Plant Physiol. (1999) 120: 65-72
The AG Dinucleotide Terminating Introns Is Important but Not
Always Required for Pre-mRNA Splicing in the
Maize
Endosperm1
Shailesh Lal2,
Jae-Hyuk Choi2, and
L. Curtis Hannah*
Program in Plant Molecular and Cellular Biology and Horticultural
Sciences, 1143 Fifield Hall, P.O. Box 110690, University of
Florida, Gainesville, Florida 32611-0690
 |
ABSTRACT |
Previous
RNA analysis of lesions within the 15 intron-containing
Sh2
(shrunken2)
gene of maize (Zea mays) revealed that the majority of
these mutants affect RNA splicing. Here we decipher further two of
these mutants, sh2-i
(shrunken2 intermediate phenotype) and
sh2-7460. Each harbors a G-to-A
transition in the terminal nucleotide of an intron, hence destroying
the invariant AG found at the terminus of virtually all nuclear
introns. Consequences of the mutations, however, differ dramatically.
In sh2-i the mutant site is recognized as
an authentic splice site in approximately 10% of the primary
transcripts processed in the maize endosperm. The other transcripts
exhibited exon skipping and lacked exon 3. A G-to-A transition in the
terminus of an intron was also found in the mutant
sh2-7460, in this case intron 12. The
lesion activates a cryptic acceptor site downstream 22 bp within exon
13. In addition, approximately 50% of
sh2-7460 transcripts contain intron 2 and
3 sequences.
 |
INTRODUCTION |
Although introns in nuclear genes are ubiquitous in nature, the
signals required to define precisely and to recognize exon-intron borders are not fully understood. Studies from all eukaryotes suggest
that splicing is essentially a two-step cleavage-ligation reaction. The
first step involves the cleavage at the 5
-splice site that leads to
the formation of an intron lariat with the adenosine residue of the
branch point sequence located upstream of the 3
-splice site. This step
is followed by the ligation of the exon and by the release of the
intron lariat (Moore and Sharp, 1993
; Brown, 1996
; Simpson and
Filipowicz, 1996
). This complex set of events is carried out by
pre-mRNA association with a conglomeration of small nRNAs and nuclear
proteins that forms a dynamic, large ribonucleosome protein complex
termed a spliceosome (for review, see Moore et al., 1993
; Sharp, 1994
).
This fundamental process, common to all eukaryotic gene expression, can
have a diverse impact on the regulation of gene expression. For
example, imprecise or inaccurate pre-mRNA splicing often imparts a
mutant phenotype (for review, see Weil and Wessler, 1991
), whereas
alternative splicing is sometimes important in the regulation of gene
expression (Gorlach et al., 1995
; Golovkin and Reddy, 1996; Nishihama
et al., 1997
). Certain introns dramatically enhance gene expression in
transient and stably transformed callus tissue
(Callis et al., 1987
; Vasil et al., 1989
; Clancy et al., 1994
).
Finally, intron splicing is required for some plant viruses to be
pathogenic (Kiss-Laszlo et al., 1992
).
Unlike yeast and vertebrates, the lack of a plant in vitro system
capable of efficiently splicing introns has hindered our understanding
of the mechanism of splicing in plants. Despite the universal nature of
the splicing pathway, primary transcripts of animal origin are not
efficiently or accurately spliced in plant cells. Conversely, the
majority of plant pre-mRNAs are not faithfully spliced in animal cells
(Barta et al., 1986
; van Santen and Spritz, 1987
; Wiebauer et al.,
1988
; Pautot et al., 1989
; Waigmann and Barta, 1992
). This species
barrier between the heterologous splicing of pre-mRNA is also observed
between monocots and dicots. Some monocot introns are not spliced in
dicots (Keith and Chua, 1986
; Goodall and Filipowicz, 1991
). In
contrast, introns of dicot origin are efficiently spliced in monocots,
suggesting that monocot-splicing machinery is more flexible or complex.
There are also fundamental structural/sequence differences that
differentiate plant introns from those of vertebrate and yeast introns
(Goodall and Filipowicz, 1991
; for review, see Simpson and Filipowicz,
1996
). Vertebrate introns possess a polypyrimidine track that is not
found in plant introns (Simpson et al., 1996
).
Branch points have recently been mapped in plants, the consensus of
which is similar to that of the vertebrates (Liu and Filipowicz, 1996
; Simpson et al., 1996
; for review, see Brown, 1998
). A
feature distinguishing plant introns from those of other organisms is their AU richness. This has been indicated to be essential for intron
processing and for definition of the intron/exon junction (Goodall
and Filipowicz, 1989
; Lou et al., 1993
; McCullough et al., 1993
;
Carle-Urioste et al., 1994
; Luehrsen and Walbot, 1994
; Gniadkowski et
al., 1996
). It is interesting that the requirements of the AU-rich
region are more stringent in dicots than in monocots (Goodall and
Filipowicz, 1991
), and some monocot introns are GC rich.
Here we describe two mutants of the sh2
(shrunken2)
gene of maize (Zea mays) that affect RNA splicing.
Sh2 encodes the large subunit of a heterotetrameric enzyme,
AGP, a key regulatory enzyme in the starch biosynthetic pathway. Null sh2 mutants cause the dramatic reduction of the
starch content in maize kernels that leads to a collapsed, brittle, or
shrunken phenotype (Tsai and Nelson, 1966
). Previous analysis of the
various sh2 mutants revealed that each of these mutants
produced multiple transcripts or transcripts of a non-wild-type size.
Because Sh2 contains 15 introns, northern analyses suggest
that the primary lesion of many mutants occurs at RNA processing
(Giroux and Hannah, 1994
). To characterize further the molecular events
underlying the mutational lesion of two of these mutants,
sh2-i
(shrunken2 intermediate phenotype) and
sh2-7460, mutant transcripts and genomic DNA were
isolated, cloned, sequenced, and expressed in Escherichia
coli and in maize tissue culture cells.
