthesis of menaquinones (Müller et al., 1996), and they have quite different biochemical characteristics (Daruwala et al., 1997). In contrast, the isoforms in C. roseus do not differ very much in their biochemical properties.

Some enzymes in the shikimate pathway also exist in isoforms that are differentially regulated, as only one isoform is inducible by wounding or elicitation (Keith et al., 1991; Muday and Herrmann, 1992; Görlach et al., 1995). The ICS isoforms in C. roseus are both induced after elicitation.

Sequencing of the cDNA revealed that all peptides of the ICS protein sequenced are part of the deduced amino acid sequence. This proves that the cDNA really encodes ICS, a conclusion substantiated by the homology to the bacterial ICS proteins. The cDNA encodes a protein of 64 kD, which is equal to the molecular mass of the purified protein. The similarity was rather unexpected because the transit peptide is normally cleaved off upon transport into the plastid. Because no obvious cleavage site can be predicted from the sequence (Gavel and Von Heijne, 1990), it is impossible to estimate the molecular mass of the mature protein from the cDNA.

We did not use very stringent hybridization conditions in the screenings to avoid missing heterologous cDNAs possibly encoding ICS I. Nevertheless, the coding regions in all of the cDNAs analyzed were identical. This suggests that the two isoforms are encoded by the same cDNA and that the differences are caused by posttranscriptional modifications. This idea is substantiated by Southern analysis, which indicates that there is only one ICS gene.

The encoded protein possesses a plastidic import signal and is thus probably located in plastids. Almost all enzymes of the shikimate pathway contain a plastidic import sequence and are present in the plastids (Weaver and Herrmann, 1997). Location of ICS in the plastids makes sense because its substrate, chorismate, is biosynthesized there. Operation of ICS in the cytosol would require a translocator transporting chorismate out of the plastids. The presence of a cytosolic chorismate mutase (Eberhard et al., 1996) is the only indirect evidence for the existence of such a translocator.

The homology of the ICS protein with AS alpha -subunits (Fig. 4) points to a common reaction mechanism. The reaction catalyzed by ICS is an unusual 1,5-substitution. In bacteria, studies with O-labeling have shown that the incoming hydroxyl group is derived from the solvent and not from intramolecular transfer (Gould and Eisenberg, 1991). A Mg2+-coordinated transition state has been suggested for the conversion of chorismate to isochorismate. The alpha -subunits of AS catalyze a reaction very similar to that of ICS, except that the incoming nucleophile is ammonia. NMR and electron paramagnetic resonance studies of AS indicated that Mg2+ interacts with chorismate at the active site of the enzyme (Koslowski et al., 1995). The fact that only Mg2+ was able to activate the enzyme suggests that the ICS from C. roseus has specific affinity for Mg2+ in its active site.

All amino acids previously identified as being involved in the allosteric feedback inhibition by Trp in AS (Caligiuri and Bauerle, 1991; Bohlmann et al., 1995) are lacking from the ICS protein and, indeed, ICS is not inhibited by Trp or by any other aromatic amino acid. However, all residues considered essential for activity of AS (Bohlmann et al., 1995) are identical in ICS, with the exception of residue 487, which is an Ala conserved in all ICS proteins cloned so far.

ICS activity in the C. roseus cells is measurable only after elicitation (Moreno et al., 1994). Excessive drainage of chorismate into isochorismate-derived products under these conditions may be prevented by the low affinity of ICS for chorismate (558 and 319 µM for ICS I and II, respectively), as compared with that of AS (67 µM; Poulsen et al., 1993). No data are available for CM from C. roseus. The fact that ICS activity in C. roseus cells is measurable only after elicitation suggests that the flow of chorismate in the direction of isochorismate is controlled by differential gene expression. Future experiments will therefore focus on the regulation of expression of the chorismate-utilizing enzyme and its impact on metabolic trafficking at this important crossroad in plant metabolism.

    FOOTNOTES
1   Present address: Department of Quinica Fundamental, Instituto de Quinica, Universida de São Paolo, São Paolo, Brazil.
*   Corresponding author; e-mail croes{at}sci.kun.nl; fax 31-24-3553450.

   Received July 9, 1998; accepted November 4, 1998.

