|
Plant Physiol. (1999) 119: 849-858
The Involvement of Hydrogen Peroxide in the Differentiation of
Secondary Walls in Cotton Fibers1
Tamara S. Potikha,
Cheryl C. Collins,
Douglas I. Johnson,
Deborah
P. Delmer, and
Alex Levine*
Department of Plant Sciences, Hebrew University of Jerusalem,
Jerusalem, Givat-Ram 91904, Israel (T.S.P., A.L.); Department of
Microbiology and Molecular Genetics, University of Vermont, 202 Stafford Hall, Burlington, Vermont 05405 (C.C.C., D.I.J.); and Section
of Plant Biology, University of California, One Shields Avenue, Davis,
California 95616-8537 (D.P.D.)
 |
ABSTRACT |
H2O2 is a
widespread molecule in many biological systems. It is created
enzymatically in living cells during various oxidation reactions and by
leakage of electrons from the electron transport chains. Depending on
the concentration H2O2 can induce cell
protective responses, programmed cell death, or necrosis. Here we
provide evidence that H2O2 may function as a
developmental signal in the differentiation of secondary walls in
cotton (Gossypium hirsutum) fibers. Three lines of
evidence support this conclusion: (a) the period of
H2O2 generation coincided with the onset of
secondary wall deposition, (b) inhibition of
H2O2 production or scavenging the available
H2O2 from the system prevented the wall
differentiation process, and (c) exogenous addition of
H2O2 prematurely promoted secondary wall
formation in young fibers. Furthermore, we provide support for the
concept that H2O2 generation could be mediated by the expression of the small GTPase Rac, the accumulation of which
was shown previously to be strongly induced during the onset of
secondary wall differentiation. In support of Rac's role in the
activation of NADPH oxidase and the generation of reactive oxygen
species, we transformed soybean (Glycine max) and
Arabidopsis cells with mutated Rac genes. Transformation with a
dominantly activated cotton Rac13 gene resulted in
constitutively higher levels of H2O2, whereas
transformation with the antisense and especially with dominant-negative
Rac constructs decreased the levels of H2O2.
 |
INTRODUCTION |
The signals that control the developmental switch from primary to
secondary wall synthesis in higher plants are not known. This
transition is characterized by a cessation of synthesis of polymers
unique to the primary cell wall accompanied by enhanced rates of
cellulose deposition and induction of synthesis of specific secondary
wall matrix polysaccharides and lignin. The developing fibers of cotton
(Gossypium hirsutum) and tracheary elements
differentiated from isolated mesophyll cells of zinnia have emerged as
two good model systems for studying this transition. In the zinnia
system the mesophyll cells are cultured in noninductive medium and
differentiation is induced by changes in hormonal balance. Specialized,
localized regions of secondary wall formation unique to these tracheary elements have been shown to contain large amounts of cellulose, xylan,
and lignin (for reviews, see Fukuda, 1991 , 1996 ). The developing cotton
fiber is unique in that the secondary wall consists of nearly pure
cellulose and is devoid of hemicellulose and lignin (for reviews of
cotton fiber development, see Basra and Malik, 1984 ; Ryser, 1985 ).
Furthermore, development occurs synchronously for nearly all fibers
within a boll, with the transition to secondary wall formation
beginning abruptly in varieties of cotton at about 14 to 16 DPA, which
is a few days prior to the cessation of fiber elongation (Meinert and
Delmer, 1977 ).
Rates of secondary wall cellulose synthesis peak at
about 24 DPA; the fibers mature and die sometime after 40 DPA,
presumably by a process of programmed cell death. During the transition
the rate of cellulose synthesis increases abruptly to about 100-fold (Meinert and Delmer, 1977 ), and recent evidence indicates that genes
that most likely encode the catalytic subunit of cellulose synthase are
also strongly induced at this time (Pear et al., 1996 ). During
xylogenesis there is also evidence that expression of genes involved in
synthesis of hemicellulose (Bolwell and Northcote, 1981 ) and lignin
(Fukuda, 1991 ) also undergo induction. The transition in both cotton
fibers and tracheary elements is also characterized by a reorganization
of the cytoskeleton that directs the specific patterns of cellulose
deposition (Seagull, 1990 ; Fukuda, 1991 , 1996 ).
Our interest in the events regulating this transition was stimulated by
our recent characterization of genes that encode two small GTPases of
the Rho subfamily in cotton, named Rac13 and Rac9. Rac13 in particular
shows highly induced expression at the transition from primary to
secondary wall synthesis (Delmer et al., 1995 ). In animals Rac proteins
function in several possibly related signal transduction pathways. Rac
has been shown to be involved in regulation of reorganization of the
actin cytoskeleton (Symons, 1996 ) and it plays another role in
leukocytes as a specific activator of the plasma membrane NADPH oxidase
(Freeman et al., 1996 ). Activation of the NADPH oxidase leads to
generation of the oxidative burst, which serves as a defense against
pathogen invasion (Abo et al., 1994 ; Diekmann et al., 1994 ). This
enzyme is the major superoxide-producing enzyme in these cells (Segal and Abo, 1993 ).
In higher plants ROS can probably be generated by several alternative
pathways (Allan and Fluhr, 1997 ; Bestwick et al., 1997 ). Such pathways
include the possibility of a cell-wall-localized peroxidase (Bolwell et
al., 1995 ), amine oxidases (Allan and Fluhr, 1997 ), non-flavin NADPH
oxidases (Van Gestelen et al., 1997 ), or NADPH oxidases that resemble
the flavin-containing type that is activated by Rac in leukocytes (Xing
et al., 1997 ). A plant homolog of the leukocyte NADPH oxidase has been
identified through analysis of rice and Arabidopsis expressed sequence
tags (Groom et al., 1996 ; Keller et al., 1998 ). The activity of this
enzyme has been implicated in plant responses to UV light and in
pathogen-induced oxidative stress in soybean (Glycine max;
Tenhaken et al., 1995 ; Rao et al., 1996 ). The amino acid sequence of
the Arabidopsis homolog of the human NADPH oxidase has an additional
calcium-binding domain, suggesting a possible role for calcium influx
in ROS production (Jabs et al., 1997 ; Keller et al., 1998 ). In a recent
report, Xing et al. (1997) have shown that a tomato or a tobacco Rac, along with soluble NADPH oxidase subunits, becomes translocated to the
plasma membrane in response to elicitor treatment, suggesting a second
function for Rac analogous to that observed in leukocytes (Diekmann et
al., 1994 ; Freeman et al., 1996 ). The involvement of calcium is also
intriguing in view of its role in callose and cellulose deposition
(Maltby et al., 1979 ; Hayashi et al., 1987 ).
Production of .O2,
H2O2, or other ROS over an
extended time creates an oxidative stress within the cell, eventually
reaching the threshold that triggers the programmed cell death
response. This is true for animal as well as plant cell systems (Levine et al., 1994 ; Korsmeyer et al., 1995 ; Jabs et al., 1996 ). The precise
mechanism of the signal transduction, from the generation of ROS to
cell death, is not fully elucidated, but the downstream events involve
calcium influx and activation of specific proteases and kinases (Levine
et al., 1996 ). In plants prolonged periods of ROS generation that
result in oxidative stress have been reported during abiotic stress,
such as chilling (Prasad, 1996 ), ozone (Schraudner et al., 1997 ), or UV
exposure (Hideg and Vass, 1996 ), and following an attack by avirulent
pathogens (Baker et al., 1991 ; Levine et al., 1994 ). In all of these
cases programmed cell death follows.
In this report we have explored the question of whether an oxidative
burst coincides with high expression of the Rac genes in cotton and
whether the generated H2O2
affects secondary wall differentiation. We present evidence that the
production of H2O2 coincides with the onset of both Rac gene expression and secondary wall
synthesis in cotton fibers. Our results suggest that at a low dosage
the produced H2O2 functions
as a developmental signal for the onset of secondary wall
differentiation. We also show that constitutive expression of the
dominantly activated form of the cotton Rac13 gene induced
the production of ROS in cultured soybean and Arabidopsis cells,
whereas reducing the expression of Rac mRNA by transformation with
antisense mRNA or with the dominant-negative form of cotton Rac had the
opposite effect. These data support a role for Rac in the signaling
pathway of H2O2 production.
 |
MATERIALS AND METHODS |
Chemicals
Tempo, 4-hydroxy-tempo, DPI, SHAM, and Evans blue were from Sigma.