To our knowledge, the results of these studies reveal a number of
features of pre-RNA processing not yet reported in plants. Namely, we
show that, although the AG dinucleotide terminating a nuclear intron is
important for splicing, it is not always essential. We note exon
skipping, a phenomenon commonly found in vertebrates. We also report a
case of improper splicing of two adjacent introns. These latter two
phenomena are hallmarks of the exon definition of pre-RNA splicing.
 |
MATERIALS AND METHODS |
Plant Materials
The maize (Zea mays) mutants
sh2-i and sh2-7460 were
kindly provided by Dr. M.G. Nueffer and Dr. Oliver Nelson and have been described elsewhere (Hannah et al., 1980
; Giroux and Hannah, 1994
). The
wild-type Sh2 allele used here was isolated from
McClintock's a1-m3 stock (Giroux et al., 1996
).
Plants were maintained and grown in the greenhouse or in the field at
the University of Florida, Gainesville.
RNA and Genomic DNA Isolation
Total RNA from the 20- to 22-d postpollination kernels and leaf
genomic DNA were isolated as described previously (McCarty, 1986
;
Giroux et al., 1994
). RNA from suspension cells was extracted using
TRIZOL reagent (Life Technologies) according to the protocol of the
manufacturer. Northern analysis was performed as described by Maniatis
et al. (1993)
. Band intensities were measured by a digital imaging
system (model IS-1000, Alpha Innotech Corp., San Leandro, CA).
PCR Amplification and Cloning
RT-PCR was used to synthesize the full-length cDNA clones of the
sh2-i and sh2-7460 alleles by using a reverse
transcriptase kit (Superscript, Life Technologies). First-strand cDNA
synthesis was primed with oligo(dT) primer from developing maize
endosperm total RNA, and full-length clones were isolated by use of the primers SH2FO.1
(5
-CAAGATCACGTCGACAGGCAAGTG-3
) and SH2.3
(5
-GGTTTGCTGCAGC TTCTAGGGC-3
). These are complementary to the 5
- and
3
-nontranslated regions of Sh2 cDNA, respectively.
Underlined sequences contain modified bases to incorporate restriction
sites for SalI and PstI. The restriction sites
were used to subsequently clone the amplified fragment into the
corresponding restriction site of vector pBluescript KS+.
To amplify cDNA-spanning exons 1 to 4 from
sh2-i, primers SH2F0.1 and SH2R0.1
(5
-GCCTGTAACATCCTCCTGCAGGT-3
) were used. The resulting products were
separated on a 1% agarose gel and alkaline transferred onto a membrane
(Hybond H+, Amersham), according to the protocol
provided by the manufacturer. This blot was first probed with an exon
3-specific probe, according to the procedure described by Church and
Gilbert (1984)
. The exon 3-specific probe was generated by PCR
amplification of Sh2 cDNA using primers SH2LHS1
(5
-CATTCTCAAACACAGTCGACTAG-3
) and SH2LHSR (5
-AGCAGGCGCAGCTCTAG-3
).
The blot was then washed twice with 2× SSPE/0.1%SDS and
0.2× SSPE/0.1%SDS at 65°C for 20 min and then subjected to
overnight exposure to x-ray film to monitor the efficacy of probe
removal. It was then probed with full-length Sh2 cDNA. Resulting autoradiograms were quantified by a phosphor imager (Molecular Dynamics, Sunnyvale, CA) or with a digital imaging system
(model IS-1000).
Genomic sequences from exons 1 to 4 were amplified using primers
SH2FO.1 and SH2RO.1
(5
-GCCTGTAACATCCTCCTGCAGGT-3
) using leaf DNA as the
template. Similarly, exons 7 to 14 of mutant
sh2-7460 were amplified using primers, SHLH872
(5
-ACATGTCGACGATGCTGCTG CTATC-3
) and SHLH871R
(5
-GAGTTCACCTGCAGA GCTGAC-3
). Resulting fragments were cloned into pBluescript KS+ or pUC19. DNA
sequencing was done at the University of Florida DNA Sequencing Core
Laboratory (Gainesville), using the ABI Prism Dye Terminator
sequencing protocol (Applied Biosystems). DNA sequences derived from
the mutants were compared with the Sh2 sequence (Shaw and
Hannah, 1992
) using DNA analysis software (Lasergene, DNASTAR,
Madison, WI).
Bacterial Expression of AGP
The Escherichia coli expression (Iglesias et al., 1993
)
was used to monitor sh2-i and
sh2-7460 transcripts for functional AGP activity.
The full-length Sh2 transcript from wild type, the smaller
transcript of mutant sh2-i, and the
wild-type-size transcript of sh2-7460 were RT-PCR
amplified using primers LH377 (5
-GGGGCCATGGCCCAG TTTGCACTTGCATTGGACGACA CG-3
) and LH396 (5
-
CCCCGAGCTCACTATATGACAGACCCATCGTTGATGG) as described earlier and
cloned into the NcoI and SstI restriction sites
of bacterial expression vector pMSH (Iglesias et al., 1993
). Resulting
clones are termed pSHW, pMSHi, and pMSH7460, respectively. The low
abundance of the larger sh2-i transcript
and its close proximity after electrophoresis to the more abundant,
smaller transcript made it difficult to effectively resolve the DNA
bands. Hence, the region from exon 1 to exon 7 of
sh2-i transcripts was amplified using primers
LH377 and SH796R (5
-CTCTCATCAACA GGAGCA C-3
). This allowed for a
definitive resolution of fragments of approximately 600 and 700 bp on
the 1% agarose gel. The larger fragment of approximately 700 bp of
mutant sh2-i was eluted from the gel, digested
with NcoI and XhoI, and cloned into the
corresponding site of pMSHi replacing the corresponding sequence in the
smaller transcript, giving rise to pMSHWi. Constructs were separately transformed into an E. coli strain AC70R-504, which lacks
endogenous AGP activity but harbors the Bt2 gene on the
compatible vector described by Giroux et al. (1996)
. Transformed cells
were grown for 16 h on Luria-Bertani-medium plates containing 1%
Glc and then iodine stained to monitor AGP activity as described
earlier (Iglesias et al., 1993
; Greene et al., 1996
).
