|
|
||||||||
|
Plant Physiol. (1999) 120: 553-558 A Gene Encoding the Cytokinin Enzyme Zeatin O-Xylosyltransferase of Phaseolus vulgaris1
Department of Horticulture and Center for Gene Research and Biotechnology, Oregon State University, Corvallis, Oregon 97331-7304
Zeatin is the most active and
ubiquitous form of the naturally occurring cytokinins. Glycosyl
conjugates of zeatin are found in many plant tissues and are considered
important for storage and protection against degradative enzymes. Two
enzymes catalyzing the formation of O-glycosyl
derivatives of zeatin have been characterized, O-glucosyltransferase and
O-xylosyltransferase, occurring in seeds of lima bean
(Phaseolus lunatus) and bean (Phaseolus
vulgaris), respectively. Recently, the ZOG1 gene
(zeatin
O-glucosyltansferase) was
isolated from P. lunatis (Martin et al., 1999
Cytokinins are important in plant cell division and
differentiation (Miller et al., 1956 There are pronounced differences between Phaseolus sp. in
the formation of glycosyl conjugates. In lima bean (Phaseolus
lunatus) seed exogenous zeatin is rapidly converted to
O-glucosylzeatin, whereas in bean (Phaseolus
vulgaris) seed zeatin is metabolized to O-xylosylzeatin
(Lee et al., 1985 Recently, the cDNA and the gene ZOG1 (zeatin
O-glucosyltransferase)
were isolated from P. lunatus by screening an expression
library with monoclonal antibodies to the enzyme (Martin et al., 1999 Plant Materials
PCR, Inverse PCR, and Sequencing Standard PCR and inverse PCR protocols (Ochman et al., 1990 region of the
P. vulgaris gene. For that purpose, DNA of cv GN was
digested with HindIII. After digestion, the restriction
enzyme was inactivated by heating the sample at 75°C for 10 min.
After dilution, T4 DNA ligase (Promega) was added
to allow intramolecular ligation (circularization) at 15°C for
24 h. The DNA was precipitated, and inverse PCR was performed with
primers CATGGAGATGGGTTCTTTCATTGCAC (primer A) and CAACAACTGAAGCACTCACCAACG (primer B) to amplify the 5 and 3 border regions, respectively. The products obtained from inverse PCR reactions
were analyzed on a 1% Sea Plaque gel (FMC Bioproducts, Rockland, ME). Bands of interest were excised and DNA was purified with
a Qiaex II gel extraction kit (Qiagen, Chatsworth, CA). The products were ligated into a pGem-T vector (Promega) for sequencing. Subsequently, flanking primers CCAAAGTCGACAATGGCTTTGAATGATG (primer C)
and GCTATGCGGCCGCCTAAATGGTATGAC (primer D) were used to obtain the complete ZOX1 gene with standard PCR procedures. PCR
products were analyzed as the inverse PCR products above.
Isolation of Recombinant Proteins To obtain recombinant proteins, the inserts were excised from the pGem-T plasmid by digestions with the restriction enzymes SalI and NotI and cloned into pZL1 plasmid. The plasmids were then used to transform Epicurian Coli BL21(DE3) pLysS competent cells (Stratagene) following the recommended protocol. The induction conditions were the same as described previously by Martin et al. (1999)RNA Blot Poly(A+) RNA was isolated from various cv GN tissues as described previously by Martin et al. (1999) -32P]dCTP-labeled probe
with Ready-To-Go DNA-labeling beads (Pharmacia).
DNA Blot DNA was extracted from young cv GN leaves with the modified cetyltrimethylammonium bromide procedure as described earlier (Martin et al., 1999 -32P]dCTP-labeled ZOX1 as the
probe.