DCFDA and dihydrorhodamine-123 were from Molecular Probes (Eugene, OR),
and pyranine was from Eastman Kodak.
Plant Material and H2O2 Measurements
Cotton (Gossypium hirsutum var Acala SJ-2) was used for
both field and cultured fiber experiments. For some of the experiments with cultured ovules, similar results were also obtained using var
Coker 130. Cotton was grown in irrigated fields in Israel in the summer
of 1996 or 1997. Flowers were marked at anthesis and at indicated times
the bolls were removed and immediately assayed for
H2O2. Locules were excised
from the bolls with a scalpel and detached fibers (without seeds) were
used for total H2O2
determination by a method based on titanium oxidation (Snell and Snell,
1949 ). H2O2 concentration
was determined by a standard graph from 5 µM to
1 mM
H2O2 constructed by direct
addition of H2O2 to the
titanium solution. H2O2
generation was also measured in whole locules that were washed with
sterile water to remove possible ROS released by cutting and incubated
in 0.5 mg/mL 2,7-DCFDA. ROS-dependent conversion of DCFDA to
2 ,7 -dichlorofluorescein was measured for 60 min in a fluorometer
(model FL500, BioTek Instruments, Winooski, VT) with
excitation/emission wavelengths set to 485/525, respectively. Selected
locules were incubated in the presence of 2.5 mg/mL thymol-free
catalase (Sigma). For microscopic examination fibers (still attached to
the locules) were stained with 0.005% dihydrorhodamine-123 or pyranine
(Apostol et al., 1989 ) for 5 min and observed as described below.
Fertilized ovules of cotton cv Coker 130 were cultured in 12-well
plates in vitro, as described by Meinert and Delmer (1977) . Compounds
were added to medium at indicated concentrations dissolved in DMSO. The
final concentration of DMSO was 0.1% in all of the samples.
Microscopy
Fluorescence microscopy was performed with an inverted microscope
(model IX-70, Olympus). Fluorescence of dihydrorhodamine-123 was
observed with a filter set (excitation = 485/22 and emission = 535/35,
respectively; model X-23, Omega, Brattleboro, VT). To enable the
comparison of differences in signal intensity, photographs were taken
using identical exposure conditions (in manual setup) for all samples.
Experiments were repeated at least four times with similar results. The
selected pictures are parts of a microscope field, which is
representative of the entire field. Photographs were taken with Pan 100 black and white (Ilford, Paramus, NJ) or Kodak Gold film. Birefringence
was monitored using an inverted microscope (Zeiss Axiophot) equipped
with a polarization reflector at the light source and a crossed
polarizer and analyzer, as described by Potikha and Delmer (1995) .
Birefringence was verified in all cases by confirmation that patterns
reversed when samples were rotated by 90o.
For determination of cellulose content, cultured fibers, with
their associated ovules, were washed free of medium, frozen, and
lyophilized and the dry weight was determined from the isolated fibers.
Whole fibers were then subjected to digestion by acetic-nitric reagent
and the residual crystalline cellulose not digested was quantified by
use of the anthrone reagent, as described by Updegraff (1969) .
Rac Constructs
Site-directed mutagenesis was performed with the Mutagen kit
(Bio-Rad). The starting templates were uracil containing
single-stranded DNA isolated from Escherichia coli CJ236
cells containing pBluescript SK (Rac13). The nucleotide sequence of
the G15V mutagenic primer was GGTCGGTGATCTAGCTGTGG
(underlined T is G in the wild-type sequence). The nucleotide sequence
of the T20N mutagenic primer was GCTGTGGGGAAAAATTGTATGCTC (underlined A is C in the wild-type sequence). For both mutant genes,
the presence of the desired mutations was confirmed by sequencing the
entire coding region of the gene using automated dideoxy sequencing
(Vermont Cancer Center DNA Sequencing Facility, Burlington, VT). The
mutated Rac constructs were excised from the pBluescript vector with
EcoRV plus SmaI and recloned into a blunted
NotI site of pBluescript SK. Orientation of the inserted genes was tested by digestion with BamHI, which cleaves 0.3 kb from the 5 end. Constructs with correct gene orientation (for sense
or antisense) were digested with SacI plus XbaI
and ligated into the XbaI/SacI sites of the
binary vector EL103 (provided by Dr. Eric Lam, Rutgers University-Cook
College, New Brunswick, NJ). After the correct insertion in E. coli XL-1-Blue was verified, the final plasmids were transformed
into Agrobacterium tumefaciens strain EHA105.
Transient Expression of Rac in Suspension-Cultured Cells
Soybeans (Glycine max cv Williams 82) were grown as
described previously (Levine et al., 1994 ). Arabidopsis (cv Columbia) were obtained from Dr. Doerner (Salk Institute, La Jolla, CA) and were
cultured in medium supplemented with Murashige and Skoog vitamins, 3%
Suc, and 0.5 µg/L 2,4-D. Both cultures were diluted 1:6 once a week,
and all experiments were performed 2 d after transfer. Soybean and
Arabidopsis transformations were done by coinoculation of 3 × 108 cells of A. tumefaciens strain
EHA105, carrying the appropriate plasmids per milliliter of plant
suspension culture, and incubated in 24-well plates for 50 h.
Cells were extensively washed over Miracloth (Calbiochem) and
resuspended in the original volume of fresh medium that contained 300 mg/L claforan antibiotic to suppress bacterial growth. GUS activity was
assayed by staining the cells with
5-bromo-4-chloro-3-indoyl- -D-glucuronic acid
and microscopic examination of the blue cells.
H2O2 was assayed over a
period of 3 d with DCFDA, as described for the cotton locules.
 |
RESULTS |
Generation of ROS in Differentiating Cotton Fibers
To study the possible relationships between the induction of Rac
accumulation, the generation of ROS, and differentiation of secondary
walls, we tagged field-grown flowers of cotton var Acala SJ-2 at
anthesis and collected cotton bolls from variously aged plants that
spanned the time of primary wall synthesis, the transition, and the
later times when secondary wall synthesis was highly active. The
concentration of H2O2 was
assessed in fibers quantitatively and qualitatively immediately
following the opening of bolls with a scalpel. For the quantitative
measurements of H2O2,
locules from bolls of different aged plants were excised and detached
fibers were placed in titanium sulfate, according to the method of
Snell and Snell (1949; Fig. 1A). The
levels of ROS in young cotton bolls were very low but increased
strongly at 16 to 20 DPA, a time that coincides with the peak time of
increased Rac expression (see figure 4 in Delmer et al., 1995 ).
H2O2 accumulation corresponded to the time of secondary wall biosynthesis and declined afterward. It is probable that the decline was caused by elevated levels of ROS, which induced antioxidant enzymes, although this was not
tested.

View larger version (17K):
[in this window]
[in a new window]
| Figure 1.
Measurements of H2O2
levels during development of field-grown cotton fibers. Flowers of
field-grown cotton were tagged at anthesis and bolls were collected at
the indicated times postanthesis. A, H2O2 was
determined in detached fibers according to the method of Snell and
Snell (1949) . B, H2O2 production was followed
in whole locules by incubating them in DCFDA for 60 min.
2 ,7 -Dichlorofluorescein, the H2O2-dependent
oxidation product, was measured at indicated times at 485-nm excitation
and 525-nm emission wavelengths. Catalase (x) was added to the 19-DPA
sample. 9 DPA ( ), 19 DPA ( ), and 26 DPA ( ). d.w., Dry
weight.
|
|
We also measured the rate of
H2O2 production in whole
locules by a more-sensitive, cell-permeable fluorescent dye, DCFDA
(Fig. 1B; Ubezio and Civoli, 1994 ; Trayner et al., 1995 ; Allan and
Fluhr, 1997 ). Oxidation of this dye by
O2 or by
H2O2 catalyzed by
peroxidase produces a fluorescent and cell-permeable product,
2 ,7 -dichlorofluorescein, that can be detected in the medium (Ubezio
and Civoli, 1994 ). The amount of fluorescence accumulation in the
incubation medium can therefore serve as a measure of ROS production in
the boll. This was verified by addition of catalase to the medium,
which almost completely inhibited the fluorescence accumulation. The
inhibition of DCFDA oxidation by catalase implicates the
H2O2 as the ROS present in the locule. Locules were washed to remove possible peroxides released by the cutting and placed in a culture dish in the presence of the
DCFDA. The increase in fluorescence during the 60 min of the incubation
corresponded to the measurements of total
H2O2, as determined by
titanium oxidation (Fig. 1A). Since the oxidation of DCFDA is catalyzed
by endogenous peroxidases, it is possible that insufficient
concentration of the enzyme affected the
H2O2 estimation. We checked
that the amount of peroxidase in young bolls was not limiting by
parallel measurements in the presence of horseradish peroxidase and
obtained similar results (data not shown).