Particle Bombardment and Expression Vectors
Maize cell line PC5, established from the mesocotyl tissue of
germinating seed (Chourey and Zurawski, 1981
), was cultured in a liquid
Murashige and Skoog medium supplemented with 2 mg/L 2,4-D. Cells were
grown in the dark at 27°C on a shaker at 150 rpm and were routinely
subcultured at 7-d intervals. After 3 d of subculture,
approximately 2 mL of cells was transferred onto a filter disc
(Whatman) for particle bombardment. The disc was placed on a Petri
plate containing Murashige and Skoog-agarose medium and used
immediately as a target for the particle bombardment. Preparation of
the DNA/gold mixture and the parameters for bombardment were previously
described (Taylor and Vasil, 1991
). The Biolistic Particle
Delivery System (model PDS-1000/HE, Bio-Rad) was used for
bombardment. Cells were harvested 22 h postbombardment, frozen in
liquid N2, and stored at
70°C for further
analysis.
Exons 2 to 4 were isolated from 1 µg of leaf genomic DNA from the
wild type and sh2-i by 30 cycles of PCR
amplification using primers SH2F0.1 and SH2R0.1. Resulting 1.6-kb
fragments were blunt ended with Pfu polymerase (New England
Biolabs) and ligated into the solitary EcoRV site present in
the luciferase-coding region of the plant expression vector pAHC18,
kindly provided by Dr. Peter Quail (Christensen and Quail, 1996
).
Resulting constructs were expressed in maize suspension cells as
described earlier. Total RNA extracted from the cells was treated with
amplification grade DNase I (BRL) and subjected to RT-PCR using primers
LucLo.Pr2 (5
-CCCGGTTTTAATGAATACGT-3
) and LucUp.Pr2
(5
-CCGTGCTCCAAAACAACAA-3
), which flanked the insertion. The resulting
PCR fragments were blotted and probed with the luciferase-coding region
of pAHC18 as described earlier. The fragments were eluted from the gel
and directly sequenced.
 |
RESULTS |
Origin of AGP Activity in the Mutant sh2-i
The mutant sh2-i, which was generously
supplied by Dr. M.G. Neuffer (University of Missouri, Columbia), was
generated by ethyl methanesulfonate mutagenesis and conditions an
intermediate or leaky phenotype in comparison to virtually all other
sh2 mutant alleles. Giroux and Hannah (1994)
showed that
this mutant produced a major transcript and protein smaller than those
found in the wild type. To determine whether the detected diminutive
SH2 protein conditioned AGP activity in sh2-i,
the small transcript of sh2-i was cloned.
Sequencing revealed that this transcript lacked exon 3. Exon 3 is a
multiple of 3 (123 bp) in length; therefore, deletion of this exon
maintains translational continuity. Conservation of the reading frame
combined with the fact that initiation of translation begins in
exon 2 (Shaw and Hannah, 1992
) caused us to consider the
possibility that this mutant SH2 protein conditioned the partial AGP
activity of sh2-i.
Accordingly, this transcript was cloned and coexpressed with the
wild-type Bt2
(Brittle2)
gene in an E. coli mutant lacking the endogenous bacterial
AGP, glg-C gene (Igleasias et al., 1993). Expression of wild-type
Sh2 and Bt2 genes (Fig.
1) complemented the E. coli
mutant giving rise to glycogen, which can be visualized easily by
exposure to iodine vapors. In contrast, expression of the abbreviated
sh2-i transcript (Fig. 1, pMSH-i/pMBT-W) did not
complement the glg-C mutant. Because mutants with less than 3%
wild-type activity give rise to some staining (S. Lal, J.-H. Choi, and
L.C. Hannah, unpublished data), we have concluded that this
sh2-i transcript probably does not underlie the
leaky kernel phenotype. Furthermore, the lack of enzymatic activity
encoded by the small transcript has been predicted from the recent
findings that the completely conserved, exon 3-encoded motif PAV is
critical for enzymatic activity in potato (Greene et al., 1996
) and in
E. coli (Meyer et al., 1993
). We have concluded from these
experiments that the truncated sh2-i transcript
does not encode the AGP activity encountered in this mutant and that an
additional source of AGP must condition the leaky phenotype of this
mutant.

View larger version (124K):
[in this window]
[in a new window]
| Figure 1.
Expression of maize endosperm AGP in E. coli. The full-length wild-type transcript Sh2,
the wild-type-size transcript of mutants
sh2-i
(sh2-iw) and
sh2-7460, and the smaller transcript of
sh2-i were expressed with
Bt2 in an E. coli strain deficient in the
endogenous AGP gene. Complementation of the glg-C E. coli mutant resulting in glycogen synthesis was visualized by
iodine staining.
|
|
Therefore, we analyzed whether the sh2-i primary
transcript undergoes multiple splicing events possibly giving rise to
other less-abundant, mature transcripts containing exon 3. RT-PCR
analysis was performed on oligo(dT)-primed first-strand cDNA from
wild-type and sh2-i developing endosperm
poly(A+) RNA using primers flanking exons 1 to 4. A less-abundant, wild-type-size PCR product from
sh2-i (Fig. 2A,
left, lane 2) was observed. This fragment hybridized to a full-length
Sh2 cDNA probe (Fig. 2A, center, lane 2) and to a probe
specific to exon 3 (Fig. 2A, right, lane 2) As judged by digital
imaging, this fragment makes up approximately 10% of the total
Sh2 transcript. Furthermore, quantitative analysis of RNA
blots probed with exon 3 suggests that this transcript makes up 5% to
10% of the total transcript.

View larger version (37K):
[in this window]
[in a new window]
| Figure 2.
RT-PCR analysis of mutant
sh2-i and
sh2-7460 transcripts. A, Total endosperm
RNA from the wild type and that from the mutants
sh2-i and
sh2-7460 were subjected to RT-PCR using
primers spanning exons 1 to 4 of the Sh2 transcript. The
left panel depicts the resultant RT-PCR products resolved on a 1%
agarose gel and stained with ethidium bromide. Lanes 1, 2, and 3 represent the RT-PCR product derived from Sh2 and the
mutants sh2-i and
sh2-7460, respectively. The center and
right panels are DNA blots of the agarose gel probed with radiolabeled
full-length Sh2 cDNA and Sh2 exon
3-specific probes, respectively. B, Schematic structure of the RT-PCR
products derived from the mutants sh2-i
and sh2-7460 and the wild-type
Sh2 transcripts, as shown in A. Transcript sources are
labeled at the left side of the panel; the numbers on the right give
the size and the relative proportion (in percentages) of each
transcript in the mutant endosperm. Arrows represent primers used for
PCR amplification. Exons are represented by boxes, and the intronic
sequences that remained in the mutant
sh2-7460 transcript are marked by a thick
line. Asterisks indicate that these transcripts contain a 22-bp
deletion of a downstream exon 13 sequence.
|
|
Full-length clones making up the larger transcript of
sh2-i were isolated by PCR, sequenced, and
expressed in E. coli. Sequencing showed that this transcript
contains a completely wild-type exon 3 that perfectly abuts exons 2 and
4 (Fig. 2B). Expression of this transcript leads to a functional AGP
(Fig. 1, top right). We have concluded that the low levels of AGP
activity found in sh2-i arise from this
less-abundant transcript.