Enzyme Assays and Analysis of Reaction Products Enzyme activity was determined as reported previously (Dixon et al., 1989
Isolation of ZOX1 by PCR Initial experiments using P. vulgaris DNA as the template and primers covering various segments of the ZOG1 sequence yielded only products corresponding to the middle and 3
regions of the ZOG1 gene (data not shown), suggesting that
there was divergence between the 5 terminus of the ZOG1 and
the P. vulgaris gene. To generate a product containing the
5 end of the P. vulgaris gene, inverse PCR was performed
with forward primer A at the 3 end and backward primer B close to the
5 end. A product of approximately 1.5 kb was obtained, and the
sequences containing the ends of the ORF were used to synthesize
primers C and D. Amplification of P. vulgaris DNA with these
primers resulted in a genomic clone of 1390 bp. The clone contained an
ORF of 1362 bp encoding a polypeptide of 454 amino acids (Fig.
1) with a mass of 51 kD.
Biological Activity of the Recombinant Protein The ORF of the genomic clone was ligated into the NotI/SalI site of the pZL1 plasmid. The properties of the recombinant protein were analyzed by western blotting and enzyme assay. The fusion protein (with the -peptide of the
cloning plasmid) was antigenic to an antibody to the zeatin
O-xylosyltransferase of P. vulgaris (Martin et
al., 1990
ZOX1 Gene Expression and Copy Number The RNA blot of mRNA isolated from seeds, leaves, and roots revealed strong expression in developing seeds but only very weak signal in vegetative tissues (Fig. 3). This confirms our previous western analyses results with monospecific antibodies to the enzyme, in which high levels of antigenic protein were detected in young seeds, less in older seeds, and very low levels in roots (Martin et al., 1990
Comparison with the ZOG1 Gene
The ZOX1 gene is the second gene isolated from a family
encoding zeatin O-glycosyltransferases. Both ZOX1
and ZOG1 are highly expressed in seeds. DNA-blot analyses
detected the presence of additional homologous fragments in both
P. vulgaris (Fig. 4) and P. lunatus (Martin et
al., 1999
* Corresponding author; e-mail mokd{at}bcc.orst.edu; fax 1-541-737-3479. Received January 5, 1999;
accepted March 19, 1999.
Abbreviation: ORF, open reading frame.
Armstrong DJ (1994) Cytokinin oxidase and the regulation of cytokinin degradation. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 1139-1154
Babcock GD,
Esen A
(1994)
Substrate specificity of maize
Brandstatter J,
Kieber JJ
(1998)
Two genes with similarity to bacterial response regulators are rapidly and specifically induced by cytokinins in Arabidopsis.
Plant Cell
10:
1009-1019
Brzobohaty B,
Moore I,
Kristoffersen P,
Bako L,
Campos N,
Schell J,
Palme K
(1993)
Release of active cytokinin by a Deikman J (1998) Elucidating cytokinin response mechanisms using mutants. Plant Growth Regul 23: 33-40
Dixon SC,
Martin RC,
Mok MC,
Shaw G,
Mok DWS
(1989)
Zeatin glycosylation enzymes in Phaseolus. Isolation of O-glucosyltransferase from P. lunatus and comparison to O-xylosyltransferase from P. vulgaris.
Plant Physiol
90:
1316-1635
Falk A,
Rask L
(1995)
Expression of a zeatin-O-glucoside-degrading
Henikoff S,
Henikoff JG
(1992)
Amino acid substitution matrices from protein blocks.
Proc Natl Acad Sci USA
89:
10915-10919
Houba-Hérin N, Pethe C, d'Alayer J, Laloue M (1999) Cytokinin oxidase from Zea mays: purification, cDNA cloning and expression in moss protoplasts. Plant J 17: 615-626 Jameson PE (1994) Cytokinin metabolism and compartmentation. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 113-128
Kakimoto T
(1996)
CKI1, a histidine kinase homolog implicated in cytokinin signal transduction.
Science
274:
982-985
Lee YH,
Mok MC,
Mok DWS,
Griffin DA,
Shaw G
(1985)
Cytokinin metabolism in Phaseolus embryos. Genetic difference and the occurrence of novel zeatin metabolites.