We also followed the production of
H2O2 during fiber
development in a qualitative way by direct microscopic observation of differentiating cotton fibers using another chemically unrelated fluorescent dye, dihydrorhodamine-123. This dye penetrates the cells in
its reduced (and nonfluorescent) form but becomes trapped inside
following oxidation by H2O2
(Royall and Ischiropoulos, 1993 ). To observe the redox state of
individual fiber cells, locules were incubated in the dye solution for
5 min and parts of the locule were placed under the microscope, with
the fibers still fully attached to the ovule. Consistent with the
results shown in Figure 1, increased dye oxidation was detected in
fibers during the period of secondary wall differentiation (Fig.
2). Dihydrorhodamine fluorescence was
observed both in localized regions within the fiber and as a uniform
layer localized to the cell surface (Fig. 2, b and c). The increase in
fluorescence with age occurred in both areas but was especially
pronounced at the cell surface. The
H2O2 production that was
uniformly distributed at the cell surface was first seen in fibers 15 to 18 DPA (Fig. 2b) and increased further after 20 DPA (Fig. 2c). This
onset of H2O2 production coincides with the onset of Rac13 gene expression (Delmer et al., 1995 ), as well as the onset of deposition of the highly ordered secondary wall microfibrils of cellulose (Meinert and Delmer, 1977 ).

View larger version (58K):
[in this window]
[in a new window]
| Figure 2.
Microscopic observation of
H2O2 generation during development of
field-grown cotton fibers. Bolls were opened and placed in a solution
of dihydrorhodamine-123, as described in ``Materials and Methods''.
Fibers that were still attached to ovules were analyzed by fluorescence
microscopy. a, Primary walls (10 DPA); b, transition period (15 DPA);
c, massive secondary wall synthesis (20 DPA); and d, mature fibers (26 DPA).
|
|
To exclude the possibility that the observed fluorescence was due to
the formation of autofluorescent compounds during wall differentiation
and to further validate the results of
H2O2 generation, the fibers
were treated with either water or pyranine and observed with the
microscope. No fluorescence was seen in the water-treated samples,
indicating lack of autofluorescence and confirming that the fluorescent
signal shown in Figures 1 and 2 originated from the dye (data not
shown). This observation is consistent with the absence of
lignification in fibers, a process that is associated with production
of autofluorescent compounds in many plant species. The staining of
fibers with pyranine, a fluorescent dye that emits light in its reduced
form but becomes bleached after reaction with
H2O2 and peroxidase,
resulting in a nonfluorescent compound (Apostol et al., 1989 ), produced
a pattern of fluorescence that was opposite to that observed with
dihydrorhodamine-123, i.e. no fluorescence was seen within the fibers,
on a fluorescent background of pyranine in the surrounding medium.
Also, the intensity decreased as a function of fiber age, consistent
with the measurements in Figure 1 (data not shown). These controls,
together with the measurements in the presence of catalase, further
support the validity of the results with the dihydrorhodamine-123 and
DCFDA dyes for estimating H2O2.
H2O2 as a Signal for Differentiation of the
Secondary Wall
To test whether the observed
H2O2 generation had a
signaling function in the process of secondary wall generation, we
carried out experiments to (a) block the generation of
H2O2, (b) scavenge generated H2O2 from the
system, or (c) test the effect of premature addition of
H2O2 to the system. Since
it is technically difficult to introduce these compounds into fiber
cells of field-grown cotton, we used a system with which fibers are
cultured with their associated ovules (Beasley, 1992 ), conditions that
Meinert and Delmer (1977) have shown allow fiber development that
closely mimics that which occurs in planta. Compounds dissolved in DMSO
(with same level of DMSO in controls) could then be directly added to
the culture solution. The effects on secondary wall synthesis were
assessed by the birefringence of fibers using polarized light
microscopy (Fig. 3) and also by direct
quantitative analysis of cellulose content (Fig.
4A).

View larger version (81K):
[in this window]
[in a new window]
| Figure 3.
Birefringence of cultured cotton fibers following
either addition of exogenous H2O2 or inhibition
of H2O2 generation by DPI. Cotton fibers were
cultured with their associated fertilized ovules in 24-well plates at
30°C. a and b, Controls 15 DPA (a) or 16 DPA (b) to which only 0.1%
DMSO was added 12 DPA. c and d, Fibers 15 DPA (c) or 16 DPA (d) to
which 50 µM H2O2 was added once
daily 13 and 14 DPA. e and f, Fibers 15 DPA (e) or 16 DPA (f) that had
been cultured in 1 µM DPI/0.1% DMSO since 12 DPA. a, c,
e, and f were viewed at ×250 magnification, whereas b and d were at
×100.
|
|

View larger version (55K):
[in this window]
[in a new window]
| Figure 4.
The effects of
H2O2-regulating compounds on cellulose content
and the amount of H2O2 in cultured fibers. A,
Total cellulose content was measured 16 DPA after the following
compounds were added 12 DPA: Control (no additions) 1 µM
DPI, 0.5 mM Tempo, 1 mM 4-hydroxy-tempo, 5 mM SHAM, and 50 µM
H2O2. The control value was 282 ± 6 µg
cellulose/mg dry weight of fibers. The SD of samples was
<7%. B, Dihydrorhodamine-123 staining of 15-DPA cotton fibers
cultured from 12 DPA in the presence of 0.1% DMSO as control (a), 1 mM 4-hydroxy-tempo (4H-TEMPO; b), 0.5 mM Tempo
(c), 1 µM DPI (d), and 5 mM SHAM (e).
|
|
With ovules/fibers cultured at 30°C, we observed, 15 DPA, the first
faint signs of birefringence of fibers when viewed under polarized
light, which is characteristic of the onset of secondary wall
deposition (Fig. 3a). After 1 additional d, many more of the control
fibers were clearly birefringent, indicating the beginning of the
abrupt transition to secondary wall synthesis. Cellulose content
increased from a level of about 170 to 280 µg/mg dry weight of fibers
over this 1-d period.
DPI is known to be a potent inhibitor of the leukocyte NADPH oxidase
and other flavin-containing oxidases and has been used extensively to
inhibit production of ROS in both animal and plant systems (O'Donnell
et al., 1993 ; Dwyer et al., 1996 ; Murphy and Auh, 1996 ; Jabs et al.,
1997 ; Mithoefer et al., 1997 ). We found that addition of 1 µM DPI to the cultured fiber system 12 DPA substantially
blocked the subsequent development of birefringence (Fig. 3, e and f).
In addition, the level of cellulose in the fibers, when expressed as a
percentage of the control value at 16 DPA (control value = 282 ± 6 µg/mg dry weight of fibers), was much lower, further confirming
that the DPI inhibited the onset of secondary wall deposition.
An alternative way to decrease the concentration of
H2O2 is to scavenge the
generated ROS by addition of synthetic scavengers. In a similar
experimental design, we used the ROS scavenger 4-hydroxy-tempo (Weiss
et al., 1993 ; Charloux et al., 1995 ). The addition of 1 mM
of this antioxidant showed a similar effect on inhibition of cellulose
deposition but was somewhat less effective than DPI (Fig. 4A). We also
tested the nonhydroxylated analog of the scavenger, Tempo, which
produced a similar although weaker effect (Fig. 4A).
As predicted, the presence of DPI or scavengers strongly reduced the
production or accumulation of
H2O2, respectively, when judged qualitatively by fluorescence microscopy using the technique described above (Fig. 4B). These data support the suggestion that the
developmentally generated
H2O2 was produced
enzymatically (most probably by NADPH oxidase or a related oxidase) and
was not a result of electron leakage caused by membrane damage. None of
these compounds appeared to exert overall toxicity, because the fibers
remained viable as judged by their appearance and ability to exclude
Evans blue dye. Also noteworthy is that the inhibitory activity of the
scavenger and the inhibitor molecules on the birefringence was
reversible, since removal of the inhibitor/scavengers from the culture
medium led to the appearance of birefringence at a later stage (data
not shown).
