|
Plant Physiol. (1999) 119: 1271-1278
Long-Day Up-Regulation of a GAMYB Gene during
Lolium temulentum Inflorescence Formation
Greg F.W. Gocal1,
Andrew T. Poole,
Frank Gubler,
Robyn
J. Watts,
Cheryl Blundell, and
Rod W. King*
Commonwealth Scientific and Industrial Research Organisation
(CSIRO) and Cooperative Research Centre for Plant Science, G.P.O. Box
4, Canberra, ACT 2601, Australia (G.F.W.G., A.T.P., F.G., R.J.W.); and CSIRO, Plant Industry, G.P.O. Box 1600, Canberra, ACT 2601, Australia
(C.B., R.W.K.)
 |
ABSTRACT |
Long-day exposure of the grass
Lolium temulentum may regulate flowering via changes in
gibberellin (GA) levels. Therefore, we have examined both GA levels and
expression of a MYB transcription factor that is
specific to the GA signal transduction pathway in monocots. This
MYB gene from L. temulentum shows over
90% nucleotide identity with the barley and rice GAMYB
genes, and, like them, gibberellic acid (GA3) up-regulates
its expression in the seed. Furthermore, cDNAs of both the barley and
L. temulentum GAMYB show the same simple patterns of
hybridization with digests of L. temulentum genomic
DNA. Compared with vegetative shoot apices of L. temulentum, the in situ mRNA expression of
LtGAMYB does not change during the earliest steps of
"floral" initiation at the apex. However, by 100 h (the
double-ridge stage of flowering) its expression increased substantially
and was highest in the terminal and lateral spikelet sites.
Thereafter, expression declined overall but then increased
within stamen primordia. Prior to increased LtGAMYB
expression, long-day exposure sufficient to induce flowering led to
increased (5- to 20-fold) levels of GA1 and GA4
in the leaf. Thus, increases first in GA level in the leaf followed by increased expression of LtGAMYB in the apex suggest
important signaling and/or response roles in flowering.
| |
INTRODUCTION |
GAs have long been considered to play a role in flowering. Such a
conclusion is supported by the observation that a number of LD plants,
including Lolium temulentum, flower in response to applied
GA (Lang, 1965 ). Also, within the shoot apex of L. temulentum the levels of bioassayed GA-like substances are
elevated after exposure to florally inductive LDs (Pharis et al.,
1987), as are endogenous GAs in leaves of some species (Graebe, 1987, and refs. therein). Thus, with exposure to LDs, increased GA content in
the leaf with its subsequent transport to the shoot apex could represent one component in the regulation of the vegetative to floral
transition at the apex of the LD plant L. temulentum.
A genetic approach to defining the role for GA in LD-induced flowering,
although not pursued for L. temulentum, has been
particularly informative with other LD plants. For example,
ga1-3, a dwarf mutant of Arabidopsis with very reduced GA
levels, never flowered under noninductive SDs, but GA application or
exposure to LD conditions led to rapid flowering (Wilson et al., 1992).
Conversely, the spy
(spindly) and elo
(elongated) mutants of Arabidopsis,
which have the appearance of being treated with a high level of GA, flower early (Jacobsen and Olszewski, 1993; Halliday et al., 1996; Jacobsen et al., 1996). Thus, not only does GA promote flowering but
also apparently substitutes for LD conditions.
At the molecular level little is known about how GAs regulate
flowering, but the expression of at least one gene could be regulated
by GA during flowering. The LEAFY gene of Arabidopsis is
known to regulate early floral events and its promoter is responsive to
GA (Blázquez et al., 1997, 1998). In addition, applied GA can
rescue the weak flowering of leafy mutants (Okamuro et al., 1996). A further candidate gene is the GAMYB transcription factor. In
the cereal aleurone the GAMYB protein is a transcriptional activator in
GA regulation (Gubler et al., 1995); it acts by binding to a
GA-response element (TAACAAA) in the promoter of an
 -amylase gene. A GAMYB gene could therefore be
as important as LEAFY in GA transcriptional regulation of
flowering. Here we show that there is a GAMYB homolog in
L. temulentum, that it is expressed in shoot apices, and
that its expression is up-regulated during the vegetative to floral
transition in parallel with increased GA levels. Thus, GA acting via
GAMYB may play roles in both the cereal aleurone and,
separately, in the shoot apex during its transition to
flowering.
| |
MATERIALS AND METHODS |
Plant Material
Lolium temulentum L. strain Ceres plants were grown
vegetatively in SD conditions (8 h) as described previously (Evans et al., 1990). When these plants are 6 or more weeks old, exposure to a
single LD (16-h incandescent lamp extension, 15 µmol
m 2 s1) leads to rapid
inflorescence formation (flowering). Controls retained in SD conditions
remain vegetative. Gocal (1997) has described the sequence, timing, and
spatial arrangement of floral organ development of the material used
here for in situ mRNA hybridization. After 6 weeks of growth the
vegetative apex had accumulated up to eight leaf primordia below the
shoot apical dome. Upon flowering, along with a rapid (2- to 4-d)
production of more spikelets by the dome, the presumptive spikelet
sites between the leaf primordia were activated, forming the
characteristic double-ridge stage that is the first morphological sign
of inflorescence development (5-7 d after LD conditions). Spikelet
outgrowth (8-11 d) followed, then the formation of glume, lemma,
and floret primordia, and, finally (21 d), anther primordia
appeared.
