Plant Physiol. email content delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (46)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martin, R. C.
Right arrow Articles by Mok, D. W.S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, R. C.
Right arrow Articles by Mok, D. W.S.
Agricola
Right arrow Articles by Martin, R. C.
Right arrow Articles by Mok, D. W.S.

Plant Physiol. (1999) 120: 553-558

A Gene Encoding the Cytokinin Enzyme Zeatin O-Xylosyltransferase of Phaseolus vulgaris1

Ruth C. Martin, Machteld C. Mok, and David W.S. Mok*

Department of Horticulture and Center for Gene Research and Biotechnology, Oregon State University, Corvallis, Oregon 97331-7304

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

Zeatin is the most active and ubiquitous form of the naturally occurring cytokinins. Glycosyl conjugates of zeatin are found in many plant tissues and are considered important for storage and protection against degradative enzymes. Two enzymes catalyzing the formation of O-glycosyl derivatives of zeatin have been characterized, O-glucosyltransferase and O-xylosyltransferase, occurring in seeds of lima bean (Phaseolus lunatus) and bean (Phaseolus vulgaris), respectively. Recently, the ZOG1 gene (zeatin O-glucosyltansferase) was isolated from P. lunatis (Martin et al., 1999). Based on the ZOG1 sequence, the ZOX1 gene (zeatin O-xylosyltransferase) was cloned from P. vulgaris. ZOX1 contains an open reading frame of 1362 bp that codes for a 454-amino acid peptide of 51 kD. The recombinant protein has properties identical to the native enzyme: it catalyzes O-xylosylzeatin formation with UDP-Xyl as a glycosyl donor but does not recognize UDP-Glucose as a substrate. The ZOX1 and ZOG1 genes exhibit 93% identity at the nucleotide level and 90% similarity at the amino acid level. Neither gene contains introns. These zeatin-specific genes and their promoters will be useful for studies of the regulation of active versus storage forms of cytokinins. Comparison of sequences encoding similar enzymes with distinct substrate specificity may lead to identification of epitopes specific to cytokinin and glycosyl donor molecules.

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

Cytokinins are important in plant cell division and differentiation (Miller et al., 1956). Zeatin, an adenine derivative first found in maize, is ubiquitous and the most active cytokinin (Letham, 1963; Shaw, 1994). Studies concerning structure-activity relationships (Skoog and Armstrong, 1970) have revealed the importance of the N6 side chain for cytokinin activity. The trans-hydroxylated isoprenoid side chain of zeatin confers high cytokinin activity, but it also makes it vulnerable to attack by degradative enzymes, the cytokinin oxidases (Whitty and Hall, 1974; Armstrong, 1994). Modification of the side chain, such as reduction to dihydrozeatin or O-glycosylation, confers resistance to cytokinin oxidases. Although dihydrozeatin is active itself, the O-glucosyl derivatives are believed to be storage products and transport forms and to be active only after conversion back to zeatin by beta -glucosidases (Jameson, 1994; Letham, 1994).

There are pronounced differences between Phaseolus sp. in the formation of glycosyl conjugates. In lima bean (Phaseolus lunatus) seed exogenous zeatin is rapidly converted to O-glucosylzeatin, whereas in bean (Phaseolus vulgaris) seed zeatin is metabolized to O-xylosylzeatin (Lee et al., 1985; Turner et al., 1987; Dixon et al., 1989). The precise function of O-xylosylzeatin is not known, but presumably it is similar to O-glucosylzeatin, since O-xylosylzeatin can also be reconverted to zeatin and it is active in bioassays (Mok et al., 1987). The corresponding enzymes have been isolated from the two species (Turner et al., 1987; Dixon et al., 1989; Mok and Martin, 1994). The zeatin O-xylosyltransferase (EC 2.4.1.204) of P. vulgaris uses UDP-Xyl as the sugar donor, whereas the O-glucosyltransferase (EC 2.4.1.203) of P. lunatus can use both UDP-Glc and UDP-Xyl to form O-glucosylzeatin or O-xylosylzeatin but has much higher affinity to UDP-Glc (Dixon et al., 1989). The two enzymes can be separated by charge on ion-exchange columns or by PAGE. Thus far, they are the only cytokinin O-glycosyltransferases characterized.