These results suggest that
H2O2 may serve as a signal
for the onset of secondary wall deposition. The DPI inhibitor results also implicate the NADPH oxidase (or a similar enzyme) in the generation of the H2O2. If
this is so, then we predicted that bypassing the oxidase by direct
addition of H2O2 to younger
fibers might cause a premature initiation of secondary wall deposition. When 50 µM
H2O2 was added once a day
to the culture solution on d 13 and 14, by 15 DPA appearance of
birefringence much stronger than in the controls was observed (compare
Fig. 3, a and b, with 3, c and d). This enhancement of the timing of
onset of deposition was further reflected in the increased level of
cellulose measured in the fibers 16 DPA (Fig. 4A). We also observed
enhanced levels of cellulose 16 DPA (Fig. 4A) by addition on 12 DPA of
5 mM SHAM, a compound known to elevate
H2O2 levels (Pantoja and
Willmer, 1988 ).
Ectopic Expression of Rac13 Induces the Production of
H2O2
A natural question that arises from the above experiments is what
causes the elevated levels of
H2O2 in cotton fibers. The effective inhibition of the
H2O2 generation in ovule
cultures by DPI (Figs. 3 and 4) supports the possible involvement of
NADPH oxidase in the generation of ROS, an enzyme that in leukocytes is
activated by Rac. Our finding that cotton Rac13 expression (Delmer et
al., 1995 ) coincides with the onset of oxidative stress and formation
of secondary wall led us to probe the role of cotton Rac in the
production of ROS in plants. Because the activity of small GTPases,
such as the human Rac1 and the cotton Rac13, depends on the type of the
bound nucleotide, GTP or GDP, the regulation of Racs can be achieved by
modifying the rate of GTP hydrolysis.
We took advantage of knowledge gained from the studies of mutant animal
Racs, regarding the critical amino acids that govern the GTP
hydrolysis, to perform site-directed mutagenesis on the cotton
Rac13 cDNA to create constructs that encode constitutively active
("dominant-activated") or constitutively negative
("dominant-negative") forms of Rac. Cotton Rac13
possesses the conserved sequences at and surrounding Gly-15 and Thr-20
that are analogous to Gly-12 and Thr-17 found in animal Racs. When the
cDNAs are mutated so that Gly is converted to Val (termed V15-Rac13), a
dominant-activated mutation results, whereas conversion of the Ser
residue to Asn (termed N20-Rac13) results in a dominant-negative
phenotype (Ridley et al., 1992 ). These, as well as an anti-sense
construct of the dominant-activated Rac13, were cloned into a binary
plant vector under the control of constitutively expressed 35S
cauliflower mosaic virus promoter to introduce the mutated genes into
plant cells via A. tumefaciens-mediated transformation.
Since such experiments would be technically very complex, if not
impossible, to carry out with cotton fibers, we chose to use cultured
cells for these studies. Two types of suspension-cultured cells were
selected: soybean cv Williams 82 and Arabidopsis var Columbia. Both
systems are well characterized with respect to oxidative burst and
yield a high percentage of cells that transiently express the
transgenes. The use of heterologous systems also avoids possible
cosuppression effects that may interfere with the results. As a
control, the soybean and Arabidopsis cells were transformed with an
identical vector carrying the bacterial GUS gene driven by the same 35S promoter. The efficiency of transgene expression was estimated by
staining a sample of the GUS-transformed cells for GUS activity 48 h after coinoculation, after removing the majority of A. tumefaciens from the medium. As shown in Figure
5C, the procedure yielded more than 65%
of transformed soybean and more than 75% of Arabidopsis cells. The
high efficiency enabled us to analyze the possible function of the
introduced genes. The influence of the introduced Rac constructs on the
redox status of the cultures was determined 16 h after removal of
the agrobacteria by measuring the conversion of DCFDA to
2 ,7 -dichlorofluorescein in the transformed cells. Results of the
fluorescence measurements clearly showed that the dominant-activated
form of Rac induced higher levels of
H2O2 in both soybean and
Arabidopsis cells. Conversely, expression of the dominant-negative Rac
construct or inhibition of expression of the endogenous Rac by
expression of the antisense construct reduced the constitutive ROS
production by the soybean and Arabidopsis cells. The influence of the
transiently expressed genes was sustained for at least 3 d after
removal of agrobacteria because similar results were obtained on the
consecutive days. Taken together, these results support the regulatory
role of the Rac gene in the regulation of
H2O2 levels in plant cells.
Because of the transient nature of the gene expression and also because
cultured cells do not usually undergo secondary wall differentiation,
we have not examined any effects of Rac on cellulose synthesis in this system.

View larger version (79K):
[in this window]
[in a new window]
| Figure 5.
The effects of transient Rac expression on
H2O2 production in soybean and Arabidopsis
cells. Soybean (A) and Arabidopsis (B) cells were transformed with
A. tumefaciens carrying the specific Rac constructs
cloned into a binary vector. H2O2 generation
was measured with the DCFDA dye, added directly to the medium of
cultured cells, for 10 min as described in the Figure 1 legend.
Fluorescence emitted from cells transformed in parallel with the
GUS gene served as the control. C, Representative field
of GUS-transformed (control) cells stained with
5-bromo-4-chloro-3-indoyl- -D-glucuronic acid.
soy, Soybean.
|
|
 |
DISCUSSION |
Taken together, our results allow us to propose a partial sequence
of events that lead to differentiation of cotton fibers. At present,
unknown developmental signal(s) induce both the expression and
activation of Rac, which in turn activates an oxidase that leads to a
sustained generation of
H2O2. The constant
production of low levels of
H2O2 stimulated the onset
of secondary wall cellulose biosynthesis and secondary wall
differentiation (perhaps by inducing expression of CelA and
other necessary genes). The continuously elevated level of
H2O2 would result in the
accumulation of
H2O2-dependent reaction
products, many of which are destructive to vital cellular components,
such as membranes, proteins, and nucleic acids. Eventually, after
reaching a certain threshold, this could trigger the activation of a
cell-death process, which for the cotton fiber cells constitutes a form
of terminal differentiation.
The concept that H2O2 might
serve as a signal for the initiation of such a developmental sequence
is novel, but it has a striking parallel to recent results by Altamura
et al. (1998) , who have shown in tobacco leaf explants that
oligogalacturonides stimulate pericycle cell wall thickening due to
stimulation of cellulose deposition. Since such oligogalacturonides
have also been shown to elicit production of
H2O2 (Legendre et al.,
1993 ; Svalheim and Robertsen, 1993 ), the same signaling pathways
may be involved in the tobacco system and the cotton fibers studied by
us. ROS, in general, and
H2O2, in particular, have
been previously implicated as second messengers in the regulation of
the plant hypersensitive response (Mehdy, 1994 ; Low and Merida, 1996 ).
The results presented here are novel in that they indicate that
H2O2 may also serve as a
signal for a major developmental process in plants: the differentiation of secondary walls. The following results support this conclusion: (a)
H2O2 generation coincides
with secondary wall deposition, (b) inhibition of either
H2O2 production or
scavenging it from the system prevented the differentiation process,
and (c) exogenous addition of
H2O2 to young fibers
prematurely promoted secondary wall formation. To our knowledge,
H2O2 is not required for
any direct metabolic process that is associated with cellulose
biosynthesis and secondary wall formation in nonlignified walls.
Therefore, the latter two results support the hypothesis that the
production of H2O2 is not
just correlated with the process but may actually serve as a regulatory
molecule in the process of cellulose biosynthesis. Moreover, the
effective blocking of H2O2
production through the inhibition of an endogenous cotton oxidase by
DPI argues that the generation of the oxidative stress is a programmed
event, regulated by developmental cues, and was not a result of
electron leakage because of nonspecific membrane damage. Since cotton
fibers do not produce lignin during the formation of secondary walls, one cannot argue that the production of
H2O2 is related to this process. This may also explain why others studying secondary wall development in lignifying systems would not have thought to consider a
signaling role for H2O2
production in addition to its potential role in lignin synthesis.