Molecular Cloning of the L. temulentum GAMYB
Homolog LtGAMYB
Gocal (1997) has described the molecular techniques used to
identify and characterize the L. temulentum genes expressed
at the shoot apex. LtGAMYB was identified from duplicate
lifts of a PCR-based cDNA library constructed from L. temulentum LD III shoot apices and hybridized with a barley
GAMYB (HvGAMYB) 5 fragment (nucleotides
272-1121; Gubler et al., 1995). The filters were washed at
intermediate stringency (0.5× SSPE; 0.2% SDS at 65°C). Cloned DNA
fragments were sequenced in both directions with either dideoxy or dye
primer ready-reaction sequencing kits (PRISM, Applied Biosystems). We
used Genetics Computer Group software (version 8.0; Devereux et al.,
1984) to do sequence analysis.
DNA Analysis
We followed the method of Dellaporta et al. (1983) to isolate
genomic DNA from etiolated 2-week-old L. temulentum
seedlings. Twenty micrograms of DNA was digested with BglII,
EcoRI, or XhoI, fractionated in a 1% agarose
gel, and blotted onto Hybond N membrane according to the
manufacturer's instructions (Amersham). To provide evidence that the
L. temulentum cDNA encoded the barley GAMYB homolog, we hybridized a 3 conserved EcoRI/SacI
fragment (nucleotides 1239-1930) to a blot that was washed at high
stringency (0.1× SSPE; 0.2% SDS at 65°C).
RNA Analysis
L. temulentum seeds were sterilized and dehusked by
shaking for 2 h in 50%
H2SO4 and then rinsed in
sterile water. The embryos were cut off with a scalpel and the
remaining half seeds were hydrated overnight on moist filter paper and
then incubated at 25°C in 2 mL of 10 mM
CaCl2, 150 µg mL1
cefatoxime, 50 units mL1 nystatin, and either 0 or 106 M
GA3. We used the method of Schuurink et al.
(1996) to isolate RNA from the endosperm halves. For RNA analysis, we
fractionated 10 µg of RNA in a 1% agarose gel containing
formaldehyde and blotted it onto a nylon membrane. The blots were
hybridized with a 32P-dCTP-labeled
EcoRI/SacI LtGAMYB fragment. The blot
was washed at high stringency and analyzed by autoradiography. We
reprobed the blots with a barley -amylase cDNA (1-28 from P. Matthews, CSIRO) and a 9-kb wheat rRNA clone, pTA71 (Gerlach and
Bedbrook, 1979).
In Situ mRNA Hybridizations
The in situ hybridization results were obtained with shoot apex
sections collected in one experiment (Lt434) and are therefore directly
comparable. Similar timing of floral development was seen across
experiments (Gocal, 1997). On harvesting, the apices were fixed,
dehydrated, paraffin-embedded, sectioned, and used for in situ
hybridization according to the method of Gocal (1997). The
LtGAMYB-specific
EcoRI/SacI fragment (see above) was
subcloned into the EcoRI/EcoRV sites of
pBluescript SK(+) and pBluescript KS(+) (Stratagene). Sense and
antisense DIG-labeled, in vitro-transcribed riboprobes were synthesized
from the T7 promoter of these subclones linearized with
EcoRI. The hybridizing probe was detected
colorimetrically using an anti-DIG Fab fragment conjugated to alkaline
phosphatase. Photographs were taken with Nomarski optics on an Axioplan
microscope (Zeiss). The film was Fujichrome 64T and all exposures were
identical.
Analysis of Endogenous GAs
To identify endogenous GAs by full-scan GC-MS, we harvested
16 g dry weight of shoots from 3-week-old seedlings from plants grown in SD conditions. On the basis of this identification, we used
GC-MS with single- and multiple-ion monitoring to follow changes in GA
levels in just fully expanded leaves from 6-week-old plants.
Leaves were harvested at a fixed time of the day after 0, 1, 2, or
4 d of LD treatment as shown in Figure
1. At harvest, the tissue was frozen in
liquid nitrogen and ground with a mortar and pestle before
lyophilization. The samples (6-7.5 g dry weight) were extracted in 250 mL of 80% (v/v) methanol at 4°C for 24 h and then filtered. The
residue was re-extracted in 250 mL of 100% methanol for a further
24 h; following filtration we combined all of the methanolic
fractions. Dideuterated GA standards (from L.N. Mander, Australian
National University, Canberra) were added at the time of extraction.
The amount of each GA added ranged from 1 to 20 ng g1 dry
weight of the sample and was estimated from preliminary assays so that
in any sample, the ratio of deutero to protio ions was close to 1:1.
Twelve thousand counts per minute each of high specific activity
[3H]GA20,
[3H]dihydro-GA19 (from J. Lenton, Long Ashton Research Station, Bristol, UK), and
[3H]GA1 (from R.P.
Pharis, University of Calgary, Alberta, Canada) were added to monitor
GAs during purification. At these levels, none of these
tritiated GAs could be detected by GC-MS. We extracted a sample for
full-scan identification in 950 mL of 80% (v/v) methanol and added
only the tritiated standards.
View larger version (11K):
[in this window]
[in a new window]
| Figure 1.