Recently, the cDNA and the gene ZOG1 (zeatin O-glucosyltransferase) were isolated from P. lunatus by screening an expression library with monoclonal antibodies to the enzyme (Martin et al., 1999). In this paper we describe the cloning of the ZOX1 (zeatin O-xylosyltransferase) gene from P. vulgaris using the sequence information from ZOG1. The authenticity of the gene is confirmed by the catalytic activity and substrate specificity of the recombinant protein of ZOX1, which are identical to the native zeatin O-xylosyltransferase.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Plant Materials

Immature seeds of bean (Phaseolus vulgaris L. cv Great Northern [GN]) were the source for isolation of the native zeatin O-xylosyltransferase, as described previously (Dixon et al., 1989). Leaves of cv GN were used for isolation of DNA.

PCR, Inverse PCR, and Sequencing

Standard PCR and inverse PCR protocols (Ochman et al., 1990) were used. Inverse PCR was used first to determine the 5' region of the P. vulgaris gene. For that purpose, DNA of cv GN was digested with HindIII. After digestion, the restriction enzyme was inactivated by heating the sample at 75°C for 10 min. After dilution, T4 DNA ligase (Promega) was added to allow intramolecular ligation (circularization) at 15°C for 24 h. The DNA was precipitated, and inverse PCR was performed with primers CATGGAGATGGGTTCTTTCATTGCAC (primer A) and CAACAACTGAAGCACTCACCAACG (primer B) to amplify the 5' and 3' border regions, respectively. The products obtained from inverse PCR reactions were analyzed on a 1% Sea Plaque gel (FMC Bioproducts, Rockland, ME). Bands of interest were excised and DNA was purified with a Qiaex II gel extraction kit (Qiagen, Chatsworth, CA). The products were ligated into a pGem-T vector (Promega) for sequencing. Subsequently, flanking primers CCAAAGTCGACAATGGCTTTGAATGATG (primer C) and GCTATGCGGCCGCCTAAATGGTATGAC (primer D) were used to obtain the complete ZOX1 gene with standard PCR procedures. PCR products were analyzed as the inverse PCR products above.

Sequencing and primer synthesis were performed by the Central Services Laboratory (Center for Gene Research and Biotechnology, Oregon State University, Corvallis). A DNA sequence analyzer (model 370A, Applied Biosystems) was used for sequencing, and a DNA synthesizer (Applied Biosystems) was used for primer synthesis.

Isolation of Recombinant Proteins

To obtain recombinant proteins, the inserts were excised from the pGem-T plasmid by digestions with the restriction enzymes SalI and NotI and cloned into pZL1 plasmid. The plasmids were then used to transform Epicurian Coli BL21(DE3) pLysS competent cells (Stratagene) following the recommended protocol. The induction conditions were the same as described previously by Martin et al. (1999).

RNA Blot

Poly(A+) RNA was isolated from various cv GN tissues as described previously by Martin et al. (1999). mRNA (4 µg) was separated on a 1.2% formaldehyde gel. RNA blotting (RNA capillary transfer) to Zeta Probe GT membranes (Bio-Rad) was performed according to the manufacturer's instructions. The ZOX1 ORF was used to synthesize an [alpha -32P]dCTP-labeled probe with Ready-To-Go DNA-labeling beads (Pharmacia).

DNA Blot

DNA was extracted from young cv GN leaves with the modified cetyltrimethylammonium bromide procedure as described earlier (Martin et al., 1999). DNA (30 µg) was digested with restriction enzymes and separated on a 1.1% gel and transferred to a Zeta Probe GT membrane. Hybridization was performed as for the RNA blotting with [alpha -32P]dCTP-labeled ZOX1 as the probe.

Enzyme Assays and Analysis of Reaction Products

Enzyme activity was determined as reported previously (Dixon et al., 1989). The reaction mixture consisted of 14C-labeled cytokinins (specific activity of 24 mCi/mmol), glycosyl donor (3 mM of UDP-Xyl or UDP-Glc), 0.05 M MgCl2, 0.5 mM ATP, and recombinant protein in 100 mM Tris, pH 8.0. The reaction mixture was incubated at 27°C for 4 h. Reaction products were separated by HPLC (Dixon et al., 1989).

