Plant Physiol. (1999) 120: 653-664
Decreased Cell Wall Digestibility in Canola Transformed with
Chimeric Tyrosine Decarboxylase Genes from Opium Poppy1
Peter J. Facchini*,
Min Yu, and
Catherine Penzes-Yost
Department of Biological Sciences, University of Calgary, Calgary,
Alberta, Canada T2N 1N4
 |
ABSTRACT |
Tyrosine decarboxylase (TYDC) is a
common plant enzyme involved in the biosynthesis of numerous secondary
metabolites, including hydroxycinnamic acid amides. Although a definite
function has not yet been determined, amides have been proposed to form
a physical barrier against pathogens because they are usually found as
integral cell wall components. Canola (Brassica napus)
was independently transformed with chimeric genes
(35S::TYDC1 and
35S::TYDC2) under the transcriptional control
of the cauliflower mosaic virus 35S promoter, and
encoding two TYDC isoforms from opium poppy (Papaver somniferum). All T0 plants displayed a suppressed
level of wild-type TYDC activity, and transgene mRNAs were not
detected. Silencing of 35S::TYDC1 was overcome
in the T1 progeny of self-pollinated T0 plants,
since high levels of TYDC1 mRNAs were detected, and TYDC activity
increased up to 4-fold compared with wild-type levels. However, TYDC1
mRNA levels decreased in T2 plants and were not detected in
the T3 progeny. TYDC activity also gradually declined in
T2 and T3 plants to nearly wild-type levels. In
contrast, silencing of 35S::TYDC2 was
maintained through four consecutive generations. T1 plants
with a 3- to 4-fold increase in wild-type TYDC activity showed a 30%
decrease in cellular tyrosine pools and a 2-fold increase in cell
wall-bound tyramine compared with wild-type plants. An increase in cell
wall-bound aromatic compounds was also detected in these T1
plants by ultraviolet autofluorescence microscopy. The relative
digestibility of cell walls measured by protoplast release efficiency
was inversely related to the level of TYDC activity.
 |
INTRODUCTION |
Plant responses to pathogens include the induction of numerous
metabolic pathways that comprise an arsenal of biochemical and physical
defenses. Induction of hydrolytic enzymes such as chitinases and
glucanases and the production of low-Mr
antimicrobial compounds known as phytoalexins are common biochemical
defense responses that increase disease resistance in plants by
directly inhibiting the growth of pathogens (Hahlbrock and Scheel,
1989
). The deposition of lignin and the cross-linking of Hyp-rich
glycoproteins within the polysaccharide matrix of the cell wall are
examples of physical defense mechanisms that reduce plant cell
susceptibility to penetration by invading pathogens (Showalter et al.,
1985
; Matern and Kneusel, 1988
).
TYDC (EC 4.1.1.28) catalyzes the decarboxylation of Tyr to tyramine
(Fig. 1) and is widespread in higher
plants (Hosoi et al., 1970
; Tocher and Tocher, 1972
; Marques and
Brodelius, 1988
; Kawalleck et al., 1993
; Trezzini et al., 1993
;
Facchini and De Luca, 1994
). The rapid and transient induction of TYDC
mRNAs in response to elicitors and/or pathogens in parsley (Schmelzer
et al., 1989
; Kawalleck et al., 1993
), Arabidopsis (Trezzini et al., 1993
), and opium poppy (Papaver somniferum; Facchini et al.,
1996
) suggests that tyramine serves as a precursor to an important
class of plant defense-response metabolites. In opium poppy, TYDC is encoded by a family of 10 to 15 genes that can be categorized into two
subgroups based on sequence identity (Facchini and De Luca, 1994
; Facchini et al., 1998
). Each subgroup consists of approximately six members that share approximately 90% identity at the
nucleotide and amino acid levels. In contrast, comparison of subgroup
members (represented by TYDC1 and TYDC2) reveals
sequence identities of <75%. Although the catalytic properties of the
different TYDC isoforms are similar (Facchini and De Luca, 1994
), the
TYDC gene family exhibits differential and organ- and
temporal-specific expression (Facchini et al., 1998
).

View larger version (17K):
[in this window]
[in a new window]
| Figure 1.