Because two transcripts arise from one mutant gene, the
sh2-i pre-RNA must undergo multiple splicing
events. Primers spanning exons 1 to 4 were used to isolate
sh2-i genomic DNA. Sequencing revealed that
sh2-i harbors a G-to-A transition at the terminus of intron 2 (Fig. 3). Hence, loss of a
wild-type splice site at the terminus of intron 2 leads to the skipping
of exon 3 in approximately 90% of the processed transcripts. In these
cases, splicing occurs between the donor site of intron 2 and the
acceptor site of intron 3. In approximately 10% of the transcripts,
however, the intron 2 acceptor site functions in splicing, although it
lacks the invariant AG terminus.

View larger version (24K):
[in this window]
[in a new window]
| Figure 3.
Schematic representation of the genomic sequence
bearing the splice-site alterations of mutants
sh2-i (exons 2-4) and
sh2-7460 (exon 11-13 [A]) and (exon
2-4 [B]). The point mutations that altered the 3 -splice site
AG to AA of intron 2 in mutant
sh2-i and intron 12 of mutant
sh2-7460 are boxed. Arrows joined by
lines mark the donor and acceptor sites used during RNA splicing to
generate the mutant transcripts.
|
|
Whereas the mutated 3
-splice site of intron 2 functions as an acceptor
site in the maize endosperm, this variant splice site lacks function
when this portion of Sh2 is expressed in cultured maize
cells. Exons 2 to 4 of the wild type and sh2-i
were cloned into the lone EcoRV site within the
luciferase-coding region of the plant expression vector AHC18
(Christensen and Quail, 1996
). These recombinant constructs and AHC18
were separately introduced into the maize suspension cell line PC5 via
particle bombardment. Total RNA extracted from these cells was analyzed
by RT-PCR using primers flanking the adjacent luciferase-coding region
of AHC18. Resulting DNA was electrophoresed, blotted, and probed with
the luciferase-coding region (Fig. 4). A
single fragment of 981 bp was amplified from cells expressing the
wild-type Sh2 gene. Sequencing revealed that this fragment
lacked introns 2 and 3, which was expected if Sh2 pre-RNA
splice signals are recognized in the cultured cells as they are in the
maize endosperm. In contrast, the
sh2-i-containing construct produced a single,
highly abundant transcript of 858 bp. From sequencing, this transcript
lacked exon 3. Therefore, whereas the AA terminus of intron 2 is
recognized in the maize endosperm, we find no evidence that this can
also function in this genic context in maize tissue culture cells.

View larger version (22K):
[in this window]
[in a new window]
| Figure 4.
Expression of Sh2 transcripts in
maize suspension cells. A, Southern blot of RT-PCR products amplified
using primers specific to the luciferase-coding region. These products
were detected with the luciferase-coding region after expression of
exons 2 to 4 from Sh2 and the mutant
sh2-i cloned into the luciferase-coding
region of the expression vector AHC18 and were transiently expressed in
maize suspension cells using particle bombardment. B, Top, Represents
the genomic construct cloned into the luciferase (lux)-coding region of
the vector AHC18. Sh2 exons are marked by blank boxes,
whereas introns are depicted by a line. The hatched boxes represent the
flanking luciferase-coding sequences. Arrows represent the primers used
in the RT-PCR reaction. The construct source is labeled at the top of
each panel. Structures of the various constructs were determined by
cloning and sequencing.
|
|
The Mutant sh2-7460 also Contains a G-to-A
Mutation at an Intron Acceptor Site
Giroux and Hannah (1994)
showed that the mutation
sh2-7460 produces two transcripts, pointing to an
alteration in RNA splicing. RT-PCR was used to isolate full-length
clones from the two transcripts. Sequencing of these transcripts
identified three alterations in RNA splicing. Both transcripts lacked
the first 22 bp of exon 13. In addition, the larger transcript
contained 15 bp of the distal portion of intron 2 and all of intron 3 (Fig. 2A, lanes 3), which lead to a shift in the reading frame and a
proximal chain-termination codon. From sequencing, we concluded that a premature chain-termination mutation was created in exon 13 of the
wild-type-size transcript and, as expected, that this transcript does
not condition AGP activity (Fig. 1, lower left).
To precisely define the mutation underlying the complex splicing
pattern exhibited by sh2-7460, genomic DNA
corresponding to the altered spliced sites was amplified and cloned. A
G-to-A transition at the terminus of intron 12 was detected, which
provided a ready explanation for the loss of function of the intron 12 acceptor site. Here an AG in the AU-rich proximal region of exon 13 was
activated and used as an acceptor site. Unlike the situation with
sh2-i, we found no evidence for splicing of the
mutant A-terminating intron.
 |
DISCUSSION |
Wild-Type Transcripts Arise from Splicing of an AA-Terminating
Intron Giving Rise to the Leaky or Non-Null Phenotype of the Maize
Mutant sh2-i
Here we elucidated the mechanism underlying the residual activity
in the mutant sh2-i. The phenotype of mutant
sh2-i is quite leaky, and Giroux and Hannah
(1994)
speculated that a predominant but truncated protein observed in
this mutant might have partial enzymatic activity giving rise to the
leaky phenotype. Here we cloned the cognate transcript and showed that
the truncated protein is nonfunctional in an E. coli
expression system. In an attempt to elucidate the cause of the residual
activity, we found that, although this mutant has suffered a G-to-A
transition in the terminus of intron 2, the mutant splice site can
still be recognized and properly spliced, albeit in only approximately
10% of the primary transcripts. The low level of this wild-type
transcript causes the leaky phenotype of sh2-i.
Giroux et al. (1994)
noted that AGP activity, the product of the
Sh2 locus, from sh2-i is approximately 20% of the wild type, a value comparable with that found for the wild-type transcript from this mutant.