Harvesting schedule ( ) in relation to the daily
exposure to light (white bars), darkness (black bars), and to
incandescent daylength extension (gray bars) for vegetative control
plants exposed to SDs or to 1, 2, or 4 florally inductive LDs.
|
|
The extracts were reduced to an aqueous solution under reduced pressure
at 35°C, then frozen overnight, thawed, and centrifuged. The
supernatants were adjusted to pH 2.5 using 2 M HCl, and
then filtered through a 0.2-µm nylon filter (Millipore) before ethyl acetate partitioning. Further purification through QAE Sephadex and
C18 Sep-Pak was outlined in Green et al. (1997).
Initial HPLC involved a 25-cm × 4.6-mm i.d. × 5-µm particle
size C18 column (Allsphere ODS-2, Alltech,
Deerfield, MI). Solvent A consisted of 10% methanol in 2 mM acetic acid, and solvent B was 100% methanol. A linear
gradient from 20% B in A to 100% B over 40 min was used, with a flow
rate of 1 mL min1. We collected 1-min fractions
and pooled and dried five groupings, based on the elution of
radiolabeled GAs. Each of these groupings was then chromatographed
isocratically at 1 mL min1 with methanol
containing 0.05% acetic acid using a 15-cm × 4.6-mm i.d. × 5-µm particle size
N(CH3)2 column (Nucleosil,
Alltech). We collected and pooled 1-min fractions, based on the
tritiated standard elution times. Because of persistent impurities,
some samples required a third HPLC step after methylation; in these cases we used the initial C18 column and
conditions.
Samples were methylated and derivatized (Green et al., 1997) before
injection onto a 25-m × 0.22-mm i.d. × 0.25-µm film thickness fused silica column (BPX-5, SGE, Austin, TX). GC conditions were as in
Green et al. (1997). For GA identification in L. temulentum we analyzed a portion of each sample in the full-scan mode, and reanalyzed the remainder of the sample in the multiple-ion-monitoring mode (at least eight characteristic ions). We co-injected all samples
with Parafilm to determine the Kovats Retention Index, and used
authentic GAs (from L.N. Mander) for comparison. We also compared the
full scans with a PC-based GA spectral library (Gaskin and MacMillan,
1991). For quantification we used the following pairs of characteristic
ions (deutero ion/protio ion): 508/506 (GA1),
286/284 (GA4), 596/594
(GA8), 300/298 (GA9),
436/434 (GA19), 420/418
(GA20), 508/506 (GA29),
434/432 (GA44), and 450/448
(GA53). With the exception of
GA53, calibration curves were used. For GA53, we made appropriate corrections to account
for contributions to the area of the 450 ion from endogenous
GA53.
| |
RESULTS |
L. temulentum GAMYB Gene
In initial experiments, barley 5 or 3 HvGAMYB probes
were hybridized to a L. temulentum PCR-based cDNA gel blot.
The largest hybridizing band was 2.8 kb, approximately the expected
size for a GAMYB gene. Subsequently, two plaques in 360,000 from a PCR-based cDNA library showed specific hybridization. These were
partially overlapping cDNAs encoded by the same gene. A complete
sequence was obtained by primer extension of these cDNAs. The
primer pair was designated as 001-Hind
(5-d [ATAAGCTTGAGATGTACCGGGTGAAGAGCGAGAGC]-3), based on the barley GAMYB start codon sequence
(Gubler et al., 1995), and Lo8
(5-d[AAAGACCATTCCCATTCAGA]-3), based on the L. temulentum
MYB-like gene outside the R2/R3 repeat. Two rounds of
amplification consisting of 30 and 20 cycles, respectively, were
performed with Pfu DNA polymerase. The single band found on
electrophoresis of the reaction product was blunt-end cloned and three
inserts were sequenced. All three gave an identical reaction product of
567 bp, which overlapped by 114 bp with the 5 end of each cDNA clone
isolated in the library screen. The nucleotide sequence of the first
nine amino acids of the LtGAMYB sequence is
uncertain because it is identical to that of the primer.
The nucleotide sequence of the LtGAMYB clone was lodged with
GenBank (accession no. AF114162). It is 91% identical to both the
barley and rice GAMYB sequences, with their proteins
being 95% and 94% similar, respectively (Fig.
2). Within the DNA-binding R2/R3 repeat
region (underlined in Fig. 2), the amino acid sequence of
LtGAMYB is 99% identical to that of barley
or rice, indicating that their binding specificities are likely to be
very similar. Furthermore, when L. temulentum genomic DNA
was cut with three restriction enzymes and analyzed by DNA gel
blotting, the L. temulentum and barley probes both
hybridized at high stringency to the same single bands for DNA digested
with EcoRI or XhoI (Fig. 3). The presence of two
bands when the DNA was cut with BglII indicates an internal
BglII site. It is uncertain why there is greater
hybridization of the barley probe with the lower band compared with
that of the homologous probe; perhaps there was an uneven transfer of DNA to these blots. We cannot say whether there are more
GAMYB-related genes in L. temulentum, but at the
high level of stringency used, cDNA probe specificity can be expected
for DNA and RNA hybridization (Fig.
3).
View larger version (38K):
[in this window]
[in a new window]
| Figure 2.