Plant Physiol
77:
635-641
Letham DS (1963) Zeatin, a factor inducing cell division from Zea mays. Life Sci 8: 569-573 Letham DS (1994) Cytokinins as phytohormones: sites of biosynthesis, translocation, and function of translocated cytokinin. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 57-80
Martin RC,
Martin RR,
Mok MC,
Mok DWS
(1990)
A monoclonal antibody specific to zeatin O-glycosyltransferases of Phaseolus.
Plant Physiol
94:
1290-1294
Martin RC, Mok MC, Mok DWS (1997) Protein processing and auxin response in transgenic tobacco harboring a putative cDNA of zeatin O-xylosyltransferase from Phaseolus vulgaris. Plant J 12: 305-312 [Medline]
Martin RC,
Mok MC,
Mok DWS
(1999)
Proc Natl Acad Sci USA
96:
284-289
Miller CO, Skoog F, Okumura FS, von Saltza MH, Strong FM (1956) Isolation, structure and synthesis of kinetin, a substance promoting cell division. J Am Chem Soc 78: 1375-1380 [CrossRef] Mok DWS, Martin RC (1994) Cytokinin metabolic enzymes. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 129-137 Mok DWS, Mok MC, Rabakoarihanta A, Shii CT (1986) Phaseolus: wide hybridization through embryo culture. In YPS Bajaj, eds, Biotechnology in Agriculture and Forestry, Vol 2: Crops I. Springer-Verlag, Berlin, pp 309-318
Mok MC,
Mok DWS
(1987)
Metabolism of 14C-zeatin in Phaseolus embryos. Occurrence of O-xylosyldihydrozeatin and its ribonucleoside.
Plant Physiol
84:
596-599
Mok MC, Mok DWS, Marsden KE, Shaw G (1987) The biological activity and metabolism of a novel cytokinin metabolite, O-xylosylzeatin, in callus tissue of Phaseolus vulgaris and P. lunatus. J Plant Physiol 130: 423-431 Morris RO, Bilyeu KD, Laskey JG, Cheikh NN (1999) Isolation of a gene encoding a glycosylated cytokinin oxidase from maize. Biochem Biophys Res Commun 255: 328-333 [CrossRef][Web of Science][Medline] Ochman H, Medhora MM, Garza D, Hartl DL (1990) Amplification of flanking sequences by inverse PCR. In MA Innis, DH Gelfand, JJ Sninsky, TJ White, eds, PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, pp 219-227 Plakidou-Dymock S, Dymock D, Hooley R (1998) A higher plant seven transmembrane receptor that influences sensitivity to cytokinins. Curr Biol 8: 315-324 [CrossRef][Web of Science][Medline] Shaw G (1994) Chemistry of adenine cytokinins. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 15-34 Skoog F, Armstrong DJ (1970) Cytokinins. Annu Rev Plant Physiol 21: 359-384
Turner JE,
Mok DWS,
Mok MC,
Shaw G
(1987)
Isolation and partial purification of an enzyme catalyzing the formation of O-xylosylzeatin in Phaseolus vulgaris embryos.