    ABBREVIATIONS

Abbreviations: AS, anthranilate synthase. CM, chorismate mutase. DHBA, 2,3-dihydroxybenzoic acid. ICS, isochorismate synthase.

    ACKNOWLEDGMENTS

We wish to thank Dr. Johan Memelink for the gift of the C. roseus cDNA library and Bert Goossen and Karl Weisz for maintaining a steady supply of cultured cells.

    LITERATURE  CITED
Top
Abstract
Introduction
Methods
Results
Discussion
References

Barghouthi S, Payne SM, Arceaux JEL, Byers BR (1991) Cloning, mutagenesis, and nucleotide sequence of a siderophore biosynthetic gene (AmoA) from Aeromonas hydrophyla. J Bacteriol 173: 5121-5128 [Abstract/Free Full Text]

Bohlmann J, DeLuca V, Eilert U, Martin W (1995) Purification and cDNA cloning of anthranilate synthase from Ruta graveolens: properties of native and recombinant enzymes. Plant J 7: 491-502 [CrossRef][Medline]

Bradford MM (1976) A rapid and sensitive method for quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254 [CrossRef][ISI][Medline]

Caligiuri MG, Bauerle R (1991) Identification of amino acid residues involved in feedback regulation of the anthranilate synthase complex from Salmonella typhimurium. J Biol Chem 266: 8328-8335 [Abstract/Free Full Text]

Coquoz J-L, Buchala A, Metraux JP (1998) The biosynthesis of salicylic acid in potato plants. Plant Physiol 117: 1095-1101 [Abstract/Free Full Text]

Daruwala R, Bhattacharyya DK, Kwon O, Meganathan R (1997) Menaquinone (vitamin K2) biosynthesis: overexpression, purification and characterization of a new isochorismate synthase from Escherichia coli. J Bacteriol 179: 3133-3138 [Abstract/Free Full Text]

Daruwala R, Kwon O, Meganathan R, Hudspeth MES (1996) A new isochorismate synthase specifically involved in menaquinone (vitamin K2) biosynthesis encoded by the menF gene. FEMS Microbiol Lett 140: 159-163 [CrossRef][Medline]

Davis LG, Dibner MD, Battey JF (1986) Basic Methods in Molecular Biology. Elsevier, New York, NY

Devereux J, Haeberli P, Smithies O (1984) A comprehensive set of sequence analysis programs for the Vax. Nucleic Acids Res 12: 387-395

Eberhard J, Bischoff M, Raesecke H-R, Amrhein N, Schmid J (1996) Isolation of a cDNA from tomato coding for an unregulated, cytosolic form of CM. Plant Mol Biol 31: 917-922 [CrossRef][ISI][Medline]

Fleischmann RD, Adams MD, White O, Clayton RA, Kirkness EF, Kerlavage AR, Bult CJ, Tomb J-F, Dougherty BA, Merrick JM, and others (1995) Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269: 496-512 [Abstract/Free Full Text]

Gavel Y, Von Heijne G (1990) A conserved cleavage-site motif in chloroplast transit peptides. FEBS Lett 261: 455-458 [CrossRef][ISI][Medline]

Görlach J, Raesecke H-R, Rentsch D, Regenass M, Roy P, Zala M, Keel C, Boller T, Amrhein N, Schmid J (1995) Temporally distinct accumulation of transcripts encoding enzymes of the prechorismate pathway in elicitor-treated, cultured tomato cells. Proc Natl Acad Sci USA 92: 3166-3170 [Abstract/Free Full Text]

Gould SJ, Eisenberg RL (1991) The origin of the C-2 hydroxyl in the isochorismate synthase reaction. Tetrahedron 47: 5979-5990 [CrossRef]

Herrmann K (1995) The shikimate pathway as an entry to aromatic secondary metabolism. Plant Physiol 107: 7-12 [Medline]

Inoue K, Shiobara Y, Nayeshiro H, Inouye H, Wilson G, Zenk MH (1984) Biosynthesis of anthraquinones and related compounds in Galium mollugo cell suspension cultures. Phytochemistry 23: 307-311 [CrossRef]

Inouye H, Ueda S, Inoue K, Hayashi T, Hibi T (1975) Chem Pharm Bull 23: 2523-2533