The presence of the wild-type Sh2 transcript in the mutant
sh2-i indicates that at low, physiologically
significant levels, the 3
-splice site of intron 2 is used although it
lacks the virtually invariant AG-terminating dinucleotide. To our
knowledge, this is the first report of a conventional nuclear intron
now terminating in AA being spliced in a plant system. This splicing
does not reflect a unique feature of Sh2 RNA splicing,
because an identical change in a latter intron in the
sh2-7460 mutation abolishes splicing at that
position. Hence, this splicing is context dependent. Context dependency
or tissue dependency is also evident, because we cannot detect intron 2 splicing of sh2-i when exons 2 to 4 of this
mutant are expressed in a maize tissue culture system.
This observation is intriguing because the terminal AG of nuclear
introns is considered invariant in many diverse species, including
plants. This dinucleotide is likely associated with the binding of U5
small nuclear ribonucleoprotein particles, one of the major
subunits of spliceosomes, and represents an essential step in
RNA processing (Brown, 1996
). Furthermore, the terminal G is
important for the second step of splicing in yeast (Parker and
Siliciano, 1993
). Mutations altering the terminal AG abolish splicing
and sometimes activate nearby, downstream cryptic acceptor sites
(Kiss-Laszlo et al., 1992
; Lou et al., 1993
; Parker and Siliciano,
1993
; Carle-Urioste et al., 1994
; Simpson and Filipowicz, 1996
; Simpson
et al., 1996
). Several cases of a G-to-A transition at the 3
-splice
site have been reported in Arabidopsis floral homeotic genes
ag-1, ag-4, and
ap1-1 (Yanofsky et al., 1990
; Mandel et al.,
1992
; Sieburth et al., 1995
); the spy-2 gene
associated with GA signal transduction (Jacobsen et al., 1996
); the
tt4(2YY6) gene encoding chalcone synthase
(Burbulis et al., 1996
); the stm-3 homeotic gene
essential for meristem formation during embryogenesis (Long et al.,
1996
); and the cop1-1 essential regulatory gene for the photomorphogenic development of the plant (McNellis et al.,
1994
). These mutations completely abolish the recognition of the
acceptor site and result in inclusion of the intron in the processed
transcript (McNellis et al., 1994
), in exon skipping (Sieburth et al.,
1995
; Jacobsen et al., 1996
), or in activation of a cryptic acceptor
splice site in the adjacent exon (Sieberth et al., 1995; Burbulis et
al., 1996
).
Alterations in splicing caused by the intron terminal G-to-A transition
have been extensively documented in vertebrates (Krawczak et al.,
1992
). These alterations are the basis for Citrullinemia (Dunn
et al., 1989
), Tay Sachs disease (Arpaia et al., 1988
), and Fabry
disease (Okumiya et al., 1995
).
Whereas sh2-i splicing is the first report, to
our knowledge, of this type of splicing in a plant system, the use of
the dinucleotide AA in the acceptor site has been noted in other
systems. Two cases were reported in Caenorhabditis elegans
(Aroian et al., 1993
) and one was reported in swine (Brown et al.,
1994
). The 3
-splice-site mutation AG to AA functions at 2% of the
wild-type frequency in yeast (Parker and Siliciano, 1993
). Recently,
McCullough et al. (1996)
expressed a
-conglicinin intron construct
in tobacco nuclei and noted the use of a 3
AA splice site. However,
this splicing event also involved use of the nonconical 5
-splice site,
AU.
The G-to-A Transitions of the Terminal Nucleotides of
Introns 2 and 12 Have Drastically Different Effects on Pre-mRNA
Splicing
Mutant sh2-7460 contains an
AG-to-AA alteration of the 3
terminus of intron 12. Therefore, this
lesion is identical to that of sh2-i, except that
it resides in a different intron. In contrast to
sh2-i, this mutant site is not functional.
Rather, a cryptic 3
-splice site 22 bp downstream within exon 13 is
used as an acceptor. This divergence in consequence on splicing must
reflect a difference in sequence, context, or position within the gene.
These types of mutations in which the splicing apparatus uses a site
found in an exon as an acceptor site have been amply documented in
plant literature. We note that the 22 bp of exon 13 now included in the
intron of sh2-7460 are 73% AU rich. Contrast
between GC and AT richness has been indicated in splice-site selection
(Goodall and Filipowicz, 1989
; Lou et al., 1993
; McCullough et al.,
1993
; Simpson and Brown, 1993
; Luehrsen and Walbot, 1994
) that may aid in the selection of the cryptic splice site.
Mutant sh2-7460 Depicts a Complex Pattern of
Pre-mRNA Splicing
The larger transcript of sh2-7460 exhibits
abnormalities in the splicing of exons 2, 3, and 13. The former change
involves enclosure of the entire 282-bp intron 3 and 15 bp of the
distal portion of intron 2. Hence, the authentic 3
- splice site of
intron 2 is skipped in approximately 50% of the mature transcripts.
Coupled with this, the splicing of intron 3 does not occur.
Plant genes are rich in introns and their accurate recognition and
removal from the primary transcript is a complex process that may
involve sequences distant from the splice site, as might be the case
here. Mutations acting from a distance to affect splicing have been
found in mammalian systems and in Arabidopsis (McNellis et al., 1994
).
An insertion in intron 11 of the maize mutant
sh2-7527 results in the inclusion of intron 9 in
approximately 40% of the processed transcripts. This mutant is
identical in sequence to wild-type Sh2 from exons 6 to 11 (S. Lal and L.C. Hannah, unpublished data; Giroux and Hannah, 1994
).
There may be a global, three-dimensional nature of splicing, in which
the splicing of various introns in context to a particular gene is
interrelated. Whether the downstream mutation in intron 12 in
sh2-7460 affects the splicing of upstream exons
is being investigated.
These Mutations Provide Evidence for Both the Intron Definition and
the Exon Definition of Pre-RNA Splicing
Two theories account for the initial recognition of introns. In
exon definition of splicing, recognition of splice sites on each end of
a single exon occurs initially and is coordinated (Berget, 1995
).