Predicted amino acid sequence of LtGAMYB and
comparison with the sequences for the barley (Hv) and rice (Os) GAMYB
homologs (Gubler et al., 1995, 1997). From the nucleotide sequence, the
position of EcoRI ( ) and SacI ( )
restriction sites conserved with those in HvGAMYB are indicated with
arrows. The stop codon is indicated with an asterisk. The R2 and R3
repeats are shown as blocks. Dashes indicate gaps to maximize
alignment. Dots show identical amino acids.
|
|
View larger version (45K):
[in this window]
[in a new window]
| Figure 3.
L. temulentum genomic DNA gel-blot
analysis using homologous 3-end-specific probes from
LtGAMYB and HvGAMYB. Genomic DNA (20 µg) was digested with BglII, EcoRI, and
XhoI. After blotting, the digested DNA was hybridized
with an EcoRI/SacI restriction fragment
from either LtGAMYB or HvGAMYB. This
restriction fragment corresponds to the nucleotide sequence encoding
the amino acids between the arrowheads in Figure 2.
|
|
View this table:
[in this window]
[in a new window]
|
Table I.
Identification of GAs from L. temulentum leaves by
GC-MS
HPLC fractions were selected by comparison with prior separations of
standards (std). To determine the Kovats Retention Index (KRI) for
GC-MS, all samples were co-injected with Parafilm. Multiple ion
monitoring data are presented.
|
|
Seed Expression of LtGAMYB
Because HvGAMYB was initially isolated as a
transactivator of an -amylase gene in barley aleurone
tissue, it was important to determine whether LtGAMYB was
also expressed in L. temulentum de-embryonated half-seeds
(caryopsese) and whether GA up-regulated this mRNA. Therefore, we
incubated the embryoless L. temulentum half-seeds in the
presence or absence of GA3 for 6 or 12 h
prior to -amylase enzyme activity assays and extraction of RNA.
After 12 h, GA3 had stimulated -amylase
activity in these half-seeds 2- to 3-fold (data not shown). To examine
changes in mRNA levels, we probed an RNA gel blot with the
gene-specific 32P-dCTP-labeled LtGAMYB
EcoRI/SacI fragment (nucleotides 962-1638) or with the
barley -amylase cDNA probe. LtGAMYB and -amylase mRNAs
were expressed in half-seeds incubated without hormone and were weakly
up-regulated after GA treatment (Fig. 4).
As Evans et al. (1994) found previously, there was a high background
-amylase enzyme activity in untreated half-seeds. If these L. temulentum seeds contained sufficient endogenous GAs to cause this
increase in mRNAs over the 12-h period, then only a weak response to
applied GA might be expected.
View larger version (70K):
[in this window]
[in a new window]
| Figure 4.
Effect of 106 M
GA3 on GAMYB and -amylase
gene expression in L. temulentum de-embryonated
half-seeds. RNA was isolated at 0, 6, or 12 h and blotted; the
blots were probed with the EcoRI/SacI
probe from LtGAMYB, a barley -amylase
cDNA, and a wheat rDNA clone (pTA71).
|
|
Overall, the very high sequence identity, the presence of a single copy
sequence in genomic DNA, and the GA up-regulation of expression in
half-seeds all confirm that LtGAMYB is the functional equivalent of HvGAMYB.
Inflorescence Expression of LtGAMYB
To determine the pattern of LtGAMYB
expression during floral evocation and development, we examined the
spatial and temporal localization of LtGAMYB mRNA within
the inflorescence by in situ hybridization (Fig.
5). At an equivalent concentration of
riboprobe, the antisense-probed sections all showed considerable
hybridization (Fig. 5, A and C-F), but the sense probe barely
hybridized at any time point for SD or LD apices. The comparison of
sense and antisense probes (Fig. 5, B versus C) for LD VI apices is the most exacting because it involved the most intense hybridization of the
antisense probe.
View larger version (135K):
[in this window]
[in a new window]
| Figure 5.
In situ localization of LtGAMYB
transcripts in L. temulentum shoot apices using
longitudinal sections of apices harvested at different developmental
stages and hybridized using DIG-labeled, in vitro-transcribed
LtGAMYB riboprobes synthesized from an
EcoRI/SacI fragment (indicated in Fig.
2). All sections were hybridized with the antisense riboprobe except B,
which was hybridized with the sense control riboprobe. Concentration of
the probe and the anti-DIG antibody and the duration of the color
development were identical. Photographs were taken using Nomarski
optics with identical exposures. A, Six-week-old vegetative apex; B and
C, double-ridge stage; D, lateral spikelet meristems at the glume
stage; E, spikelets at floret stage; and F, a stamen primordium on the
flank of a floret site. Bars = 100 µm. am, Apical meristem; f,
floret; g, glume; gp, glume primordium; l, lemma; lp, leaf primordium;
pr, provascular strand; sm, spikelet meristem; s, stamen primordium;
tsm, terminal spikelet meristem.
|
|
The expression of the LtGAMYB message was detected
throughout the vegetative SD shoot apex; it was highest in the apical
dome at the tip of the shoot apex and within the developing leaf
primordia at its base (Fig. 5A). Compared with the SD apices,
expression remained unchanged in the shoot apex during floral
evocation over the first 12 to 30 h (LD II and LD III) after
LD exposure (data not shown). We detected the greatest expression
within the double-ridge apex (Fig. 5C, LD VI), predominantly in the
apical dome but also within the lateral spikelet meristems. The
original leaf primordia evident as the lower bulge on the "double
ridge" (Fig. 5C) showed much less LtGAMYB expression.