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Isolation of ZOX1 by PCR

Initial experiments using P. vulgaris DNA as the template and primers covering various segments of the ZOG1 sequence yielded only products corresponding to the middle and 3' regions of the ZOG1 gene (data not shown), suggesting that there was divergence between the 5' terminus of the ZOG1 and the P. vulgaris gene. To generate a product containing the 5' end of the P. vulgaris gene, inverse PCR was performed with forward primer A at the 3' end and backward primer B close to the 5' end. A product of approximately 1.5 kb was obtained, and the sequences containing the ends of the ORF were used to synthesize primers C and D. Amplification of P. vulgaris DNA with these primers resulted in a genomic clone of 1390 bp. The clone contained an ORF of 1362 bp encoding a polypeptide of 454 amino acids (Fig. 1) with a mass of 51 kD.


View larger version (68K):
[in this window]
[in a new window]
  		Figure 1. Deduced amino acid sequence of the ORF of ZOX1 from P. vulgaris (top line) compared with that of ZOG1 of P. lunatus. Alignment was performed with the GCG Program, identifying identical (I), highly similar (:), and similar (.) pairings based on the scoring matrix of Henikoff and Henikoff (1992).

Biological Activity of the Recombinant Protein

The ORF of the genomic clone was ligated into the NotI/SalI site of the pZL1 plasmid. The properties of the recombinant protein were analyzed by western blotting and enzyme assay. The fusion protein (with the alpha -peptide of the cloning plasmid) was antigenic to an antibody to the zeatin O-xylosyltransferase of P. vulgaris (Martin et al., 1990) and had the expected size of 54 kD (Fig. 2). The gene product had high enzyme activity, converting 14C-zeatin to O-xylosylzeatin and 14C-dihydrozeatin to O-xylosyldihydrozeatin with UDP-Xyl as the sugar donor (Table I). For example, in one assay 82% of the labeled zeatin was converted to O-xylosylzeatin and 78% of the dihydrozeatin was converted to O-xylosyldihydrozeatin in 4 h. UDP-Glc is not a substrate because no O-glucosylzeatin was formed with UDP-Glc as the sugar donor under the same reaction conditions. The recombinant protein did not convert cis-zeatin or ribosylzeatin to the corresponding xylosyl derivatives in the presence of UDP-Xyl. Thus, the substrate specificity corresponds closely to that of the native enzyme of P. vulgaris (Dixon et al., 1989), and therefore, the isolated clone is a gene encoding a zeatin O-xylosyltransferase, referred to as ZOX1 (accession no. AF116858).


View larger version (78K):
[in this window]
[in a new window]
  		Figure 2. Western analysis of recombinant protein encoded by the ORF of ZOX1 of P. vulgaris. Lane 1, Markers; lane 2, native zeatin O-xylosyltransferase; lane 3, recombinant protein as a fusion to alpha -peptide.

 
View this table:
[in this window] [in a new window]
  		Table I. Substrate specificity of recombinant proteins encoded by the ORF of ZOX1 and a control plasmid without insert

Protein (125 µL) from culture supernatant was incubated with radiolabeled cytokinins and UDP-Xyl (UDPX) or UDP-Glc (UDPG), as indicated for 4 h. Reaction products were separated by HPLC on a reverse-phase C18 column.

ZOX1 Gene Expression and Copy Number

The RNA blot of mRNA isolated from seeds, leaves, and roots revealed strong expression in developing seeds but only very weak signal in vegetative tissues (Fig. 3). This confirms our previous western analyses results with monospecific antibodies to the enzyme, in which high levels of antigenic protein were detected in young seeds, less in older seeds, and very low levels in roots (Martin et al., 1990).


View larger version (64K):
[in this window]
[in a new window]
  		Figure 3. Northern analysis of mRNA from tissues of P. vulgaris probed with ZOX1. Lane 1, Small seeds (<2 mm); lane 2, medium seeds (2-4 mm); lane 3, large seeds (4-6 mm); lane 4, leaves; lane 5, roots.