Mutations that alter recognition at one end of the exon also alter
recognition at the other end of the same exon. In other words,
alteration in binding at the 5
-donor site also alters use of the
upstream 3
- acceptor site abutting the same exon. Recently, the
evidence for exon definition in plants was reported (Yi and Jack,
1998
). In contrast, in the intron definition of splicing, the initial
recognition is in the intron, probably at the branch point for lariat
formation. This is followed by scanning in the 3
direction for
detection of the first AG dinucleotide. This AG then defines the
acceptor site (for summary, see Luehrsen and Walbot [1994]).
The exon definition of splicing is attractive in animal systems where
introns can be quite large compared with the adjoining exons. This
model circumvents the need to scan the very large animal introns for
splice sites. This model predicts that mutations abolishing splicing at
one terminus of an exon also block splicing at the other terminus of
the same exon. The exon consequently is not recognized and is removed
during splicing, a phenomenon termed exon skipping. In support of this
model, 51% of more than 100 splice mutations in humans exhibited exon
skipping (Berget, 1995
). Although plant exon sequences influence
pre-mRNA splicing (Carle-Urioste et al., 1994
, 1997
), little evidence
favors the exon definition of splicing in plants (for review, see
Simpson and Filipowicz, 1996
).
The vast majority of the evidence from splice-site mutants in plants
favors the intron definition of splicing. In this regard, the splicing
pattern of exon 13 in sh2-7460 is easily
explained by the intron definition of splicing. The use of the first AG nucleotide downstream of the mutated site in
sh2-7460 is consistent with the scanning model,
beginning in the intron and proceeding 3
until the first AG is
encountered.
In contrast, the alteration found in sh2-i favors
the exon definition of splicing. Exon skipping, the hallmark of the
exon definition of splicing, occurs in 90% of the
sh2-i endosperm-splicing events and all of those
produced in maize tissue culture cells. Blockage of splicing at the 3
end of intron 2 apparently blocks splicing at the 5
end of intron 3 and results in total exclusion of exon 3 from the processed transcript.
Furthermore, the aberrations in the splicing of the two adjacent
introns (introns 2 and 3) in sh2-7460 endosperms
are in accord with the exon definition of splicing.
In summary, splicing of introns 2 and 3 of Sh2 transcripts
seemingly follows the exon definition of splicing, whereas splicing of
intron 12 of the same transcript is apparently in accord with the
intron definition of splicing. One possible explanation for this
paradox is that the critical factor in determining the mode of
recognition is the distance between adjacent splice sites. Those
sequences, whether exon or intron, separated by the shortest distance
between splice sites determine whether the exon or the intron
definition, respectively, is followed in splicing. We note that exon 3 of Sh2 is short (123 nucleotides) relative to the flanking
introns (476 and 284 nucleotides), whereas intron 12 is short (70 nucleotides) compared with the adjacent exons (87 and 105 nucleotides).
Berget (1995)
similarly noted this possibility in reference to
observations that increases in exon length in genes with short exons
and long introns or expanding introns in genes with short introns and
long exons led to aberrant splicing.
 |
FOOTNOTES |
1
This research was supported in part by the
National Science Foundation (grant nos. IBN-9316887 and MCB-9420422)
and by the U.S. Department of Agriculture Competitive Grants Program
(grant nos. 94-37300-453, 97-36306-4461, 95-37301-2080, and 98-01006). This is Florida Agricultural Experiment Station journal series no.
R-06349.
2
These authors contributed equally to the paper.
*
Corresponding author; e-mail hannah@gnv.ifas.ufl; fax
1-352-392-5653.
Received November 16, 1998;
accepted January 25, 1999.
 |
ABBREVIATIONS |
Abbreviations:
AGP, ADP-Glc pyrophosphorylase.
RT-PCR, reverse
transcription-PCR.
 |
ACKNOWLEDGMENTS |
We thank Dr. Gerry Neuffer for sh2-i, Dr.
Oliver Nelson for sh2-7460, Dr. Peter Quail for
the plant expression vector, and Dr. Prem Chourey for the maize tissue
culture cells. Synthesis of DNA primers and DNA sequencing were done in
the facilities of the Interdisciplinary Center for Biotechnology
Research at the University of Florida, Gainesville.
 |
LITERATURE CITED |
Aroian RV,
Levy AD,
Kago M,
Oshima Y,
Kramer JM,
Sternberg PW
(1993)
Splicing in Caenorhabditis elegans does not require an AG at the 3
splice acceptor site.
Mol Cell Biol
13:
626-637
[Abstract/Free Full Text]
Arpaia E,
Dumbrille-Ross A,
Maler T,
Neote K,
Tropak M,
Stirling JL,
Pitts JS,
Bapat B,
Lamhonwah AM
(1988)
Identification of an altered splice site in Ashkenazi Tay-Sachs disease.
Nature
333:
85-86
[CrossRef][Medline]
Barta A,
Sommergruber K,
Thompson D,
Harmuth K,
Matzke ME,
Matzke AJM
(1986)
The expression of nopaline synthase-human growth hormone chimeric gene in transformed tobacco and sunflower callus tissue.
Plant Mol Biol
6:
347-357
[CrossRef][Web of Science]
Berget SM
(1995)
Exon recognition in vertebrate splicing.
J Biol Chem
270:
2411-2414
[Free Full Text]
Brown JWS
(1996)
Arabidopsis intron mutations and pre-mRNA splicing.
Plant J
10:
771-780
[CrossRef][Web of Science][Medline]
Brown JWS
(1998)
Splice site selection in plant pre-mRNA splicing.
Annu Rev Plant Physiol Plant Mol Biol
49:
77-95
[CrossRef][Web of Science]
Brown WR,
Kacskovics I,
Amendt BA,
Blackmore NB,
Rothschild M,
Shinde R,
Butler JE
(1994)
The hinge deletion allelic variant of porcine IgA results from a mutation at the splice acceptor site in the first C
intron.
J Immunol
154:
3836-3842
[Abstract]
Burbulis IA,
Lacobucci M,
Shirley BW
(1996)
A null mutation in the first enzyme of flavonoid biosynthesis does not affect male fertility in Arabidopsis.
Plant Cell
8:
1013-1025
[Abstract]
Callis J,
Fromm M,
Walbot V
(1987)
Introns increase gene expression in cultured maize cells.