DPI is a known inhibitor of NADPH oxidases (O'Donnell et al., 1993 )
but it can also inhibit other flavohemoproteins. Thus, one cannot be
certain that the generation of ROS observed here is initiated by an
enzyme analogous to the leukocyte NADPH oxidase, although our
experiments with the mutant Rac genes and previous studies of patterns
of Rac gene expression (Delmer et al., 1995 ) and other studies relating
Rac to elicitor-induced oxidative bursts in plants (Kieffer et al.,
1997 ; Xing et al., 1997 ) do argue for such an involvement. We have yet
to explore whether the theoretically proposed initial product of this
enzyme, superoxide, is produced and directly converted to
H2O2 in fibers, either
spontaneously or by the action of superoxide dismutase.
It is also noteworthy that in intact bean plants
H2O2-dependent oxidative
protein cross-linking occurs during the later stages of hypocotyl
growth (Bradley et al., 1992 ; Schopfer, 1994 ). The cross-linking of the
bean cell wall proteins does not occur in the young cells despite the
presence of peroxidase and the specific cell wall proteins (Bradley et
al., 1992 ); it happens only later, when H2O2 is
being produced (Schopfer, 1994 ). The role of
H2O2 in development,
particularly with respect to developmental changes in arabinogalactan
proteins and Hyp-rich glycoproteins at the plant cell surface, was
recently discussed by Knox (1995) . These results further support the
notion that H2O2 generation
in plants is developmentally regulated. Some interesting parallels
exist between the
H2O2-driven events that
occur during the transition from primary to secondary wall
synthesis and those that occur following oxidative burst during the
pathogenesis response. For example, there is an influx of
Ca2+ into the cytoplasm and induction of
transient callose deposition (shown for cotton fibers by Maltby et al.
[1979] and described in pathogenesis by Bestwick et al. [1995] and
in lignification [common to many secondary cell walls but not cotton
fibers] by Fukuda [1991]). Furthermore, one might expect that
cross-linking of cell wall polymers via the action of
H2O2 and wall-associated peroxidases that also characterizes the hypersensitive response (Bradley et al., 1992 ; Iiyama et al., 1994 ) occurs at the cessation of
cell expansion and at the onset of secondary wall formation.
In the developmentally induced cell wall differentiation, we observed a
continuous production of
H2O2, which appears to be necessary to sustain the signaling process, since the process could be
halted by the addition of DPI or 4-hydroxy-tempo. Such a continually
elevated concentration of
H2O2 within the cell is likely to produce an accumulation of damage to vital cellular components and therefore may result in the activation of programmed cell death. H2O2 was indeed
shown to act as a self-generated programmed cell death trigger during
the plant response to pathogens (Levine et al., 1994 ). The main
differences between the developmentally and the pathogen-induced
oxidative bursts lies in the duration of the burst and in the
concentration of the H2O2.
During the pathogenesis response the oxidative burst lasts about 4 to
6 h and may reach millimolar concentrations (Legendre et al.,
1993 ). The rate of H2O2
production during fiber differentiation is much lower; however, the
duration of the developmentally produced oxidative burst is longer,
lasting several days. For this reason, it may be more appropriate to
call it an oxidative "phase" in development rather than a
"burst." Nevertheless, it is highly probable that programmed cell
death is triggered by the gradual accumulation of
H2O2-dependent oxidation
products in both cases: the short but high dose that induces cell
death, as happens during the hypersensitive response, and the prolonged
but low dose characteristic of the developmentally regulated processes.
In support of programmed cell death induction by a constant low level
of ROS, transient transfection experiments of animal cell cultures with
small GTPases, Rac or Ras, showed a significant increase in the levels
of ROS production and in subsequent cell death (Sundaresan et al.,
1996 ; Irani et al., 1997 ). Our preliminary results showed the same
trend in the suspension-cultured plant cells (data not shown), but the conclusive proof for the role of the developmentally produced H2O2 in the cotton fiber
cell death needs further experimentation.
The terminal differentiation of many cells with thick secondary walls,
such as tracheary elements, sclereids, and presumably also cotton
fibers, culminates in autolysis, which can be considered programmed
cell death (Fukuda, 1996 ; Groover et al., 1997 ). Consistent with the
role of H2O2 in secondary
wall synthesis in other plants and different cell types, we observed
H2O2 generation during
secondary wall formation in trichomes of young Arabidopsis leaves and
developing tracheary elements in cultured mesophyll cells of
zinnia, although a detailed time course of production has not yet been
determined (data not shown). Schopfer (1994) has detected
developmentally regulated distribution of
H2O2 in bean hypocotyls,
which was most pronounced in differentiating xylem cells. Groover et
al. (1997) , working with the tracheary element differentiation system
in zinnia, did not detect an oxidative burst during the wall
differentiation and the programmed cell death processes, although they
did find a small but constant increase in
H2O2 during this period.
However, this production was not correlated with conditions that induce tracheary element differentiation. Whether this is due to true differences between the zinnia and cotton systems is not clear. It
should be noted that the two systems differ in the type of secondary
walls with respect to lignification. Moreover, the addition of
H2O2 to zinnia cultures
induced a necrotic type of death response, thus arguing against a role
for H2O2 in signaling for a
programmed process of cell death. However, the doses of
H2O2 used in the zinnia studies were in the
range of 0.25 and 4 mM, whereas for the cotton fiber
differentiation was induced by only 50 µM.
What triggers this regulated oxidative phase of development is not
known. The correlation of the onset of
H2O2 production with the
onset of expression of the Rac genes in cotton suggested to us that
changes in the expression levels of the Rac protein (as well as its
activation state) may be the developmentally regulated step that
controls the production of ROS. The role of small GTPases, Rac1 and
Ras, in the induction of ROS generation through the activation of NADPH
oxidase has been shown in animal systems (Sundaresan et al., 1996 ). In
plants, the involvement of Rac in the stimulation of NADPH oxidase was
suggested recently by studies that showed changes in the localization
of Rac upon elicitation (Kieffer et al., 1997 ; Xing et al., 1997 ). Our
own experiments involving the transient manipulation of Rac gene
expression in cultured soybean and Arabidopsis cells further support
the suggestion that this GTPase has a causative role in signaling the
generation of oxidative stress in plant cells.
It is also interesting to note that Meinert and Delmer (1977) observed
a net loss of uronic acid from the fiber wall when fibers enter the
stage of secondary wall synthesis. In view of the study by Legendre et
al. (1993) of the H2O2
activation by polygalacturonic acid oligomers, this offers an appealing
tool for constitutive induction of ROS production during wall
differentiation. Future work will explore the possible epistatic
relationship between generation of pectic fragments and activation of
Rac. In view of the studies by Legendre et al. (1993) and Svalheim and
Robertsen (1993) of the elicitation of
H2O2 production by
oligogalacturonides, as well as the recent work showing their effects
on stimulation of cellulose deposition in pericycle cells of tobacco
(Altamura et al., 1998 ), this offers an attractive mechanism for
induction of ROS production during wall differentiation.
 |
FOOTNOTES |
1
This work was supported by grants from the
U.S.-Israel Binational Agricultural Research and Development Fund and
the Israel Academy of Sciences and by a fellowship to T.S.P. from the
Giladi Foundation.
*
Corresponding author; e-mail alexl{at}leonardo.ls.huji.ac.il; fax
972-2-658-4425.
Received August 27, 1998;
accepted November 23, 1998.
 |
ABBREVIATIONS |
Abbreviations:
DCFDA, dichlorodihydrofluorescein
diacetate.
DPA, days postanthesis.
DPI, diphenyleneiodonium.
ROS, reactive oxygen species.
SHAM, salicylhydroxamic acid.
 |
LITERATURE CITED |
Abo A,
Webb MR,
Grogan A,
Segal AW
(1994)
Activation of NADPH oxidase involves the dissociation of p21-rac from its inhibitory GDP-GTP exchange protein (rhoGDI) followed by its translocation to the plasma membrane.
Biochem J
298:
585-591
Allan AC,
Fluhr R
(1997)
Two distinct sources of elicited reactive oxygen species in tobacco epidermal cells.
Plant Cell
9:
1559-1572
[Abstract]
Altamura MM,
Zaghi D,
Salvi G,
De Lorenzo G,
Bellincampi D
(1998)
Oligogalacturonides stimulate pericycle cell wall thickening and cell divisions leading to stoma formation in tobacco leaf explants.