DNA after BglII or BamHI digestion, with ZOX1 as the probe, yielded a single, large hybridizing fragment (Fig. 4). XbaI-treated samples contained two complementary bands. Because none of these enzymes cut within the ZOX1 gene, one possible explanation for these results may be that there are two genes close together, with an XbaI site between the genes or within the second gene.


View larger version (43K):
[in this window]
[in a new window]
  		Figure 4. Southern analysis of P. vulgaris DNA probed with ZOX1. Restriction digestion was with BglII (lane 1), XbaI (lane 2), and BamHI (lane 3).

Comparison with the ZOG1 Gene

The nucleotide sequences of the two genes are very similar with an identity of 93% over the length of 1380 bp. The deduced amino acid sequences have a similarity of 90% and an identity of 87% over 449 amino acids (Fig. 1). Based on BLAST analyses, amino acids between positions 329 and 372 of ZOX1 are common to many glycosyltransferase genes and may therefore contain epitopes conferring glycosyl donor recognition. A 15-base deletion in the ZOX1 gene at the 5' terminus accounts for the smaller size of the O-xylosyltransferase (Fig. 1) and is likely the cause of the initial difficulty in amplifying the 5' end of the ZOX1 gene. The ZOX1 gene does not contain any introns, as is true for the ZOG1 gene of P. lunatus (Martin et al., 1999).

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

The ZOX1 gene is the second gene isolated from a family encoding zeatin O-glycosyltransferases. Both ZOX1 and ZOG1 are highly expressed in seeds. DNA-blot analyses detected the presence of additional homologous fragments in both P. vulgaris (Fig. 4) and P. lunatus (Martin et al., 1999). These may be genes encoding zeatin glycosyltransferases expressed in vegetative tissues, since O-glucosyl derivatives of zeatin and ribosylzeatin also occur in leaves and stems (Letham, 1994). Such genes are expected to have similar coding regions but to differ in their promoters. The isolation of an additional zeatin O-glucosyltransferase gene from P. lunatus (R.C. Martin, M.C. Mok, and D.W.S. Mok, unpublished data) supports this hypothesis. The activity of O-glycosyltransferases may also be affected directly or indirectly by other genes, since a P. vulgaris cDNA constitutively expressed in transgenic tobacco stimulated a low level of O-xylosyltransferase activity (Martin et al., 1997). A BLAST search of ZOX and ZOG amino acid sequences revealed homology to other glycosyltransferases such as flavonoid 3-O-glucosyltransferases. A C-terminal segment suggested to be the UDP-glycosyltransferase signature is present in these genes. In the ZOX gene this region occurs between amino acids 329 to 372 (WAPinfinity DQ).

The isolation of the Phaseolus ZOG and ZOX genes will facilitate cloning of similar genes from other species. A collection of zeatin metabolic genes may facilitate determination of domains regulating substrate specificity. For example, the difference in glycosyl donor recognition between ZOX1 and XOG1 should make it possible to identify the sequence essential for differences in UDP-Xyl and UDP-Glc affinity through domain swapping and/or site-directed mutagenesis.

Whereas different zeatin O-glycosyltransferases occur in P. vulgaris and P. lunatus seeds, two other Phaseolus sp. examined, Phaseolus coccineus and Phaseolus acutifolius, appear to be closer to P. vulgaris since they display mainly O-xylosyltransferase activity based on incubation studies with labeled zeatin (Mok and Mok, 1987). The differences between species may reflect the availability of glycosyl donors, leading to the adaptation of specific enzymes using the prevalent glycosyl substrate in each species. Because interspecific hybrid embryos of Phaseolus display distinct developmental limits depending on the parental species combination, with P. vulgaris × P. lunatus crosses being the least successful (Mok et al., 1986), it will be of interest to determine whether abnormal embryo growth is somehow related to interspecific differences in glycosylation preference.