Genes Dev
1:
1183-1200
[Abstract/Free Full Text]
Carle-Urioste JC,
Brendel V,
Walbot V
(1997)
A combinational role for exon, intron and splice site sequences in splicing in maize.
Plant J
11:
1253-1263
[Medline]
Carle-Urioste JC,
Ko CH,
Bonito M,
Walbot V
(1994)
In vivo analysis of intron processing using splicing-dependent reporter gene assays.
Plant Mol Biol
26:
1785-1795
[Medline]
Chourey PS,
Zurawski D
(1981)
Callus formation from protoplasts of a maize cell culture.
Theor Appl Genet
59:
341-344
Christensen AH,
Quail PH
(1996)
Ubiquitin promoter-based vectors for high level expression of selectable and/or screenable marker genes in monocotyledonous plants.
Transgenic Res
5:
213-218
[CrossRef][Web of Science][Medline]
Church GM,
Gilbert W
(1984)
Genomic sequencing.
Proc Natl Acad Sci USA
81:
1991-1995
[Abstract/Free Full Text]
Clancy M,
Vasil V,
Hannah LC,
Vasil IK
(1994)
Maize shrunken1 intron and exon regions increase gene expression in maize protoplasts.
Plant Sci
98:
151-161
[CrossRef]
Dunn JM,
Phillips RA,
Zhu X,
Becker A,
Gallie BL
(1989)
Mutations in the RB1 gene and their affects on transcription.
Mol Cell Biol
9:
4596-4604
[Abstract/Free Full Text]
Giroux MJ,
Boyer C,
Feix G,
Hannah LC
(1994)
Coordinated transcriptional regulation of storage product genes in the maize endosperm.
Plant Physiol
106:
713-722
[Abstract]
Giroux MJ,
Hannah LC
(1994)
ADP-glucose pyrophosphorylase in shrunken2 and brittle2 mutants of maize.
Mol Gen Genet
243:
400-408
[Web of Science][Medline]
Giroux MJ,
Shaw GB,
Cobb BG,
Greene T,
Okita T,
Hannah LC
(1996)
A single gene mutation increases maize seed weight.
Proc Natl Acad Sci USA
93:
5824-5829
[Abstract/Free Full Text]
Gniadkowski M,
Hammings-Mieszczak M,
Klahre U,
Liu H,
Filipowicz W
(1996)
Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.
Nucleic Acids Res
24:
619-627
[Abstract/Free Full Text]
Golovikin M,
Reddy AS
(1996)
Structure and expression of a plant U1 snRNP 70K gene: alternative splicing of U1 snRNP 70K pre-mRNAs produces two different transcripts.
Plant Cell
8:
1421-1435
[Abstract]
Goodall GJ,
Filipowicz W
(1989)
The AU-rich sequences present in the introns of plant nuclear pre-mRNAs are required for splicing.
Cell
58:
473-483
[CrossRef][Web of Science][Medline]
Goodall GJ,
Filipowicz W
(1991)
Different effects of intron nucleotide composition and secondary structure on pre-mRNA splicing in monocot and dicot plants.
EMBO J
10:
2635-2644
[Web of Science][Medline]
Gorlach J,
Raesecke HR,
Abel G,
Wehrli R,
Amrhein N,
Schmid J
(1995)
Organ-specific differences in the ratio of alternatively spliced chorismate synthase (LeCS2) transcripts in tomato.
Plant J
8:
451-456
[Medline]
Greene T,
Chantler SE,
Kahn B,
Preiss J,
Okita TW
(1996)
Mutagenesis of the potato ADP-glucose pyrophosphorylase and characterization of an allosteric mutant defective in 3-phosphoglycerate activation.
Proc Natl Acad Sci USA
93:
1509-1513
[Abstract/Free Full Text]
Hannah LC,
Tuschall DM,
Man RJ
(1980)
Multiple forms of maize endosperm ADP-glucose pyrophosphorylase and their control by Shrunken-2 and Brittle-2.
Genetics
95:
961-970
[Abstract/Free Full Text]
Iglesias AA,
Barry GF,
Myer C,
Bloksberg L,
Nakata PA,
Greene T,
Laughlin MJ,
Okita TW,
Kishore GM,
Preiss J
(1993)
J Biol Chem
268:
1081-1086
[Abstract/Free Full Text]
Jacobsen SE,
Binkowski K,
Olszewski NE
(1996)
SPINDLY: a tetratricopeptide repeat protein involved in gibberellin signal transduction in Arabidopsis.
Proc Natl Acad Sci USA
93:
9292-9296
[Abstract/Free Full Text]
Keith B,
Chua N-H
(1986)
Monocot and dicot pre-mRNAs are processed with different efficiencies in transgenic tobacco.
EMBO J
5:
2419-2425
[Web of Science][Medline]
Kiss-Laszlo Z,
Blanc S,
Hohn T
(1992)
Splicing of cauliflower mosaic virus 35S RNA is essential for viral infectivity.
EMBO J
14:
3552-3562
[Web of Science][Medline]
Krawczak M,
Reiss J,
Cooper DN
(1992)
The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences.
Hum Genet
90:
41-54
[Web of Science][Medline]
Liu HX,
Filipowicz W
(1996)
Mapping of branchpoint nucleotides in mutant pre-mRNAs expressed in plant cells.
Plant J
9:
381-389
[CrossRef][Web of Science][Medline]
Long JA,
Moan EI,
Medford JI,
Barton MK
(1996)
A member of KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis.
Nature
379:
66-69
[CrossRef][Medline]
Lou H,
McCullough AJ,
Schuler MA
(1993)
3
Splice site selection in dicot plant nuclei is position dependent.
Mol Cell Biol
13:
4485-4493
[Abstract/Free Full Text]
Luehrsen KR,
Walbot V
(1994)
Intron creation and polyadenylation in maize are directed by AU-rich RNA.
Genes Dev
8:
1117-1130
[Abstract/Free Full Text]
Mandel MA,
Gustafson-Brown C,
Savidge B,
Yanofsky MF
(1992)
Molecular characterization of the Arabidopsis floral homeotic gene APTALA1.
Nature
360:
273-277
[CrossRef][Medline]
Maniatis T,
Fritsch EF,
Sambrook KJ
(1993)
Molecular Cloning. A Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
McCarty DR
(1986)
A simple method for extraction of RNA from maize tissue.