Planta
204:
429-436
[CrossRef]
Apostol I,
Heinstein PF,
Low PS
(1989)
Rapid stimulation of an oxidative burst during elicitation of cultured plant cells. Role in defense and signal transduction.
Plant Physiol
90:
109-116
[Abstract/Free Full Text]
Baker CJ,
O'Neill NR,
Keppler LD,
Orlandi EW
(1991)
Early responses during plant-bacteria interactions in tobacco cell suspensions.
Phytopathology
81:
1504-1507
[Web of Science]
Basra AS,
Malik CP
(1984)
Development of the cotton fiber.
Int Rev Cytol
89:
65-113
Beasley CA (1992) In vitro cotton ovule culture: a review.
In Cotton Fiber Cellulose: Structure, Function and
Utilization Conference. National Cotton Council, Savannah, GA,
pp 55-90
Bestwick CS,
Bennett MH,
Mansfield JW
(1995)
Hrp mutant of Pseudomonas syringae pv phaseolicola induces cell wall alterations but not membrane damage leading to the hypersensitive reaction in lettuce.
Plant Physiol
108:
503-516
[Abstract]
Bestwick CS,
Brown IR,
Bennett MHR,
Mansfield JW
(1997)
Plant Cell
9:
209-221
[Abstract]
Bolwell GP,
Butt VS,
Davies DR,
Zimmerlin A
(1995)
The origin of the oxidative burst in plants.
Free Radical Res
23:
517-532
[Web of Science][Medline]
Bolwell GP,
Northcote DH
(1981)
Control of hemicellulose and pectin synthesis during differentiation of vascular tissue in bean (Phaseolus vulgaris) callus and in bean hypocotyl.
Planta
152:
225-233
[CrossRef]
Bradley DJ,
Kjellbom P,
Lamb CJ
(1992)
Elicitor- and wound-induced oxidative cross-linking of a proline-rich plant cell wall protein: a novel, rapid defense response.
Cell
70:
21-30
[CrossRef][Web of Science][Medline]
Charloux C,
Paul M,
Loisance D,
Astier A
(1995)
Inhibition of hydroxyl radical production by lactobionate, adenine, and tempol.
Free Radical Biol Med
19:
699-704
[Medline]
Delmer DP,
Pear JR,
Andrawis A,
Stalker DM
(1995)
Genes encoding small GTP-binding proteins analogous to mammalian rac are preferentially expressed in developing cotton fibers.
Mol Gen Genet
248:
43-51
[CrossRef][Web of Science][Medline]
Diekmann D,
Abo A,
Johnston C,
Segal AW,
Hall A
(1994)
Interaction of Rac with p67phox and regulation of phagocytic NADPH oxidase activity.
Science
265:
531-533
[Abstract/Free Full Text]
Dwyer SC,
Legendre L,
Low PS,
Leto TL
(1996)
Plant and human neutrophil oxidative burst complexes contain immunologically related proteins.
Biochim Biophys Acta
1289:
231-237
[Medline]
Freeman JL,
Abo A,
Lambeth JD
(1996)
Rac "insert region" is a novel effector region that is implicated in the activation of NADPH oxidase.
J Biol Chem
271:
19794-19801
[Abstract/Free Full Text]
Fukuda H
(1991)
Tracheary element formation as a model system of cell differentiation.
Int Rev Cytol
136:
289-332
Fukuda H
(1996)
Xylogenesis initiation, progression, and cell death.
Annu Rev Plant Physiol Plant Mol Biol
47:
299-325
[CrossRef][Web of Science]
Groom QJ,
Torres MA,
Fordham-Skelton AP,
Hammond-Kosack KE,
Robinson NJ,
Jones JDG
(1996)
RbohA, a rice homologue of the mammalian gp91phox respiratory burst oxidase gene.
Plant J
10:
515-522
[CrossRef][Web of Science][Medline]
Groover A,
Dewitt N,
Heidel A,
Jones A
(1997)
Programmed cell death of plant tracheary elements differentiating in vitro.
Protoplasma
196:
197-211
[CrossRef]
Hayashi T,
Read SM,
Bussell J,
Thelen M,
Lin FC,
Brown RMJ,
Delmer DP
(1987)
UDPglucose:(1,3)-glucan synthases from mung bean and cotton: differential effects of Ca2+ and Mg2+ on enzyme properties and on macromolecular structure of the glucan product.
Plant Physiol
83:
1054-1062
[Abstract/Free Full Text]
Hideg E,
Vass I
(1996)
UV-B induced free radical production in plant leaves and isolated thylakoid membranes.
Plant Sci
115:
251-260
[CrossRef]
Iiyama K,
Lam TBT,
Stone BA
(1994)
Covalent cross-links in the cell wall.
Plant Physiol
104:
315-320
[Web of Science][Medline]
Irani K,
Xia Y,
Zweier JL,
Sollott SJ,
Der CJ,
Fearon ER,
Sundaresan M,
Finkel T,
Goldschmidt-Clermont PJ
(1997)
Mitogenic signaling mediated by oxidants in Ras-transformed fibroblasts.
Science
275:
1649-1652
[Abstract/Free Full Text]
Jabs T,
Dietrich RA,
Dangl JL
(1996)
Initiation of runaway cell death in an Arabidopsis mutant by extracellular superoxide.
Science
273:
1853-1856
[Abstract/Free Full Text]
Jabs T,
Tschoepe M,
Colling C,
Hahlbrock K,
Scheel D
(1997)
Elicitor-stimulated ion fluxes and O2 from the oxidative burst are essential components in triggering defense gene activation and phytoalexin synthesis in parsley.
Proc Natl Acad Sci USA
94:
4800-4805
[Abstract/Free Full Text]
Keller T,
Damude HG,
Werner D,
Doerner P,
Dixon RA,
Lamb C
(1998)
A plant homolog of the neutrophil NADPH oxidase gp91-phox subunit gene encodes a plasma membrane protein with Ca2+-binding motifs.
Plant Cell
10:
255-266
[Abstract/Free Full Text]
Kieffer F,
Simon-Plas F,
Maume BF,
Blein JP
(1997)
Tobacco cells contain a protein, immunologically related to the neutrophil small G protein Rac2 and involved in elicitor-induced oxidative burst.
FEBS Lett
403:
149-153
[CrossRef][Web of Science][Medline]
Knox JP
(1995)
The extracellular matrix in higher plants. 4. Developmentally regulated proteoglycans and glycoproteins of the plant cell surface.
FASEB J
9:
1004-1012
[Abstract]
Korsmeyer SJ,
Yin XM,
Oltvai ZN,
Veis-Novack DJ,
Linette GP
(1995)
Reactive oxygen species and the regulation of cell death by the Bcl-2 gene family.
Biochim Biophys Acta
1271:
63-66
[Medline]
Legendre L,
Rueter S,
Heinstein PF,
Low PS
(1993)
Characterization of the oligogalacturonide-induced oxidative burst in cultured soybean (Glycine max) cells.
Plant Physiol
102:
233-240
[Abstract]
Levine A,
Pennell R,
Alvarez M,
Palmer R,
Lamb CJ
(1996)
Calcium-mediated apoptosis in a plant hypersensitive disease resistance response.
Curr Biol
6:
427-437
[CrossRef][Web of Science][Medline]
Levine A,
Tenhaken R,
Dixon R,
Lamb C
(1994)
H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response.
Cell
79:
583-593
[CrossRef][Web of Science][Medline]
Low PS,
Merida JR
(1996)
The oxidative burst in plant defense-function and signal transduction.
Physiol Plant
96:
533-542
[CrossRef]
Maltby D,
Carpita NC,
Montezinos D,
Kulow C,
Delmer DP
(1979)
Glucan in developing cotton fibers: Structure, localization, and relationship of synthesis to that of secondary wall cellulose.
Plant Physiol
63:
1159-1164
Mehdy MC
(1994)
Active oxygen species in plant defense against pathogens.
Plant Physiol
105:
467-472
[Web of Science][Medline]
Meinert M,
Delmer DP
(1977)
Changes in the biochemical composition of the cell wall of the cotton fiber during development.
Plant Physiol
59:
1088-1097
[Abstract/Free Full Text]
Mithoefer A,
Daxberger A,
Fromhold-Treu D,
Ebel J
(1997)
Involvement of an NAD(P)H oxidase in the elicitor-inducible oxidative burst of soybean.