Many cytokinin mutants have been reported (Wang, 1994; Deikman, 1998), and recently several Arabidopsis genes most likely involved in cytokinin-signaling pathways have been identified (Kakimoto, 1996; Brandstatter and Kieber, 1998; Plakidou-Dymock et al., 1998). As to cytokinin metabolic enzymes, the sequence of a maize gene encoding a cytokinin oxidase has recently been obtained (Houba-Hérin et al., 1999; Morris et al., 1999). Other genes related to zeatin metabolism are those encoding beta -glucosidases (Brzobohaty et al., 1993; Falk and Rask, 1995). However, these genes are unlikely to be critical to cytokinin metabolism since beta -glucosidases degrade a broad range of glycosides (Babcock and Esen, 1994). In comparison, the zeatin O-glycosyltransferases of Phaseolus are highly specific, discriminating among trans- and cis-zeatin, dihydrozeatin, and ribosylzeatin. The expression of the O-glycosyltransferase genes may be tightly regulated, having a direct bearing on the levels of active cytokinins in plant tissues.

    FOOTNOTES
1   This research was supported by a grant from the U.S. Department of Agriculture-National Research Initiative Competitive Grants Program (no. 9801398) and the Oregon Agricultural Experiment Station (paper no. 11,466).
*   Corresponding author; e-mail mokd{at}bcc.orst.edu; fax 1-541-737-3479.

   Received January 5, 1999; accepted March 19, 1999.

    ABBREVIATIONS

Abbreviation: ORF, open reading frame.

    LITERATURE  CITED
Top
Abstract
Introduction
Methods
Results
Discussion
References

Armstrong DJ (1994) Cytokinin oxidase and the regulation of cytokinin degradation. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 1139-1154

Babcock GD, Esen A (1994) Substrate specificity of maize beta -glucosidase. Plant Sci 101: 31-39 [CrossRef]

Brandstatter J, Kieber JJ (1998) Two genes with similarity to bacterial response regulators are rapidly and specifically induced by cytokinins in Arabidopsis. Plant Cell 10: 1009-1019 [Abstract/Free Full Text]

Brzobohaty B, Moore I, Kristoffersen P, Bako L, Campos N, Schell J, Palme K (1993) Release of active cytokinin by a beta -glucosidase localized to the maize root meristem. Science 262: 1051-1054 [Abstract/Free Full Text]

Deikman J (1998) Elucidating cytokinin response mechanisms using mutants. Plant Growth Regul 23: 33-40

Dixon SC, Martin RC, Mok MC, Shaw G, Mok DWS (1989) Zeatin glycosylation enzymes in Phaseolus. Isolation of O-glucosyltransferase from P. lunatus and comparison to O-xylosyltransferase from P. vulgaris. Plant Physiol 90: 1316-1635 [Abstract/Free Full Text]

Falk A, Rask L (1995) Expression of a zeatin-O-glucoside-degrading beta -glucosidase in Brassica napus. Plant Physiol 108: 1369-1377 [Abstract]

Henikoff S, Henikoff JG (1992) Amino acid substitution matrices from protein blocks. Proc Natl Acad Sci USA 89: 10915-10919 [Abstract/Free Full Text]

Houba-Hérin N, Pethe C, d'Alayer J, Laloue M (1999) Cytokinin oxidase from Zea mays: purification, cDNA cloning and expression in moss protoplasts. Plant J 17: 615-626

Jameson PE (1994) Cytokinin metabolism and compartmentation. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 113-128

Kakimoto T (1996) CKI1, a histidine kinase homolog implicated in cytokinin signal transduction. Science 274: 982-985 [Abstract/Free Full Text]

Lee YH, Mok MC, Mok DWS, Griffin DA, Shaw G (1985) Cytokinin metabolism in Phaseolus embryos. Genetic difference and the occurrence of novel zeatin metabolites. Plant Physiol 77: 635-641 [Abstract/Free Full Text]

Letham DS (1963) Zeatin, a factor inducing cell division from Zea mays. Life Sci 8: 569-573

Letham DS (1994) Cytokinins as phytohormones: sites of biosynthesis, translocation, and function of translocated cytokinin. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 57-80

Martin RC, Martin RR, Mok MC, Mok DWS (1990) A monoclonal antibody specific to zeatin O-glycosyltransferases of Phaseolus. Plant Physiol 94: 1290-1294 [Abstract/Free Full Text]