Keith B, Dong X, Ausubel FM, Fink GR (1991) Differential induction of 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase genes in Arabidopsis thaliana by wounding and pathogenic attack. Proc Natl Acad Sci USA 88: 8821-8825 [Abstract/Free Full Text]

Koslowski MC, Tom NJ, Seto CT, Sefler AM, Bartlet PA (1995) Chorismate-utilizing enzymes isochorismate synthase, anthralinate synthase, and p-aminobenzoate synthase: mechanistic insight through inhibitor design. J Am Chem Soc 117: 2128-2140 [CrossRef]

Ledüc C, Birgel I, Müller R, Leistner E (1997) Isochorismate hydroxymutase from a cell-suspension culture of Galium mollugo L. Planta 202: 206-210 [CrossRef]

Ledüc C, Ruhnau P, Leistner E (1991) Isochorismate hydroxymutase from Rubiaeae cell suspension cultures. Plant Cell Rep 10: 334-337

Lee HI, Leon J, Raskin I (1995) Biosynthesis and metabolism of salicylic acid. Proc Natl Acad Sci USA 92: 4076-4079 [Abstract/Free Full Text]

Leete E, Bodem GB (1976) Biosynthesis of shihunine in Derdobium pierardii. J Am Chem Soc 98: 6321-6329 [CrossRef]

Liu J, Quinn N, Berchtold GA, Walsh CT (1990) Overexpression, purification, and characterization of isochorismate synthase (EntC), the first enzyme involved in the biosynthesis of enterobactin from chorismate. Biochemistry 29: 1417-1425 [CrossRef][Medline]

Lütke HA, Chow KC, Mickel FS, Moss KA, Kern HF, Scheele GA (1987) Selection of initiation codons differs in plants and animals. EMBO J 6: 43-48 [ISI][Medline]

Moreno PRH, Van der Heijden R, Verpoorte R (1993) Effect of terpenoid precursor feeding and elicitation on formation of indole alkaloids in cell suspension cultures of Catharanthus roseus. Plant Cell Rep 12: 702-705

Moreno PRH, Van der Heijden R, Verpoorte R (1994) Elicitor-mediated induction of isochorismate synthase and accumulation of 2,3-dihydroxybenzoic acid in Catharanthus roseus cell suspension and shoot cultures. Plant Cell Rep 14: 188-191

Muday GK, Herrmann KM (1992) Wounding induces one of two isoenzymes of 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase in Solanum tuberosum. Plant Physiol 98: 496-500 [Abstract/Free Full Text]

Müller R, Dahm C, Schulte G, Leistner E (1996) An isochorismate hydroxymutase isogene from Escherichia coli. FEBS Lett 378: 131-134 [CrossRef][Medline]

Müller WU, Leistner E (1978) Metabolic relation between naphthalene derivatives in Juglans. Phytochemistry 17: 1735-1738 [CrossRef]

Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15: 473-497 [CrossRef]

Nigoyi KK, Fink GR (1992) Two anthranilate synthase genes in Arabidopsis: defense-related regulation of the tryptophan pathway. Plant Cell 4: 721-733 [Abstract/Free Full Text]

Ozenberger BA, Brickman TJ, McIntosh MA (1989) Nucleotide sequence of Escherichia coli isochorismate synthetase gene entC and evolutionary relationship of isochorismate synthetase and other chorismate-utilizing enzymes. J Bacteriol 171: 775-783 [Abstract/Free Full Text]

Pasquali G, Goddijn OJM, De Waal A, Verpoorte R, Schilperoort RA, Hoge JHC, Memelink J (1992) Coordinated regulation of two indole alkaloid biosynthetic genes from Catharanthus roseus by auxin and elicitors. Plant Mol Biol 18: 1121-1131 [CrossRef][ISI][Medline]

Perrella FW (1988) "EZ-FIT": a practical curve-fitting microcomputer program for the analysis of enzyme kinetic data on IBM-PC compatible computers. Anal Biochem 174: 437-447 [CrossRef][Medline]

Poulsen C, Bongaerts RJM, Verpoorte R (1993) Purification and characterization of anthranilate synthase from Catharanthus roseus. Eur J Biochem 212: 431-440 [Medline]

Poulsen C, Van der Heijden R, Verpoorte R (1991) Assay of isochorismate synthase from plant cell cultures by high-performance liquid chromatography. Phytochemistry 30: 2873-2878 [CrossRef]