Phytochemistry
45:
1101-1107
[CrossRef][Web of Science]
Murphy TM,
Auh CK
(1996)
The superoxide synthases of plasma membrane preparations from cultured rose cells.
Plant Physiol
110:
621-629
[Abstract]
O'Donnell BV,
Tew DG,
Jones OT,
England PJ
(1993)
Studies on the inhibitory mechanism of iodonium compounds with special reference to neutrophil NADPH oxidase.
Biochem J
290:
41-49
Pantoja O,
Willmer CM
(1988)
Redox activity and peroxidase activity associated with the plasma membrane of guard-cell protoplasts.
Planta
174:
44-50
Pear JR,
Kawagoe Y,
Schreckengost WE,
Delmer DP,
Stalker DM
(1996)
Higher plants contain homologs of the bacterial celA genes encoding the catalytic subunit of cellulose synthase.
Proc Natl Acad Sci USA
93:
12637-12642
[Abstract/Free Full Text]
Potikha T,
Delmer DP
(1995)
A mutant of Arabidopsis thaliana displaying altered patterns of cellulose deposition.
Plant J
7:
453-460
[CrossRef]
Prasad TK
(1996)
Mechanisms of chilling-induced oxidative stress injury and tolerance in developing maize seedlings: changes in antioxidant system, oxidation of proteins and lipids, and protease activities.
Plant J
10:
1017-1026
[CrossRef][Web of Science]
Rao MV,
Paliyath G,
Ormrod DP
(1996)
UV-B- and ozone-induced biochemical changes in antioxidant enzymes of Arabidopsis thaliana.
Plant Physiol
110:
125-136
[Abstract]
Ridley AJ,
Paterson HF,
Johnston CL,
Diekmann D,
Hall A
(1992)
The small GTP-binding protein rac regulates growth factor-induced membrane ruffling.
Cell
70:
401-410
[CrossRef][Web of Science][Medline]
Royall JA,
Ischiropoulos H
(1993)
Evaluation of 2 ,7 -dichlorofluorescin and dihydrorhodamine 123 as fluorescent probes for intracellular H2O2 in cultured endothelial cells.
Arch Biochem Biophys
302:
348-355
[CrossRef][Web of Science][Medline]
Ryser U
(1985)
Cell wall biosynthesis in differentiating cotton fibers.
Eur J Cell Biol
39:
236-265
Schopfer P
(1994)
Histochemical demonstration and localization of H2O2 in organs of higher plants by tissue printing on nitrocellulose paper.
Plant Physiol
104:
1269-1275
[Abstract]
Schraudner M,
Langebartels C,
Sandermann H
(1997)
Changes in the biochemical status of plant cells induced by the environmental pollutant ozone.
Physiol Plant
100:
274-280
[CrossRef]
Seagull RW
(1990)
The effects of microtubule and microfilament disrupting agents on cytoskeletal arrays and wall deposition in developing cotton fibers.
Protoplasma
159:
44-59
[CrossRef]
Segal AW,
Abo A
(1993)
The biochemical basis of the NADPH oxidase of phagocytes.
Trends Biochem Sci
18:
43-47
[CrossRef][Web of Science][Medline]
Snell FD, Snell CT (1949) Colorimetric methods of analysis.
In Inorganic, Vol 2, Ed 3. Van Nostrano Company, New York,
pp 882-883
Sundaresan M,
Yu ZX,
Ferrans VJ,
Sulciner DJ,
Gutkind JS,
Irani K,
Goldschmidt-Clermont PJ,
Finkel T
(1996)
Regulation of reactive-oxygen-species generation in fibroblasts by Rac1.
Biochem J
318:
379-382
Svalheim O,
Robertsen B
(1993)
Elicitation of hydrogen peroxide production in cucumber hypocotyl segments by oligo-14-alpha-d-galacturonides and an oligo-beta-glucan preparation from cell walls of Phytophthora megasperma f. sp. glycinea.
Physiol Plant
88:
675-681
[CrossRef]
Symons M
(1996)
Rho family GTPases: the cytoskeleton and beyond.
Trends Biochem Sci
21:
178-181
[CrossRef][Web of Science][Medline]
Tenhaken R,
Levine A,
Brisson LF,
Dixon RA,
Lamb C
(1995)
Function of the oxidative burst in hypersensitive disease resistance.
Proc Natl Acad Sci USA
92:
4158-4163
[Abstract/Free Full Text]
Trayner ID,
Rayner AP,
Freeman GE,
Farzaneh F
(1995)
Quantitative multiwell myeloid differentiation assay using dichlorodihydrofluorescein diacetate (H-2DCF-DA) or dihydrorhodamine 123 (H-2R123).
J Immunol Metheds
186:
275-284
[CrossRef][Web of Science][Medline]
Ubezio P,
Civoli F
(1994)
Flow cytometric detection of hydrogen peroxide production induced by doxorubicin in cancer cells.
Free Radical Biol Med
16:
509-516
[CrossRef][Web of Science][Medline]
Updegraff DM
(1969)
Semimicro determination of cellulose in biological materials.
Anal Biochem
32:
420-424
[CrossRef][Web of Science][Medline]
Van Gestelen P,
Asard H,
Caubergs RJ
(1997)
Solubilization and separation of a plant plasma membrane NADPH-O2 synthase from other NAD(P)H oxidoreductases.
Plant Physiol
115:
543-550
[Abstract]
Weiss RH,
Flickinger AG,
Rivers WJ,
Hardy MM,
Aston KW,
Ryan US,
Riley DP
(1993)
Evaluation of activity of putative superoxide dismutase mimics: direct analysis by stopped-flow kinetics.
J Biol Chem
268:
23049-23054
[Abstract/Free Full Text]
Xing,
T,
Higgins VJ,
Blumwald E
(1997)
Race-specific elicitors of Cladosporium fulvum promote translocation of cytosolic components of NADPH oxidase to the plasma membrane of tomato cells.
Plant Cell
9:
249-259
[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
F. Wen, D. Xing, and L. Zhang
Hydrogen peroxide is involved in high blue light-induced chloroplast avoidance movements in Arabidopsis
J. Exp. Bot.,
July 1, 2008;
59(10):
2891 - 2901.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Paradiso, R. Berardino, M. C. de Pinto, L. Sanita di Toppi, M. M. Storelli, F. Tommasi, and L. De Gara
Increase in Ascorbate-Glutathione Metabolism as Local and Precocious Systemic Responses Induced by Cadmium in Durum Wheat Plants
Plant Cell Physiol.,
March 1, 2008;
49(3):
362 - 374.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Queval, J. Hager, B. Gakiere, and G. Noctor
Why are literature data for H2O2 contents so variable? A discussion of potential difficulties in the quantitative assay of leaf extracts
J. Exp. Bot.,
February 1, 2008;
59(2):
135 - 146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. W. Jeon, J.-U. Hwang, Y. Hwang, W.-Y. Song, Y. Fu, Y. Gu, F. Bao, D. Cho, J. M. Kwak, Z. Yang, et al.
The Arabidopsis Small G Protein ROP2 Is Activated by Light in Guard Cells and Inhibits Light-Induced Stomatal Opening
PLANT CELL,
January 1, 2008;
20(1):
75 - 87.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. L. Wong, R. Pinontoan, K. Hayashi, R. Tabata, T. Yaeno, K. Hasegawa, C. Kojima, H. Yoshioka, K. Iba, T. Kawasaki, et al.