Reactions in the biosynthesis of hydroxycinnamic
acid amides that are catalyzed by TYDC and THT.
|
|
Recent studies have shown that the biosynthesis of hydroxycinnamic acid
amides of tyramine and their subsequent polymerization in the cell wall
by oxidative enzymes are integral and ubiquitous components of the
plant defense response to pathogen challenge (Clarke, 1982
;
Negrel and Martin, 1984
; Negrel and Jeandet, 1987
; Negrel and
Lherminier, 1987
; Negrel et al., 1993a
; Schmidt et al., 1998
).
These amides, together with other cell wall-bound phenolics, are
believed to create a barrier against pathogens by reducing the
digestibility of the cell wall and/or by directly inhibiting the growth
of fungal hyphae. Hydroxycinnamic acid amides, which have been found in
a variety of plants (Martin-Tanguy et al., 1978
), are formed by the
condensation of hydroxycinnamoyl-CoA esters with various amines such as
polyamines (e.g. putrescine and spermidine) or tyramine. THT (EC
2.3.1.110) catalyzes the condensation of tyramine and select
derivatives of hydroxycinnamoyl-CoA (Fig. 1) and is induced in response
to pathogens (Fleurence and Negrel, 1987
), elicitor treatment (Villegas
and Brodelius, 1990
; Schmidt et al., 1998
; Yu and Facchini, 1999
),
and wounding (Negrel et al., 1993a
). The enzyme was first isolated
from tobacco leaves (Negrel and Martin, 1984
) and has been purified to
homogeneity from potato (Hohlfeld et al., 1995
, 1996
), tobacco (Negrel
and Javelle, 1997
), and opium poppy (Yu and Facchini, 1999
).
The use of transgenic plants with altered levels of a specific enzyme
is a powerful technique with which to study metabolic regulation and to
refine our understanding of the physiological roles for secondary
metabolic pathways. For example, the co-suppression of PAL activity in
transgenic tobacco demonstrated that this enzyme is a rate-determining
step in the biosynthesis of phenylpropanoid derivatives, including
lignin, and showed that phenolic metabolites are crucial for the
resistance of plants to pathogens (Bate et al., 1994
; Maher et
al., 1994
). Introduction of a foreign TDC (Trp decarboxylase) (EC 4.1.1.25)
gene into canola (Brassica napus) resulted in the
redirection of Trp into tryptamine rather than into indole
glucosinolates (Chavadej et al., 1994
). In contrast, expression of the
same TDC gene in transgenic potato resulted in altered
aromatic amino acid biosynthesis and increased susceptibility of the
plants to pathogen infestation (Yao et al., 1995
). In the present
study, we tested the hypothesis that an increase in TYDC activity in
canola transformed with chimeric TYDC transgenes would increase the incorporation of tyramine and/or hydroxycinnamic acid
amides into cell walls and result in a corresponding decrease in cell
wall digestibility.
 |
MATERIALS AND METHODS |
Growth and Transformation of Canola
Two TYDC cDNAs from opium poppy (Papaver somniferum cv
Marianne) were placed under the transcriptional control of the CaMV 35S promoter. pBI35S::TYDC1 was constructed by
replacement of GUS between the KpnI and
SacI sites of pBI122 with a KpnI/SacI fragment from pBluescript (Stratagene) containing the TYDC1 cDNA (Facchini and De Luca, 1994
). pBI35S::TYDC2 was constructed
by replacement of GUS between the XbaI and
SacI sites of pBI122 with a XbaI/SacI
fragment from pBluescript containing the TYDC2 cDNA (Facchini and De
Luca, 1994
). pBI122 is a modified version of pBI121 (CLONTECH, Palo
Alto, CA) containing the restriction sites ApaI,
XhoI, and KpnI in an adapter fragment that was
inserted into the SmaI site between the 35S
promoter and GUS. pBI122 also harbors the NPT II
gene for kanamycin resistance under the control of the constitutive
NOS (nopaline synthase) promoter.
Plasmids were sequenced through the 35S
promoter-TYDC junction to verify construct assembly.
pBI35S::TYDC1 and pBI35S::TYDC2 were mobilized in
the disarmed Agrobacterium tumefaciens strain LB4404 by
direct DNA transfer (An, 1987
) and used to transform canola
(Brassica napus cv Westar) by the cotyledonary petiole
method (Moloney et al., 1989
). Plants were maintained in a growth
chamber at a PPFD of 400 µE m
2
s
1 and a light/dark regime of 16 h
(21°C)/8 h (15°C). Regenerated plants were tested for integration
of chimeric TYDC and NPT II genes into the canola
genome, TYDC and NPT II enzyme activities, and the presence of TYDC
mRNAs.