Poulsen C, Verpoorte R (1991) Roles of chorismate mutase, isochorismate synthase and anthralinate synthase in plants. Phytochemistry 30: 377-386 [CrossRef]

Poulsen C, Verpoorte R (1992) Activities of chorismate utilizing enzymes and of enzymes involved in indole alkaloid biosynthesis in cell suspension cultures. Plant Physiol Biochem 30: 105-113

Rowland BM, Taber HW (1996) Duplicate isochorismate synthase genes of Bacillus subtilis: regulation and involvement in the biosynthesis of menaquinone and 2,3-dihydroxybenzoate. J Bacteriol 178: 854-861 [Abstract/Free Full Text]

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Schaaf PMM, Heide LE, Leistner EW, Tani Y, Karas M, Deutzmann R (1993) Properties of isochorismate hydroxymutase from Flavobacterium K3-15. J Nat Prod 56: 1294-1303 [Medline]

Schmid J, Amrhein N (1995) Molecular organization of the shikimate pathway in higher plants. Phytochemistry 39: 737-749 [CrossRef][ISI]

Serino L, Reimman C, Baur H, Beyeler M, Visca P, Haas D (1995) Structural genes for salicylate biosynthesis from chorismate in Pseudomonas aeruginosa. Mol Gen Genet 249: 217-228 [CrossRef][Medline]

Sieweke H-J, Leistner E (1992) Phytochemistry 31: 2329-2335 [CrossRef]

Von Heijne G, Stepphun J, Herrmann RG (1989) Domain structure of mitochondrial and chloroplast targeting peptides. Eur J Biochem 180: 535-545 [ISI][Medline]

Walsh CT, Liu J, Rusnak F, Sakaitani M (1990) Molecular studies on enzymes in chorismate metabolism and the enterobactin biosynthetic pathway. Chem Rev 90: 1105-1129 [CrossRef]

Weaver LM, Herrmann K (1997) Dynamics of the shikimate pathway in plants. Trends Plant Sci 2: 346-351 [CrossRef]

Weische A, Leistner E (1985) Cell free synthesis of o-succinylbenzoic acid from iso-chorismic acid, the key reaction in vitamin K2 (menaquinone) biosynthesis. Tetrahedron 26: 1487-1490 [CrossRef]

Yalpani N, León J, Lawton MA, Raskin I (1993) Pathway of salicylic acid biosynthesis in healthy and virus-inoculated tobacco. Plant Physiol 103: 315-321 [Abstract]

Young IG, Batterham TJ, Gibson F (1969) The isolation and properties of isochorismic acid, an intermediate in the biosynthesis of 2,3-dihydroxybenzoic acid. Biochim Biophys Acta 177: 389-400 [Medline]

Young IG, Gibson F (1969) Regulation of the enzymes involved in the biosynthesis of 2,3-dihydroxybenzoic acid in Aerobacter aerogenes and Escherichia coli. Biochim Biophys Acta 177: 401-411 [Medline]

Copyright Clearance Center:   0032-0889/99/119//08
 
© 1999 American Society of Plant Physiologists



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
M. A. Strawn, S. K. Marr, K. Inoue, N. Inada, C. Zubieta, and M. C. Wildermuth
Arabidopsis Isochorismate Synthase Functional in Pathogen-induced Salicylate Biosynthesis Exhibits Properties Consistent with a Role in Diverse Stress Responses
J. Biol. Chem., February 23, 2007; 282(8): 5919 - 5933.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Gaille, P. Kast, and D. Haas
Salicylate Biosynthesis in Pseudomonas aeruginosa. PURIFICATION AND CHARACTERIZATION OF PchB, A NOVEL BIFUNCTIONAL ENZYME DISPLAYING ISOCHORISMATE PYRUVATE-LYASE AND CHORISMATE MUTASE ACTIVITIES
J. Biol. Chem., June 7, 2002; 277(24): 21768 - 21775.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Tegelen, L. J.P.
Right arrow Articles by Wullems, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Tegelen, L. J.P.
Right arrow Articles by Wullems, G. J.
Agricola
Right arrow Articles by van Tegelen, L. J.P.
Right arrow Articles by Wullems, G. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY THE PLANT CELL
Copyright © 1999 by the American Society of Plant Biologists