Martin RC, Mok MC, Mok DWS (1997) Protein processing and auxin response in transgenic tobacco harboring a putative cDNA of zeatin O-xylosyltransferase from Phaseolus vulgaris. Plant J 12: 305-312 [Medline]

Martin RC, Mok MC, Mok DWS (1999) Proc Natl Acad Sci USA 96: 284-289 [Abstract/Free Full Text]

Miller CO, Skoog F, Okumura FS, von Saltza MH, Strong FM (1956) Isolation, structure and synthesis of kinetin, a substance promoting cell division. J Am Chem Soc 78: 1375-1380 [CrossRef]

Mok DWS, Martin RC (1994) Cytokinin metabolic enzymes. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 129-137

Mok DWS, Mok MC, Rabakoarihanta A, Shii CT (1986) Phaseolus: wide hybridization through embryo culture. In YPS Bajaj, eds, Biotechnology in Agriculture and Forestry, Vol 2: Crops I. Springer-Verlag, Berlin, pp 309-318

Mok MC, Mok DWS (1987) Metabolism of 14C-zeatin in Phaseolus embryos. Occurrence of O-xylosyldihydrozeatin and its ribonucleoside. Plant Physiol 84: 596-599 [Abstract/Free Full Text]

Mok MC, Mok DWS, Marsden KE, Shaw G (1987) The biological activity and metabolism of a novel cytokinin metabolite, O-xylosylzeatin, in callus tissue of Phaseolus vulgaris and P. lunatus. J Plant Physiol 130: 423-431

Morris RO, Bilyeu KD, Laskey JG, Cheikh NN (1999) Isolation of a gene encoding a glycosylated cytokinin oxidase from maize. Biochem Biophys Res Commun 255: 328-333 [CrossRef][Web of Science][Medline]

Ochman H, Medhora MM, Garza D, Hartl DL (1990) Amplification of flanking sequences by inverse PCR. In MA Innis, DH Gelfand, JJ Sninsky, TJ White, eds, PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, pp 219-227

Plakidou-Dymock S, Dymock D, Hooley R (1998) A higher plant seven transmembrane receptor that influences sensitivity to cytokinins. Curr Biol 8: 315-324 [CrossRef][Web of Science][Medline]

Shaw G (1994) Chemistry of adenine cytokinins. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 15-34

Skoog F, Armstrong DJ (1970) Cytokinins. Annu Rev Plant Physiol 21: 359-384

Turner JE, Mok DWS, Mok MC, Shaw G (1987) Isolation and partial purification of an enzyme catalyzing the formation of O-xylosylzeatin in Phaseolus vulgaris embryos. Proc Natl Acad Sci USA 84: 3714-3717 [Abstract/Free Full Text]

Wang TL (1994) Cytokinin mutants. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 255-268

Whitty CD, Hall RH (1974) A cytokinin oxidase in Zea mays. Can J Biochem 52: 781-799

Copyright Clearance Center:   0032-0889/99/120//06
 
© 1999 American Society of Plant Physiologists



This article has been cited by other articles:


Home page
 J Exp BotHome page
A. Pineda Rodo, N. Brugiere, R. Vankova, J. Malbeck, J. M. Olson, S. C. Haines, R. C. Martin, J. E. Habben, D. W. S. Mok, and M. C. Mok
Over-expression of a zeatin O-glucosylation gene in maize leads to growth retardation and tasselseed formation
J. Exp. Bot., July 1, 2008; 59(10): 2673 - 2686.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
M. C. Mok, R. C. Martin, P. I. Dobrev, R. Vankova, P. S. Ho, K. Yonekura-Sakakibara, H. Sakakibara, and D. W.S. Mok
Topolins and Hydroxylated Thidiazuron Derivatives Are Substrates of Cytokinin O-Glucosyltransferase with Position Specificity Related to Receptor Recognition
Plant Physiology, March 1, 2005; 137(3): 1057 - 1066.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. Hou, E.-K. Lim, G. S. Higgins, and D. J. Bowles
N-Glucosylation of Cytokinins by Glycosyltransferases of Arabidopsis thaliana
J. Biol. Chem., November 12, 2004; 279(46): 47822 - 47832.
[Abstract] [Full Text] [PDF]