Nucleic Acid Isolation and Analysis
Genomic DNA was extracted by grinding 100 mg of leaf tissue in 400 µL of 200 mM Tris-HCl, pH 7.8, 250 mM NaCl,
0.5% SDS, and 25 mM EDTA. Debris were removed by
centrifugation, and DNA was precipitated with an equal volume of
isopropanol and recovered by centrifugation. The pellet was rinsed in
70% ethanol, dried, and redissolved in water. Fragments of
TYDC1 and TYDC2 were amplified by 30 PCR cycles
from 100 ng of genomic DNA using a primer-annealing temperature of
55°C and specific oligonucleotides designed from published sequences
(TYDC1 sense primer, AGGGACTACTTGTGAAGCCA; TYDC1 antisense primer,
ACTGATTCAAGCAATTTCGC; TYDC2 sense primer, ACTTCTTAGCTGATTATTAT; TYDC2
antisense primer, ACGGCATGAGTCATGTAAAC; Facchini and De Luca, 1994
).
PCR products were analyzed on 1% agarose gels containing ethidium
bromide.
Total RNA was isolated according to the method of Logemann et al.
(1987)
, and 15 µg was fractionated onto 1.0% formaldehyde agarose
gels before transfer to nitrocellulose membranes (Sambrook et al.,
1989
). RNA blots were hybridized to random-primer
32P-labeled (Feinberg and Vogelstein, 1984
) full-length
TYDC1 or TYDC2 cDNAs at 65°C in 0.25 M sodium phosphate,
pH 8.0, 7% SDS, 1% BSA, and 1 mM EDTA. Blots were washed
at 55°C, twice with 2× SSC containing 0.1% SDS and twice with 0.2×
SSC containing 0.1% SDS (Sambrook et al., 1989
) (1× SSC: 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0). RNA
blots were autoradiographed with an intensifying screen on Kodak X-OMAT
film at
80°C.
TYDC, THT, and NPT II Assays
For TYDC and THT assays, plant tissues were frozen under liquid
nitrogen and ground to a fine powder with a mortar and pestle. Powdered
tissues were extracted with 200 mM Tris-HCl, pH 7.8, debris
was removed by centrifugation, and the supernatant was desalted using a
PD-10 column (Pharmacia). TYDC activity was assayed by measuring the
release of 14CO2 from
L-[carboxyl-14C]Tyr
(Facchini and De Luca, 1994
). The TYDC assay contained 50 mM Tris-HCl, pH 7.8, 1 mM
EDTA, 25 µM pyridoxal-1-phosphate, 0.1 µCi
(specific activity = 55 mCi mmol
1)
[14C]Tyr, and 500 µL of protein extract
(total volume = 1 mL) in an airtight vial. Reactions were
incubated for 60 min at 35°C with constant agitation. Enzymatically
liberated 14CO2 was trapped
on quaternary ammonium-saturated GF/D filters suspended above
the reaction solution. Reactions were stopped by the addition of 0.2 N HCl and agitated for an additional 1 h
before scintillation counts from GF/D filters were determined.
4-Coumaroyl-CoA for the THT assay was enzymatically synthesized using
total protein extract from Escherichia coli harboring pQE19,
which expresses a recombinant tobacco 4-coumarate:coenzyme A ligase
(4CL) (Lee and Douglas, 1996
). The synthesis reaction consisted of 0.1 mM CoA, 0.2 mM 4-coumaric
acid (Sigma), 2.5 mM ATP, 1 mM DTT, and 300 mg of total bacterial protein
extract (Meng and Campbell, 1997
). After 1 h of incubation, the
synthesized 4-coumaroyl-CoA was purified using a Sep-Pak
C18 column (Waters). The 4-coumaroyl-CoA was
concentrated, and its identity and purity were confirmed by TLC and
comparison of the UV spectrum with that of an authentic standard. THT
activity was measured as described previously (Yu and Facchini, 1999
).