In advanced double-ridge apices 8 to 11 d after the LD transition
(LD IX-LD XII), expression declined but was still detected within
spikelet sites (Fig. 5D), developing glume primordia, and the apical
dome (data not shown). At later times (LD XXX), expression was still
evident in the developing glume and lemma primordia, as well as in the
floret meristems that initiate in their axils (Fig. 5E). Of the floral
organs that initiate from the floret meristem, the highest expression
was within the stamen primordia (Fig. 5F). LtGAMYB was
also expressed within the provascular tissue, especially that leading
to the developing glumes and lemma during late stages of development.
GA Levels in L. temulentum Leaves
From full-scan GC-MS and/or multiple-ion monitoring analysis
involving more than eight selected ions, we have identified a number of
endogenous GAs in L. temulentum (Table I). We based their
identification on: (a) matches in their mass spectra with authentic
standards; (b) common Kovats Retention Index Values; and (c) their
co-chromatography on HPLC.
The GC-MS-single-ion monitoring analysis of changes in GA content of
leaves exposed to various florally inductive LD conditions appears in
Figure 6 for the various times of
harvest. By 48 h after beginning exposure to LD conditions, there
were increases of 5- to 20-fold in the content of
GA1 and GA4 (Fig. 6). In
L. temulentum both of these GAs were active for stem
elongation (Evans et al., 1990) and they were, respectively, the
biosynthetic products of conversion of GA19 to
GA20 to GA1 and of
GA24 to GA9 to
GA4 (Graebe, 1987). The reduction in precursor
levels due to LD exposure, particularly of GA19,
implies an increase in its metabolism.
View larger version (20K):
[in this window]
[in a new window]
| Figure 6.
Effect of LD exposure on leaf GA content in
L. temulentum. Levels are shown for biosynthetic
precursors, active GAs (GA1, GA4), and one
catabolite (GA8) for the two common biosynthetic pathways
in plants that differ in carbon-13 hydroxylation. The timing of
harvests relative to exposure to various SD or LD was outlined in
``Materials and Methods''. GA24 was not quantified. dwt,
Dry weight.
|
|
Floral development in L. temulentum responds proportionately
to increasing the number of LD, and we assume that GA metabolism did
change in the leaf following the 1st LD, but we were unable to detect
it in this study. In a repeat experiment GA biosynthesis did appear to
increase in the leaf after 1 LD (data not shown). It could be expected
that GA levels at the shoot apex would increase with those in the leaf,
and our earlier bioassay studies indicated such change (Pharis et al.,
1987). Recently, we have applied highly sensitive GC-MS techniques to
measure GAs in the shoot apex; and we have found reproducible evidence
of increases after 2 LD (R.W. King and T. Moritz, unpublished data).
| |
DISCUSSION |
In the grass L. temulentum, we have identified and
characterized LtGAMYB, a homolog of the barley GA-regulated
MYB gene. LtGAMYB is expressed in vegetative
tissue and we assume that it is important for maintaining normal
vegetative growth. Its enhanced expression during the early stages of
floral development (double-ridge stage; LD VI) implies that GAMYB is
important for floral development (more so than for floral evocation)
and that GA levels at the apex increase at that time. To our knowledge,
this is the first report of an increase in MYB gene
expression at flower initiation. However, unrelated MYB
genes play roles in flower coloration (Jackson et al., 1991) and
regulate petal epidermal cell shape (Noda et al., 1994). Even more
significant is the link we can make between flowering,
LtGAMYB expression, and evidence that GA levels, both endogenous (Fig. 6) and applied (Pharis et al., 1987; Evans et al.,
1990), may regulate flowering of L. temulentum.
GA not only regulates flowering, but also seed germination, -amylase
production in the cereal aleurone, stem elongation, and many more
processes (Graebe, 1987). It is now known that GAMYB is one component
of the transduction pathway from GA to responses involving aleurone
function (Gubler et al., 1995, 1997). In the present study,
by cloning LtGAMYB, we were able to extend these findings to
the grass L. temulentum, which has the additional benefit
that the timing of its flowering responses has been precisely defined
in our previous physiological studies (Evans and King, 1985; King et
al., 1993). The very high degree of identity of LtGAMYB with
existing barley and rice GAMYB genes (Fig. 2), together with
the fact that the 3-end-specific barley and L. temulentum probes both hybridize with the same single-copy sequence within L. temulentum genomic DNA (Fig. 3), identifies this L. temulentum MYB-like gene as the L. temulentum GAMYB
homolog. The fact that expression of the L. temulentum
homolog is up-regulated in de-embryonated half-seeds in response to
GA3 reinforces this claim (Fig. 4). It follows
that, just as GAMYB is proposed to mediate some
GA-controlled germination-related processes, it may also provide a
critical link between endogenous GA and the transcriptional activation of a cascade of genes involved in flowering.