Maize Genet Coop Newslett
60:
61
McCullough AJ,
Bayton CE,
Schuler MA
(1996)
Interaction across exons can influence splice site recognition in plant nuclei.
Plant Cell
12:
2295-2307
[Free Full Text]
McCullough AJ,
Lou H,
Schuler MA
(1993)
Factors affecting authentic 5
splice site selection in plant nuclei.
Mol Cell Biol
13:
1323-1331
[Abstract/Free Full Text]
McNellis TW,
von Arnim AG,
Araki T,
Komeda Y,
Misera S,
Deng X-W
(1994)
Genetic and molecular analysis of an allelic series of cop1 mutants suggests functional roles for multiple protein domains.
Plant Cell
6:
487-500
[Abstract]
Meyer CR,
Ghosh P,
Nadler S,
Preiss J
(1993)
Cloning, expression, and sequence of an allosteric mutant ADPglucose pyrophosphorylase from Escherichia coli B.
Arch Biochem Biophys
302:
64-71
[CrossRef][Medline]
Moore MJ,
Query CC,
Sharp PA
(1993)
Splicing of precursors to messenger RNAs by the spliceosome.
In
R Gestland,
J Atkins,
eds, The RNA World.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 303-308
Moore MJ,
Sharp PA
(1993)
Evidence of two active sites in the spliceosome provided by stereochemistry of pre-mRNA.
Nature
365:
364-368
[CrossRef][Medline]
Nishihama R,
Banno H,
Kawahara E,
Irie K,
Machida Y
(1997)
Possible involvement of differential splicing in regulation of the activity of Arabidopsis ANP1 that is related to mitogen-activated protein kinase kinase kinase (MAPKKKs).
Plant J
12:
39-48
[CrossRef][Web of Science][Medline]
Okumiya T,
Ishii S,
Kase R,
Kamei S,
Sakuraba H,
Yoshiyki S
(1995)
-Galactosidase gene mutations in Fabry disease: heterogeneous expressions of mutant enzyme proteins.
Hum Genet
95:
557-556
[Medline]
Parker R,
Guthrie C
(1985)
A point mutation in the conserved hexa-nucleotide at a yeast 5
splice site junction uncouples recognition, cleavage and ligation.
Cell
41:
107-118
[CrossRef][Web of Science][Medline]
Parker R,
Siliciano PG
(1993)
Evidence for an essential non-Watson-Crick interaction between the first and last nucleotides of a nuclear pre-mRNA intron.
Nature
361:
660-662
[CrossRef][Medline]
Pautot V,
Brzezinski R,
Tepfer M
(1989)
Expression of mouse metallothionein gene in transgenic plant tissue.
Gene
77:
133-140
[CrossRef][Medline]
Sharp PJ
(1994)
Split genes and RNA splicing.
Cell
77:
805-815
[CrossRef][Web of Science][Medline]
Shaw JR,
Hannah LC
(1992)
Genomic sequence of the wild type Shrunken-2 allele of Zea mays.
Plant Physiol
98:
1214-1216
[Free Full Text]
Sieburth LE,
Running MP,
Meyerowitz EM
(1995)
Genetic separation of the third and fourth whorl functions of AGAMOUS.
Plant Cell
7:
1249-1258
[Abstract]
Simpson CG,
Brown JWS
(1993)
Efficient splicing of AU-rich antisense intron sequence.
Plant Mol Biol
21:
205-211
[CrossRef][Medline]
Simpson CG,
Clark G,
Davidson D,
Smith P,
Brown JWS
(1996)
Mutation of putative branchpoint consensus sequences in plant introns reduces splicing efficiency.
Plant J
9:
369-380
[CrossRef][Medline]
Simpson CG,
Filipowicz W
(1996)
Splicing of precursors to mRNA in higher plants: regulation and sub-nuclear organization of the spliceosomal machinery.
Plant Mol Biol
32:
1-41
[CrossRef][Web of Science][Medline]
Smith CJW,
Chu TT,
Nadal-Ginard B
(1993)
Scanning and competition between AGs are involved in 3
splice site selection in mammalian introns.
Mol Cell Biol
13:
4939-4952
[Abstract/Free Full Text]
Smith CJW,
Patton JG,
Nadal-Ginard B
(1989)
Alternative splicing in the control of gene expression.
Annu Rev Genet
23:
527-577
[CrossRef][Web of Science][Medline]
Taylor MG,
Vasil IK
(1991)
Histology of, and physical factors affecting, transient GUS expression in plant millet (Pennisetum glaucum (Li) R. Rv.) embryos following microprojectile bombardment.
Plant Cell Rep
10:
120-125
Tsai CY,
Nelson OE
(1966)
Starch deficient maize mutant lacking ADP-glucose pyrophosphorylase activity.
Science
151:
341-343
[Abstract/Free Full Text]
van Santen VL,
Spritz RA
(1987)
Splicing of plant pre-mRNAs in animal system and vice versa.
Gene
56:
253-265
[CrossRef][Medline]
Vasil V,
Clancy M,
Ferl RJ,
Vasil IK,
Hannah LC
(1989)
Increased gene expression by the first intron of maize shrunken-1 locus in grass species.
Plant Physiol
91:
1575-1579
[Abstract/Free Full Text]
Waigmann E,
Barta A
(1992)
Processing of chimeric introns in dicot plants: evidence for close cooperation between 5
and 3
splice sites.
Nucleic Acids Res
20:
75-81
[Abstract/Free Full Text]
Weil CF,
Wessler SR
(1991)
The effects of plant transposable element insertion on transcription initiation and RNA processing.
Annu Rev Plant Physiol
42:
527-552
Wiebauer K,
Herrero J-J,
Filipowicz W
(1988)
Nuclear pre-mRNA processing in plants: distinct modes of 3
-splice-site selection in plants and animals.
Mol Cell Biol
8:
2042-2051
[Abstract/Free Full Text]
Yanofsky MF,
Ma H,
Bowman JL,
Drews GN,
Feldmann KA,
Meyerowitz EM
(1990)
The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors.
Nature
346:
35-39
[CrossRef][Medline]
Yi Y,
Jack T
(1998)
An intragenic suppressor of the Arabidopsis floral organ identity mutant apetala3-1 functions by suppressing defects in splicing.
Plant Cell
10:
1465-1477
[Abstract/Free Full Text]