Ninety microliters of desalted enzyme extract in 50 mM Tris-HCl, pH 7.8, was incubated for 1 h
with 0.5 µCi of [8-14C]tyramine and 100 nmol
of 4-coumaroyl-CoA. Reactions were stopped by the addition of 1.0 M HCl, and 20 µL was applied to a silica gel 60 F254 TLC plate that was subsequently developed in
chloroform:methanol (5:4). The developed TLC plate was autoradiographed
for 12 h. Radiolabeled spots corresponding to 4-coumaroyltyramine
(RF = 0.82) were scraped off the plate and
radioactivity was quantified by liquid scintillation counting.
A dot-blot assay was used to determine the level of NPT II activity
(Radke et al., 1988
). Leaf tissue (100 mg) was extracted in 100 µL of
50 mM sodium phosphate, pH 7.0, 14 mM
-mercaptoethanol, 10 mM EDTA, 0.1% Sarcosyl, and 0.1%
Triton X-100. The soluble protein extract was incubated in 15 mM Tris-maleate, pH 7.0, 10 mM
MgCl2, 100 mM
NH4Cl, and 0.5 mM DTT with 10 µCi
of [
-32P]ATP (specific activity, 3000 Ci
mmol
1) in the presence or absence of 0.1 mg
mL
1 kanamycin at 37°C for 1 h.
Radiolabeled products were immobilized on P-81 paper (Whatman,
Maidstone, UK), which was then washed at 65°C for 1 h in 10 mM sodium phosphate, pH 7.0, containing 1.0% SDS. The P-81
paper was dried and autoradiographed for 24 h. The total protein
concentration of plant extracts was determined by the method of
Bradford (1976)
.
Extraction and Analysis of Amino Acids
Leaves (1 g) were freeze-dried and ground in 100% methanol (10:1
[v/w]). The homogenate was incubated at 60°C for 30 min and then
centrifuged for 15 min at 12,000g. The supernatant was
collected, and the pellet was extracted once more with 50% methanol.
The combined extracts were reduced to dryness and redissolved in 75 µL of dilution buffer containing 100 mM
NaHCO3 and 100 mM
H3BO3, pH 8.5. Twenty
microliters of the resuspended solution was mixed with 20 µL of
9-fluorenylmethyl chloroformate (20.7 mg mL
1)
(Varian, Sugarland, TX) and incubated at room temperature for 10 min to
generate fluorescent amino acid derivatives. After extraction of the
free fluorescent dye in 70 µL of pentane ethyl acetate (80:20), 20 µL of the aqueous phase containing the amino acid derivatives was
subjected to HPLC (Amino Tag column and Fluorichrome detector, Varian).
Each amino acid was quantified as a percentage of total amino acids.
Alkaline Hydrolysis and Analysis of Cell Walls
Leaves (1 g) were ground in 100% methanol (1:1 [w/v]). The
homogenate was incubated at 60°C for 30 min and then centrifuged for
15 min at 12,000g. The pellet was extracted two more times with 50% methanol, ensuring that no soluble aromatic compounds were
present. The pellet was then hydrolyzed in 1.0 M
NaOH for 4 h at 37°C. Insoluble debris were removed by
centrifugation. The supernatant was acidified (pH 2.0) with 6.0 M HCl and extracted three times with equal
volumes of ethyl acetate. The pooled ethyl acetate fractions were
reduced to dryness and the residue was recovered in methanol. Extracted
samples were applied to a silica gel 60 F254 TLC
plate, which was developed in chloroform:methanol (5:4). Authentic
standards displayed the following RF values: tyramine, 0.23; and 4-coumaroyltyramine, 0.82.
Tyramine in hydrolyzed cell walls extracts was quantified by HPLC on a
liquid chromatography system (BioSys 500, Beckman) and a photodiode
array detector (System Gold 168, Beckman) using a
C18 reverse phase column (4.6 × 250 mm;
Ultrasphere, Beckman) at 1200 psi with an isocratic gradient of
methanol:water (8:2) containing 0.1% triethylamine and a flow rate of
0.5 mL min
1. The tyramine peak was identified
from its UV spectrum and by comparison of its retention time with that
of an authentic standard.