Our claim that GAMYB expression is important for flowering
implies that GA levels increase at the shoot apex in association with
LD-induced flowering of L. temulentum. Quantitation of
endogenous levels of "biologically active" GAs at the shoot apex
during monocot inflorescence development has been assessed only by
bioassay in barley (Nicholls, 1974), L. temulentum (Pharis
et al., 1987), oat (Kaufman et al., 1976), and rice (Osada et al.,
1973). In such apices the level of GA3-like
activity was high at the double-ridge stage and decreased thereafter; a
second peak of GA-like activity was then observed during stamen
development in barley (Nicholls, 1974), oat (Kaufman et al., 1976), and
rice (Osada et al., 1973). Our evidence showing that LD exposure led to
increased active GAs in the leaf (Fig. 6) indicates that shoot apex GA
levels could be high just before the double-ridge stage, when
LtGAMYB expression increases at the apex (Fig. 5). This
information fits with the timing of increased LtGAMYB
expression and with our earlier evidence that the florigenic effect of
applied GA3 on excised apices remained high until
the double-ridge stage of floral development (LD VI; King et al.,
1993). During stamen development GA action may also be important
(Sawhney, 1992), and this agrees with the enhanced expression of
LtGAMYB in stamen primordia (Fig. 5F). Thus,
LtGAMYB may mediate the processes of floral development in
response to endogenous GAs. We have previously argued that GAs may not
regulate earlier processes involving floral evocation (King et al.,
1993); however, this issue has yet to be examined.
For years it has been known that LD conditions enhance the GA
biosynthesis of dicot species (Zeevaart, 1971; Gilmour et al., 1986;
Talon and Zeevaart, 1990; Zeevaart and Gage, 1993; Wu et al.,
1996). For monocots a LD-regulated increase in GA levels in leaves has
been shown previously for Poa pratensis (Junttila et al.,
1997) and now also for L. temulentum (Fig. 6). It is
possible that in L. temulentum, LD conditions activate
specific biosynthetic steps, including those involving the 20-oxidase
enzyme(s) regulating both the early 13-hydroxylation pathway and the
non-13-hydroxylation pathway (Fig. 6), as was reported for spinach
(Gilmour et al., 1986). On the other hand, the increases in
GA1 and GA4 suggest increased activity of 3 -hydroxylases or a more general up-regulation of early steps of GA biosynthesis. Reduced catabolism of
3-hydroxylated GAs could also cause a buildup of
GA1 and GA4, an explanation we cannot assess.
Enhanced expression of floral identity genes related to
APETALA1 and cell-cycle-regulatory genes in L. temulentum, including CDC2 (Gocal, 1997), are associated
with the very earliest (d 1-4) events of floral evocation. Later (d
5-6), when LtGAMYB expression was greatest, cell division
became intensive but the two responses were not linked. For example,
after a further 3 to 6 d there was much reduced LtGAMYB
expression (late double-ridge/early glume stage; Fig. 5D), yet cell
division was still intensive. There are many phases of plant
development at which GAMYB expression could be important,
but the dramatic contrast between the high level of expression of
LtGAMYB at the double-ridge stage and the weaker expression
during other floral stages and in vegetative apices may indicate that
LtGAMYB plays an important developmental role over the
period associated with inflorescence primordia formation. We envisage
that such a specific developmental role of LtGAMYB could
involve activation of the expression of the floral transcription factor
related to the LEAFY gene of Arabidopsis. In L. temulentum apices, LtGAMYB expression (Fig. 5) precedes
the expression of the L. temulentum LEAFY homolog (Gocal,
1997). Furthermore, there may be a GAMYB-binding site within
the LEAFY promoter (e.g. for Arabidopsis, the sequence
CAACTGTC; accession no. M91208). However, it remains to be determined
whether this site is functionally important for GA-induced gene
expression in Arabidopsis, and, if so, whether it is mediated through a
GAMYB. Whether this site is conserved in the promoter of the
L. temulentum LEAFY gene also remains to be determined.
| |
FOOTNOTES |
1
Present address: Plant Biology Laboratory, The
Salk Institute for Biological Studies, 10010 N. Torrey Pines Road, San
Diego, CA 92037.
*
Corresponding author; e-mail r.king{at}pi.csiro.au; fax
61-26-246-5000.
Received September 29, 1998;
accepted January 2, 1999.
| |
ABBREVIATIONS |
Abbreviations:
LD, long day.
SD, short day.
| |
ACKNOWLEDGMENTS |
The authors would like to thank Drs. Peter Chandler, Lloyd
Evans, Jake Jacobsen, and Masumi Robertson for their helpful comments during the preparation of this manuscript. Greg Gocal would like to
thank those at the Australian National University and CSIRO who were so
helpful during the course of his Ph.D.
| |
LITERATURE CITED |
Blázquez MA,
Green R,
Nilsson O,
Sussman MR,
Weigel D
(1998)
Gibberellins promote flowering of Arabidopsis by activating the LEAFY promoter.
Plant Cell
10:
791-800
[Abstract/Free Full Text]
Blázquez MA,
Soowal LN,
Lee I,
Weigel D
(1997)
LEAFY expression and flower initiation in Arabidopsis.
Development
124:
3835-3844
[Abstract]
Dellaporta SL,
Wood J,
Hicks JB
(1983)
A plant DNA minipreparation: version II.
Plant Mol Biol Rep
1:
19-21
Devereux J,
Haeberli P,
Smithies O
(1984)
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res
12:
387-395
Evans LT, King RW (1985) Lolium temulentum L. In AH Halevy, ed, CRC Handbook of Flowering, Vol III. CRC
Press, Boca Raton, FL, pp 306-323
Evans LT,
King RW,
Chu A,
Mander LN,
Pharis RP
(1990)
Gibberellin structure and florigenic activity in Lolium temulentum, a long-day plant.