Home page
 Plant Cell PhysiolHome page
M. Shao, H. Zheng, Y. Hu, D. Liu, J.-C. Jang, H. Ma, and H. Huang
The GAOLAOZHUANGREN1 Gene Encodes a Putative Glycosyltransferase that is Critical for Normal Development and Carbohydrate Metabolism
Plant Cell Physiol., October 15, 2004; 45(10): 1453 - 1460.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
F. El Yahyaoui, H. Kuster, B. Ben Amor, N. Hohnjec, A. Puhler, A. Becker, J. Gouzy, T. Vernie, C. Gough, A. Niebel, et al.
Expression Profiling in Medicago truncatula Identifies More Than 750 Genes Differentially Expressed during Nodulation, Including Many Potential Regulators of the Symbiotic Program
Plant Physiology, October 1, 2004; 136(2): 3159 - 3176.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. Jones, B. Messner, J.-I. Nakajima, A. R. Schaffner, and K. Saito
UGT73C6 and UGT78D1, Glycosyltransferases Involved in Flavonol Glycoside Biosynthesis in Arabidopsis thaliana
J. Biol. Chem., November 7, 2003; 278(45): 43910 - 43918.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
A. M. Rashotte, S. D.B. Carson, J. P.C. To, and J. J. Kieber
Expression Profiling of Cytokinin Action in Arabidopsis
Plant Physiology, August 1, 2003; 132(4): 1998 - 2011.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
Y. K. Veach, R. C. Martin, D. W.S. Mok, J. Malbeck, R. Vankova, and M. C. Mok
O-Glucosylation of cis-Zeatin in Maize. Characterization of Genes, Enzymes, and Endogenous Cytokinins
Plant Physiology, March 1, 2003; 131(3): 1374 - 1380.
[Abstract] [Full Text] [PDF]

Home page
 Plant CellHome page
C. E. Hutchison and J. J. Kieber
Cytokinin Signaling in Arabidopsis
PLANT CELL, May 1, 2002; 14(90001): S47 - 59.
[Full Text] [PDF]

Home page
 Plant Physiol.Home page
G. Haberer and J. J. Kieber
Cytokinins. New Insights into a Classic Phytohormone
Plant Physiology, February 1, 2002; 128(2): 354 - 362.
[Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
R. C. Martin, M. C. Mok, J. E. Habben, and D. W. S. Mok
A maize cytokinin gene encoding an O-glucosyltransferase specific to cis-zeatin
PNAS, April 25, 2001; (2001) 101128798.
[Abstract] [Full Text]

Home page
 Plant Physiol.Home page
K. D. Bilyeu, J. L. Cole, J. G. Laskey, W. R. Riekhof, T. J. Esparza, M. D. Kramer, and R. O. Morris
Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize
Plant Physiology, January 1, 2001; 125(1): 378 - 386.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
R. G. Jackson, E.-K. Lim, Y. Li, M. Kowalczyk, G. Sandberg, J. Hoggett, D. A. Ashford, and D. J. Bowles
Identification and Biochemical Characterization of an Arabidopsis Indole-3-acetic Acid Glucosyltransferase
J. Biol. Chem., February 2, 2001; 276(6): 4350 - 4356.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Li, S. Baldauf, E.-K. Lim, and D. J. Bowles
Phylogenetic Analysis of the UDP-glycosyltransferase Multigene Family of Arabidopsis thaliana
J. Biol. Chem., February 2, 2001; 276(6): 4338 - 4343.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
R. C. Martin, M. C. Mok, J. E. Habben, and D. W. S. Mok
A maize cytokinin gene encoding an O-glucosyltransferase specific to cis-zeatin
PNAS, May 8, 2001; 98(10): 5922 - 5926.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (46)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martin, R. C.
Right arrow Articles by Mok, D. W.S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, R. C.
Right arrow Articles by Mok, D. W.S.
Agricola
Right arrow Articles by Martin, R. C.
Right arrow Articles by Mok, D. W.S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 1999 by the American Society of Plant Biologists