Cell Wall Digestibility Measurement
Cell wall digestibility was determined by measuring the number of
protoplasts released after digestion of leaf tissue with hydrolytic
enzymes (Brisson et al., 1994
; Yao et al., 1995
). Leaf sections (5 mm)
were placed in a Petri dish containing 10 mL of plasmolysis solution
(50 mM Hepes, pH 5.5, 50 mM
CaCl2, and 500 mM mannitol). After
2 h of incubation, the plasmolysis solution was replaced with
enzymatic solution (50 mM Hepes, pH 5.5, 50 mM
CaCl2, 500 mM mannitol, 25 mg
mL
1 cellulase, and 3 mg
mL
1 pectinase). After 3 h of incubation,
the enzyme solution was removed, and 10 mL of high-density solution (50 mM Hepes, pH 5.5, 50 mM
CaCl2, and 500 mM Suc) was added to
allow the protoplasts to float. The high-density solution was
centrifuged at 3000g for 5 min, and the top 9 mL was
removed. Protoplasts in the remaining 1 mL were counted in a
hemocytometer.
Histochemical Analysis of Cell Walls
Cross-sections of leaves (approximately 500 µm thick) were
prepared by hand-sectioning, and aromatic compounds were monitored by
UV autofluorescence using a microscope (Aristoplan, Wild-Leitz, Wetzlar, Germany).
 |
RESULTS |
TYDC and THT Activities in Wild-Type Canola
The basal levels of TYDC and THT activity in various organs of
wild-type canola were determined. The highest levels of TYDC activity
were detected in roots (Fig. 2A). TYDC
activity in young leaves was approximately 17% of that in roots but
was considerably lower in mature leaves, stems, and flower buds. THT
activity was abundant in roots but was highest in mature leaves (Fig.
2B). Substantial THT activity was detected in flower buds but was found at lower levels in stems and young leaves.

View larger version (16K):
[in this window]
[in a new window]
| Figure 2.
TYDC and THT activities in wild-type canola. Bars
represent the means ± SE of three experiments.
|
|
Transformation of Canola with Chimeric TYDC Genes
Approximately 2000 canola cotyledonary petioles were treated with
A. tumefaciens harboring either pBI35S::TYDC1 or
pBI35S::TYDC2. Two putative 35S::TYDC1
(BN10 and BN11) and 13 putative 35S::TYDC2 (BN23
through BN219) transgenic plants were regenerated under kanamycin
selection (Fig. 3). Regeneration
efficiencies were 0.2% for 35S::TYDC1 and 1.3%
for 35S::TYDC2. As a control, canola cotyledonary petioles were treated with A. tumefaciens harboring pBI122
and a regeneration efficiency of 18% was obtained. In comparison, the
regeneration efficiency for canola cotyledonary petioles treated with
A. tumefaciens harboring pCGN 783 was reported at 83%, and the transformation efficiency was estimated at 55% (Moloney et al.,
1989
). Furthermore, 85 putative transgenic canola plants were
regenerated after treatment of stem segments with A. tumefaciens harboring a chimeric TDC gene in pBI 121, of which 11 were confirmed as transgenic (Chavadej et al., 1994
).

View larger version (62K):
[in this window]
[in a new window]
| Figure 3.
PCR assay demonstrating the integration of
chimeric opium poppy TYDC1 and TYDC2
transgenes into the canola genome. Genomic DNA from two canola lines
transformed with 35S::TYDC1 (BN10 and BN11)
and 13 canola lines transformed with
35S::TYDC2 (BN23 through BN219) were used as
templates for PCR with either TYDC1- or
TYDC2-specific primers. Cloned opium poppy TYDC1
(pTYDC1) and TYDC2 (pTYDC2) cDNAs were used as positive control
templates, whereas extracted wild-type canola genomic DNA (WT) was used
as a negative control template.
|
|
Regenerated kanamycin-resistant plants were allowed to flower and set
seed. Each T0 plant was tested for the presence
of the chimeric TYDC1 or TYDC2 transgenes. PCR
results suggested that all regenerated plants were transgenic (Fig. 3).
No PCR products were amplified with either TYDC1- or
TYDC2-specific primers using wild-type genomic DNA as a
template. Further evidence for the transformation of regenerated plants
was obtained by direct assay for NPT II activity. Plants transformed
with NOS::NPT II are resistant to kanamycin
because NPT II phosphorylates and, consequently, detoxifies the
antibiotic. The dot-blot assay shown in Figure 4 illustrates the relative levels of NPT
II activity in regenerated T0 plants. No
radioactivity was immobilized on the P-81 paper in the absence of
kanamycin. NPT II activity was not detected in wild-type plants but was
detected in 14 putative transformants (Fig. 4). NPT II activity in
T0 plants confirms that transgenes were inserted
into transcriptionally active genomic regions.