Regulation of Rice NADPH Oxidase by Binding of Rac GTPase to Its N-Terminal Extension
PLANT CELL,
December 1, 2007;
19(12):
4022 - 4034.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Abbal, M. Pradal, F.-X. Sauvage, P. Chatelet, S. Paillard, A. Canaguier, A.-F. Adam-Blondon, and C. Tesniere
Molecular characterization and expression analysis of the Rop GTPase family in Vitis vinifera
J. Exp. Bot.,
July 1, 2007;
58(10):
2641 - 2652.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Jones, M. J. Raymond, Z. Yang, and N. Smirnoff
NADPH oxidase-dependent reactive oxygen species formation required for root hair growth depends on ROP GTPase
J. Exp. Bot.,
April 1, 2007;
58(6):
1261 - 1270.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Jacob-Wilk, I. Kurek, P. Hogan, and D. P. Delmer
The cotton fiber zinc-binding domain of cellulose synthase A1 from Gossypium hirsutum displays rapid turnover in vitro and in vivo
PNAS,
August 8, 2006;
103(32):
12191 - 12196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gapper and L. Dolan
Control of Plant Development by Reactive Oxygen Species
Plant Physiology,
June 1, 2006;
141(2):
341 - 345.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fujiwara, K. Umemura, T. Kawasaki, and K. Shimamoto
Proteomics of Rac GTPase Signaling Reveals Its Predominant Role in Elicitor-Induced Defense Response of Cultured Rice Cells
Plant Physiology,
February 1, 2006;
140(2):
734 - 745.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kawasaki, H. Koita, T. Nakatsubo, K. Hasegawa, K. Wakabayashi, H. Takahashi, K. Umemura, T. Umezawa, and K. Shimamoto
Cinnamoyl-CoA reductase, a key enzyme in lignin biosynthesis, is an effector of small GTPase Rac in defense signaling in rice
PNAS,
January 3, 2006;
103(1):
230 - 235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Brembu, P. Winge, and A. M. Bones
The small GTPase AtRAC2/ROP7 is specifically expressed during late stages of xylem differentiation in Arabidopsis
J. Exp. Bot.,
September 1, 2005;
56(419):
2465 - 2476.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Karlsson, M. Melzer, I. Prokhorenko, T. Johansson, and G. Wingsle
Hydrogen peroxide and expression of hipI-superoxide dismutase are associated with the development of secondary cell walls in Zinnia elegans
J. Exp. Bot.,
August 1, 2005;
56(418):
2085 - 2093.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Ortega-Villasante, R. Rellan-Alvarez, F. F. Del Campo, R. O. Carpena-Ruiz, and L. E. Hernandez
Cellular damage induced by cadmium and mercury in Medicago sativa
J. Exp. Bot.,
August 1, 2005;
56(418):
2239 - 2251.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Preuss, J. Serna, T. G. Falbel, S. Y. Bednarek, and E. Nielsen
The Arabidopsis Rab GTPase RabA4b Localizes to the Tips of Growing Root Hair Cells
PLANT CELL,
June 1, 2004;
16(6):
1589 - 1603.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Park, Y. Gu, Y. Lee, Z. Yang, and Y. Lee
Phosphatidic Acid Induces Leaf Cell Death in Arabidopsis by Activating the Rho-Related Small G Protein GTPase-Mediated Pathway of Reactive Oxygen Species Generation
Plant Physiology,
January 1, 2004;
134(1):
129 - 136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Bloomfield and C. Pears
Superoxide signalling required for multicellular development of Dictyostelium
J. Cell Sci.,
August 15, 2003;
116(16):
3387 - 3397.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P.-J. Jih, Y.-C. Chen, and S.-T. Jeng
Involvement of Hydrogen Peroxide and Nitric Oxide in Expression of the Ipomoelin Gene from Sweet Potato
Plant Physiology,
May 1, 2003;
132(1):
381 - 389.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. del Carmen Cordoba-Pedregosa, F. Cordoba, J. M. Villalba, and J. A. Gonzalez-Reyes
Zonal Changes in Ascorbate and Hydrogen Peroxide Contents, Peroxidase, and Ascorbate-Related Enzyme Activities in Onion Roots
Plant Physiology,
February 1, 2003;
131(2):
697 - 706.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Y. Cheung, C. Y-h. Chen, L.-z. Tao, T. Andreyeva, D. Twell, and H.-m. Wu
Regulation of pollen tube growth by Rac-like GTPases
J. Exp. Bot.,
January 1, 2003;
54(380):
73 - 81.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Doblin, I. Kurek, D. Jacob-Wilk, and D. P. Delmer
Cellulose Biosynthesis in Plants: from Genes to Rosettes
Plant Cell Physiol.,
December 15, 2002;
43(12):
1407 - 1420.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Nakanomyo, B. Kost, N.-H. Chua, and H. Fukuda
Preferential and Asymmetrical Accumulation of a Rac Small GTPase mRNA in Differentiating Xylem Cells of Zinnia elegans
Plant Cell Physiol.,
December 15, 2002;
43(12):
1484 - 1492.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-z. Tao, A. Y. Cheung, and H.-m. Wu
Plant Rac-Like GTPases Are Activated by Auxin and Mediate Auxin-Responsive Gene Expression
PLANT CELL,
November 1, 2002;
14(11):
2745 - 2760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Lavy, K. Bracha-Drori, H. Sternberg, and S. Yalovsky
A Cell-Specific, Prenylation-Independent Mechanism Regulates Targeting of Type II RACs
PLANT CELL,
October 1, 2002;
14(10):
2431 - 2450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Kurek, Y. Kawagoe, D. Jacob-Wilk, M. Doblin, and D. Delmer
Dimerization of cotton fiber cellulose synthase catalytic subunits occurs via oxidation of the zinc-binding domains
PNAS,
August 20, 2002;
99(17):
11109 - 11114.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Baxter-Burrell, Z. Yang, P. S. Springer, and J. Bailey-Serres
RopGAP4-Dependent Rop GTPase Rheostat Control of Arabidopsis Oxygen Deprivation Tolerance
Science,
June 14, 2002;
296(5575):
2026 - 2028.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Yang
Small GTPases: Versatile Signaling Switches in Plants
PLANT CELL,
May 1, 2002;
14(90001):
S375 - 388.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Wu, Y. Gu, S. Li, and Z. Yang
A Genome-Wide Analysis of Arabidopsis Rop-Interactive CRIB Motif-Containing Proteins That Act as Rop GTPase Targets
PLANT CELL,
December 1, 2001;
13(12):
2841 - 2856.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhang, L. Zhang, F. Dong, J. Gao, D. W. Galbraith, and C.-P. Song
Hydrogen Peroxide Is Involved in Abscisic Acid-Induced Stomatal Closure in Vicia faba
Plant Physiology,
August 1, 2001;
126(4):
1438 - 1448.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Sang, D. Cui, and X. Wang
Phospholipase D and Phosphatidic Acid-Mediated Generation of Superoxide in Arabidopsis
Plant Physiology,
August 1, 2001;
126(4):
1449 - 1458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Joo, Y. S. Bae, and J. S. Lee
Role of Auxin-Induced Reactive Oxygen Species in Root Gravitropism
Plant Physiology,
July 1, 2001;
126(3):
1055 - 1060.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Li, J.-J. Shen, Z.-L. Zheng, Y. Lin, and Z. Yang
The Rop GTPase Switch Controls Multiple Developmental Processes in Arabidopsis
Plant Physiology,
June 1, 2001;
126(2):
670 - 684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Orozco-Cárdenas, J. Narváez-Vásquez, and C. A. Ryan
Hydrogen Peroxide Acts as a Second Messenger for the Induction of Defense Genes in Tomato Plants in Response to Wounding, Systemin, and Methyl Jasmonate
PLANT CELL,
January 1, 2001;
13(1):
179 - 191.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. Lin, D. F. Seals, S. K. Randall, and Z. Yang
Dynamic Localization of Rop GTPases to the Tonoplast during Vacuole Development
Plant Physiology,
January 1, 2001;
125(1):
241 - 251.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
F. C. Küpper, B. Kloareg, J. Guern, and P. Potin
Oligoguluronates Elicit an Oxidative Burst in the Brown Algal Kelp Laminaria digitata
Plant Physiology,
January 1, 2001;
125(1):
278 - 291.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. Winge, T. Brembu, R. Kristensen, and A. M. Bones
Genetic Structure and Evolution of RAC-GTPases in Arabidopsis thaliana
Genetics,
December 1, 2000;
156(4):
1959 - 1971.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. Wu, H. Li, and Z. Yang
Arabidopsis RopGAPs Are a Novel Family of Rho GTPase-Activating Proteins that Require the Cdc42/Rac-Interactive Binding Motif for Rop-Specific GTPase Stimulation
Plant Physiology,
December 1, 2000;
124(4):
1625 - 1636.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Park, H.-J. Choi, S. Lee, T. Lee, Z. Yang, and Y. Lee
Rac-Related GTP-Binding Protein in Elicitor-Induced Reactive Oxygen Generation by Suspension-Cultured Soybean Cells
Plant Physiology,
October 1, 2000;
124(2):
725 - 732.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. Kovtun, W.-L. Chiu, G. Tena, and J. Sheen
From the Cover: Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants
PNAS,
March 14, 2000;
97(6):
2940 - 2945.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|