Planta
182:
97-106
Evans LT,
King RW,
Mander LN,
Pharis RP,
Duncan KA
(1994)
The differential effects of C-16,17 dihydro gibberellins and related compounds on stem elongation and flowering in Lolium temulentum.
Planta
193:
107-114
Gaskin P, MacMillan J (1991) GC-MS of Gibberellins and Related
Compounds: Methodology and a Library of Spectra. Cantocks Enterprises,
University of Bristol, UK
Gerlach WL,
Bedbrook JR
(1979)
. Cloning and characterization of ribosomal RNA genes from wheat and barley.
Nucleic Acids Res
7:
1869-1885
[Abstract/Free Full Text]
Gilmour SJ,
Zeevaart JAD,
Schwenen L,
Graebe JE
(1986)
Gibberellin metabolism in cell-free extracts from spinach leaves in relation to photoperiod.
Plant Physiol
82:
190-195
[Abstract/Free Full Text]
Gocal GFW (1997) Molecular biology of floral evocation in
Lolium temulentum. PhD thesis. Australian National
University, Canberra
Graebe JE
(1987)
Gibberellin biosynthesis and control.
Annu Rev Plant Physiol
38:
419-465
[CrossRef][ISI]
Green LS,
Mosleth Færgestad E,
Poole A,
Chandler PM
(1997)
Grain developmental mutants of barley -amylase production during grain maturation and its relation to endogenous gibberellic acid content.
Plant Physiol
114:
203-212
[Abstract]
Gubler F,
Kalla R,
Roberts JK,
Jacobsen JV
(1995)
Gibberellin-regulated expression of a MYB gene in barley aleurone cells: evidence for MYB transactivation of a high-pI -amylase gene promoter.
Plant Cell
7:
1879-1891
[Abstract]
Gubler F,
Watts RJ,
Kalla R,
Matthews P,
Keys M,
Jacobsen JV
(1997)
Cloning of a rice cDNA encoding a transcription factor homologous to barley GAMYB.
Plant Cell Physiol
38:
362-365
[Abstract/Free Full Text]
Halliday KJ,
Devlin PF,
Whitelam GC,
Hanhart CJ,
Koornneef M
(1996)
The ELONGATED gene of Arabidopsis acts independently of light and gibberellins in the control of elongation growth.
Plant J
9:
305-312
[Medline]
Jackson D,
Culianez-Macia F,
Prescott AG,
Roberts K,
Martin C
(1991)
Expression patterns of myb genes from Antirrhinum flowers.
Plant Cell
3:
115-125
[Abstract/Free Full Text]
Jacobsen SE,
Binkowski KA,
Olszewski NE
(1996)
SPINDLY, a tetratricopeptide repeat protein involved in gibberellin signal transduction in Arabidopsis.
Proc Natl Acad Sci USA
93:
9292-9296
[Abstract/Free Full Text]
Jacobsen SE,
Olszewski NE
(1993)
Mutations at the SPINDLY locus of Arabidopsis alter gibberellin signal transduction.
Plant Cell
5:
887-896
[Abstract/Free Full Text]
Junttila O,
Heide OM,
Lindgard B,
Ernstsen A
(1997)
Gibberellins and the photoperiodic control of leaf growth in Poa pratensis.
Physiol Plant
101:
599-605
[CrossRef]
Kaufman PB,
Ghosheh NS,
Nakosteen L
(1976)
Analysis of native gibberellins in internode, nodes, leaves and inflorescence of developing Avena plants.
Plant Physiol
58:
131-134
[Abstract/Free Full Text]
King RW,
Blundell C,
Evans LT
(1993)
The behaviour of shoot apices of Lolium temulentum in vitro as the basis of an assay system for florigenic extracts.
Aust J Plant Physiol
20:
337-348
Lang A
(1965)
Physiology of flower initiation.
In
W Ruhland,
eds, Encyclopedia of Plant Physiology, Vol 15/1.
Springer-Verlag, Berlin, pp 1380-1536
Nicholls PB (1974) The effect of daylength on the development of
the barley inflorescence and the endogenous gibberellin concentration.
Bulletin 12. In RL Bieleski, AR Ferguson, MM Cresswell, eds,
Mechanisms of Regulation of Plant Growth. The Royal Society of New
Zealand, Wellington, pp 305-309
Noda K-I,
Glover BJ,
Linstead P,
Martin C
(1994)
Flower colour intensity depends on specialized cell shape controlled by a Myb-related transcription factor.
Nature
369:
661-664
[CrossRef][Medline]
Okamuro JK,
den Boer BGW,
Lotys-Prass C,
Szeto W,
Jofuku KD
(1996)
Flowers into shoots: photo and hormonal control of a meristem identity switch in Arabidopsis.
Proc Natl Acad Sci USA
93:
13381-13386
Osada A,
Suge H,
Shibukawa S,
Noguchi I
(1973)
Changes of endogenous gibberellins in rice plants as affected by growth stage and different growth conditions.
Proc Crop Sci Soc Jpn
42:
41-45
Pharis RP,
Evans LT,
King RW,
Mander LN
(1987)
Gibberellins, endogenous and applied, in relation to flower induction in the long-day plant Lolium temulentum.