View larger version (47K):
[in this window]
[in a new window]
| Figure 4.
NPT II dot-blot assay of leaf extracts from
putative T0 transgenic canola plants. Labeling reactions
were performed with [ -32P]ATP and plant extracts in
the presence (+Kan) or absence ( Kan) of kanamycin. The negative
control was wild-type (WT) canola. BN10 and BN11 were transformed with
35S::TYDC1, whereas all other plants were
transformed with 35S::TYDC2.
|
|
TYDC Activity in Consecutive Generations of Transgenic Canola
TYDC activity levels in young leaves of T0
plants are shown in Figure 5. Despite
detectable NPT II activity in all but one primary transformant, most
T0 plants showed suppressed levels of wild-type
TYDC activity. In BN10 and BN213, TYDC activity was similar to that in
wild-type plants, but in BN11, BN212, and BN214, it was less than 20%
of the wild-type level. The mean TYDC activity of all primary
transformants was approximately 50% of that in wild-type plants. TYDC1
and TYDC2 mRNAs were not detected in T0 plants
(data not shown), suggesting that a trans-silencing
mechanism might be responsible for the suppressed
35S::TYDC expression and endogenous TYDC activity
(Matzke and Matzke, 1995
). Although a canola TYDC cDNA was not
available to measure endogenous TYDC mRNA levels, the apparent homology
among known TYDC genes across species is sufficiently low (Facchini and
De Luca, 1994
) to ensure that opium poppy TYDC probes did not hybridize
with canola TYDC mRNAs under high-stringency conditions. Although no
definite conclusions about the silencing of endogenous canola TYDC
genes can be drawn, our data clearly show the specific silencing of
35S::TYDC transgenes.

View larger version (38K):
[in this window]
[in a new window]
| Figure 5.
Relative TYDC activity in young leaves of
T0 canola transformed with
35S::TYDC1 (BN10 and BN11) and
35S::TYDC2 (BN23 through BN219). The relative
TYDC activity in wild-type (WT) leaves is shown for comparison. Bars
represent the means ± SE of three experiments. TYDC
specific activity in wild-type leaves was approximately 20 pkat
mg 1 protein.
|
|
Two transgenic canola lines were selected to analyze the inheritance of
TYDC suppression. BN11 (35S::TYDC1) and BN214
(35S::TYDC2) showed the most severely suppressed
TYDC activity among T0 plants (Fig. 5) but
exhibited high levels of NPT II activity (Fig. 4). All BN11 and BN214
T1 plants tested positive for the presence of
TYDC transgenes by PCR analysis. This departure from the
expected segregation ratio for a hemizygous single-copy gene suggests
that TYDC transgenes were present in multiple copies in
T0 plants. TYDC activity in the
T1 progeny of BN214 was suppressed relative to
wild-type plants (Fig. 6) and was within
a range similar to that displayed by T0 plants
transformed with 35S::TYDC2 (Fig. 5). Among 11 tested BN214 T1 plants, the mean TYDC activity
was approximately 55% of the wild-type level. In contrast, TYDC
activity increased in BN11 T1 progeny relative to
the wild-type level (Fig. 6). The mean TYDC activity among BN11
T1 plants was 3-fold higher than the wild-type
level and was 15-fold higher than the BN11 T0
parent.

View larger version (26K):
[in this window]
[in a new window]
| Figure 6.
Relative TYDC activity in young leaves of the
T1 progeny of BN11 (35S::TYDC1)
and BN214 (35S::TYDC1) canola lines. The
relative TYDC activity in wild-type (WT) leaves is shown for
comparison. Bars represent the means ± SE of three
experiments. TYDC specific activity in wild-type leaves was
approximately 20 pkat mg 1 protein.
|
|
TYDC1 mRNAs were detected in young leaves of all
T1 progeny of BN11 (Fig.