Proc Natl Acad Sci USA
84:
3714-3717
Wang TL (1994) Cytokinin mutants. In DWS Mok, MC Mok, eds, Cytokinins: Chemistry, Activity and Function. CRC Press, Boca Raton, FL, pp 255-268 Whitty CD, Hall RH (1974) A cytokinin oxidase in Zea mays. Can J Biochem 52: 781-799
Copyright Clearance Center: 0032-0889/99/120//06
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
A. Pineda Rodo, N. Brugiere, R. Vankova, J. Malbeck, J. M. Olson, S. C. Haines, R. C. Martin, J. E. Habben, D. W. S. Mok, and M. C. Mok Over-expression of a zeatin O-glucosylation gene in maize leads to growth retardation and tasselseed formation J. Exp. Bot., July 1, 2008; 59(10): 2673 - 2686. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Mok, R. C. Martin, P. I. Dobrev, R. Vankova, P. S. Ho, K. Yonekura-Sakakibara, H. Sakakibara, and D. W.S. Mok Topolins and Hydroxylated Thidiazuron Derivatives Are Substrates of Cytokinin O-Glucosyltransferase with Position Specificity Related to Receptor Recognition Plant Physiology, March 1, 2005; 137(3): 1057 - 1066. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hou, E.-K. Lim, G. S. Higgins, and D. J. Bowles N-Glucosylation of Cytokinins by Glycosyltransferases of Arabidopsis thaliana J. Biol. Chem., November 12, 2004; 279(46): 47822 - 47832. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shao, H. Zheng, Y. Hu, D. Liu, J.-C. Jang, H. Ma, and H. Huang The GAOLAOZHUANGREN1 Gene Encodes a Putative Glycosyltransferase that is Critical for Normal Development and Carbohydrate Metabolism Plant Cell Physiol., October 15, 2004; 45(10): 1453 - 1460. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. El Yahyaoui, H. Kuster, B. Ben Amor, N. Hohnjec, A. Puhler, A. Becker, J. Gouzy, T. Vernie, C. Gough, A. Niebel, et al. Expression Profiling in Medicago truncatula Identifies More Than 750 Genes Differentially Expressed during Nodulation, Including Many Potential Regulators of the Symbiotic Program Plant Physiology, October 1, 2004; 136(2): 3159 - 3176. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Jones, B. Messner, J.-I. Nakajima, A. R. Schaffner, and K. Saito UGT73C6 and UGT78D1, Glycosyltransferases Involved in Flavonol Glycoside Biosynthesis in Arabidopsis thaliana J. Biol. Chem., November 7, 2003; 278(45): 43910 - 43918. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Rashotte, S. D.B. Carson, J. P.C. To, and J. J. Kieber Expression Profiling of Cytokinin Action in Arabidopsis Plant Physiology, August 1, 2003; 132(4): 1998 - 2011. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. K. Veach, R. C. Martin, D. W.S. Mok, J. Malbeck, R. Vankova, and M. C. Mok O-Glucosylation of cis-Zeatin in Maize. Characterization of Genes, Enzymes, and Endogenous Cytokinins Plant Physiology, March 1, 2003; 131(3): 1374 - 1380. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Hutchison and J. J. Kieber Cytokinin Signaling in Arabidopsis PLANT CELL, May 1, 2002; 14(90001): S47 - 59. [Full Text] [PDF] |
||||
![]() |
G. Haberer and J. J. Kieber Cytokinins. New Insights into a Classic Phytohormone Plant Physiology, February 1, 2002; 128(2): 354 - 362. [Full Text] [PDF] |
||||
![]() |
R. C. Martin, M. C. Mok, J. E. Habben, and D. W. S. Mok A maize cytokinin gene encoding an O-glucosyltransferase specific to cis-zeatin PNAS, April 25, 2001; (2001) 101128798. [Abstract] [Full Text] |
||||
![]() |
K. D. Bilyeu, J. L. Cole, J. G. Laskey, W. R. Riekhof, T. J. Esparza, M. D. Kramer, and R. O. Morris Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize Plant Physiology, January 1, 2001; 125(1): 378 - 386. [Abstract] [Full Text] |
||||
![]() |
R. G. Jackson, E.-K. Lim, Y. Li, M. Kowalczyk, G. Sandberg, J. Hoggett, D. A. Ashford, and D. J. Bowles Identification and Biochemical Characterization of an Arabidopsis Indole-3-acetic Acid Glucosyltransferase J. Biol. Chem., February 2, 2001; 276(6): 4350 - 4356. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, S. Baldauf, E.-K. Lim, and D. J. Bowles Phylogenetic Analysis of the UDP-glycosyltransferase Multigene Family of Arabidopsis thaliana J. Biol. Chem., February 2, 2001; 276(6): 4338 - 4343. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Martin, M. C. Mok, J. E. Habben, and D. W. S. Mok A maize cytokinin gene encoding an O-glucosyltransferase specific to cis-zeatin PNAS, May 8, 2001; 98(10): 5922 - 5926. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|