Plant Physiol
84:
1132-1138
[Abstract/Free Full Text]
Sawhney VK
(1992)
Floral mutants in tomato: development, physiology, and evolutionary implications.
Can J Bot
70:
701-707
Schuurinck RC,
Vain PV,
Jones RL
(1996)
Modulation of calmodulin mRNA and protein levels in barley aleurone.
Plant Physiol
111:
371-380
[Abstract]
Talon M,
Zeevaart JAD
(1990)
Gibberellins and stem growth as related to photoperiod in Silene armeria L.
Plant Physiol
92:
227-235
[Abstract/Free Full Text]
Wilson RN,
Heckman JW,
Somerville CR
(1992)
Gibberellin is required for flowering in Arabidopsis thaliana under short days.
Plant Physiol
100:
403-408
[Abstract/Free Full Text]
Wu K,
Li L,
Gage DA,
Zeevaart JAD
(1996)
Molecular cloning and photoperiod-regulated expression of gibberellin 20-oxidase from the long-day plant spinach.
Plant Physiol
110:
547-554
[Abstract]
Zeevaart JAD
(1971)
Effects of photoperiod on growth rate and endogenous gibberellins in the long-day rosette plant spinach.
Plant Physiol
47:
821-827
[Abstract/Free Full Text]
Zeevaart JAD,
Gage DA
(1993)
ent-Kaurene biosynthesis is enhanced by long photoperiods in the long-day plants Spinacia oleracea L. and Agrostemma githago L.
Plant Physiol
101:
25-29
[Abstract]
This article has been cited by other articles:
|
|
|
|
 
R. W. King, L. N. Mander, T. Asp, C. P. MacMillan, C. A. Blundell, and L. T. Evans
Selective Deactivation of Gibberellins below the Shoot Apex is Critical to Flowering but Not to Stem Elongation of Lolium
Mol Plant,
March 1, 2008;
1(2):
295 - 307.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. W. King, T. Moritz, L. T. Evans, J. Martin, C. H. Andersen, C. Blundell, I. Kardailsky, and P. M. Chandler
Regulation of Flowering in the Long-Day Grass Lolium temulentum by Gibberellins and the FLOWERING LOCUS T Gene
Plant Physiology,
June 1, 2006;
141(2):
498 - 507.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. P. MacMillan, C. A. Blundell, and R. W. King
Flowering of the Grass Lolium perenne. Effects of Vernalization and Long Days on Gibberellin Biosynthesis and Signaling
Plant Physiology,
July 1, 2005;
138(3):
1794 - 1806.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. A. Millar and F. Gubler
The Arabidopsis GAMYB-Like Genes, MYB33 and MYB65, Are MicroRNA-Regulated Genes That Redundantly Facilitate Anther Development
PLANT CELL,
March 1, 2005;
17(3):
705 - 721.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. M. Swain, D. P. Singh, C. A. Helliwell, and A. T. Poole
Plants with Increased Expression of ent-Kaurene Oxidase are Resistant to Chemical Inhibitors of this Gibberellin Biosynthesis Enzyme
Plant Cell Physiol.,
February 1, 2005;
46(2):
284 - 291.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Jia, M. T. Clegg, and T. Jiang
Evolutionary Dynamics of the DNA-Binding Domains in Putative R2R3-MYB Genes Identified from Rice Subspecies indica and japonica Genomes
Plant Physiology,
February 1, 2004;
134(2):
575 - 585.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kaneko, Y. Inukai, M. Ueguchi-Tanaka, H. Itoh, T. Izawa, Y. Kobayashi, T. Hattori, A. Miyao, H. Hirochika, M. Ashikari, et al.
Loss-of-Function Mutations of the Rice GAMYB Gene Impair {alpha}-Amylase Expression in Aleurone and Flower Development
PLANT CELL,
January 1, 2004;
16(1):
33 - 44.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Washio
Functional Dissections between GAMYB and Dof Transcription Factors Suggest a Role for Protein-Protein Associations in the Gibberellin-Mediated Expression of the RAmy1A Gene in the Rice Aleurone
Plant Physiology,
October 1, 2003;
133(2):
850 - 863.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. P. Singh, A. M. Jermakow, and S. M. Swain
Gibberellins Are Required for Seed Development and Pollen Tube Growth in Arabidopsis
PLANT CELL,
December 1, 2002;
14(12):
3133 - 3147.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. F.W. Gocal, C. C. Sheldon, F. Gubler, T. Moritz, D. J. Bagnall, C. P. MacMillan, S. F. Li, R. W. Parish, E. S. Dennis, D. Weigel, et al.
GAMYB-like Genes, Flowering, and Gibberellin Signaling in Arabidopsis
Plant Physiology,
December 1, 2001;
127(4):
1682 - 1693.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. W. King, T. Moritz, L. T. Evans, O. Junttila, and A. J. Herlt
Long-Day Induction of Flowering in Lolium temulentum Involves Sequential Increases in Specific Gibberellins at the Shoot Apex
Plant Physiology,
October 1, 2001;
127(2):
624 - 632.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. W. King and Y. Ben-Tal
A Florigenic Effect of Sucrose in Fuchsia hybrida Is Blocked by Gibberellin-Induced Assimilate Competition
Plant Physiology,
January 1, 2001;
125(1):
488 - 496.
[Abstract]
[Full Text]
|
|
|
|
Top
Abstract
Introduction