7). In contrast, TYDC2 mRNAs were not
detected in any BN214 T1 progeny, and homologous
TYDC mRNAs were not detected in wild-type leaves (Fig. 7). These data
show that silencing of 35S::TYDC1 was
overcome in BN11 T1 plants, but
35S::TYDC2 silencing was maintained in
BN214 T1 plants. The T1
progeny of two other T0 plants, BN10
(35S::TYDC1) and BN212
(35S::TYDC2), were tested to verify the
reproducibility of transgene inheritance and expression. TYDC1 mRNAs
were detected in all BN10 T1 progeny, which also
exhibited higher levels of TYDC activity compared with wild-type plants (data not shown). In contrast, all BN212 T1
progeny showed suppressed levels of TYDC activity compared with
wild-type plants, and TYDC1 mRNAs were not detected (data not shown).
Thus, the reversion of transgene suppression from the
T0 to T1 generations in
plants transformed with 35S::TYDC1 (BN10 and
BN11), and the continued transgene silencing in
T1 plants transformed with
35S::TYDC2 (BN212 and BN214), occurred in
independent transgenic lines.

View larger version (48K):
[in this window]
[in a new window]
| Figure 7.
Gel-blot analysis of RNA from young leaves of the
T1 progeny of BN11 (35S::TYDC1)
and BN214 (35S::TYDC1) canola lines. RNA
extracted from young leaves of wild-type (WT) canola plants was used as
a control. Total RNA was extracted and 15 µg was fractionated on
1.0% formaldehyde agarose gels, transferred to nylon membranes, and
hybridized at high stringency with 32P-labeled
TYDC1- or TYDC2-specific probes. Gels
were stained with ethidium bromide before blotting to ensure equal
loading.
|
|
TYDC activity did not increase above wild-type levels through four
successive generations of the BN214 line (Fig.
8). Mean TYDC activity among BN214
progeny increased from approximately 50% of wild-type levels in
T1 plants to near-wild-type levels in
T3 plants. TYDC mRNAs were not detected in the
T2 or T3 progeny of BN214
(data not shown). Mean TYDC activity among BN11 progeny decreased from
maximum levels found in T1 plants to nearly
wild-type levels in T3 plants (Fig. 8). TYDC mRNA
levels also decreased in T2 plants to less than
20% of those found in T1 plants and, ultimately,
to undetectable levels in T3 plants (data not
shown). All T2 and T3
plants derived from BN11 and BN214 lines tested positive for the
presence of TYDC transgenes by PCR analysis. The failure to
recover the parental genotype through three generations is consistent
with the suggested multiple insertion of TYDC transgenes in
T0 plants.

View larger version (27K):
[in this window]
[in a new window]
| Figure 8.
Relative mean TYDC activity in young leaves of
successive self-pollinated generations (T1, T2,
and T3 plants) derived from BN11
(35S::TYDC1) and BN214
(35S::TYDC1) canola lines. The relative TYDC
activity in wild-type (WT) canola leaves is shown for comparison. Bars
represent the means ± SE. TYDC specific activity in
wild-type leaves was equal to approximately 20 pkat mg 1
protein.
|
|
Aromatic Amino Acid and Cell Wall-Bound Amine Analysis
In two T1 plants, BN11-6 and BN11-9
(35S::TYDC1), TYDC activity in young leaves was 3- to 4-fold higher than wild-type levels (Fig. 6). In two other
T1 plants, BN214-2 and BN214-6
(35S::TYDC2), TYDC activity in young leaves was
only 30% of wild-type levels (Fig. 6). Internal cellular pools of
amino acids were measured in young leaves of these
T1 plants and compared with wild-type plants.
Although the concentration of most amino acids did not vary (data not
shown), Tyr pools were somewhat lower and higher in the tested
T1 progeny of BN11 and BN214, respectively,
relative to wild-type controls (Table I).
In contrast, Phe pools were not significantly different in the tested
T1 progeny of BN11 and BN214 compared with
wild-type plants (Table I). Differences in TYDC activity and amino acid
levels between wild-type and transgenic plants were much less apparent
in mature leaves.
View this table:
[in this window]
[in a new window]
|
Table I.
Analysis of aromatic amino acids in young leaves and
cell wall-bound tyramine levels in mature leaves from wild-type and
transgenic canola plants
Values represent the means ± SE of four
independent measurements.
|
|
Neither tyramine nor hydroxycinnamic acid amides of tyramine were
detected in methanol extracts from young or mature leaves, stems, or
roots of wild-type or transgenic plants. However, cell wall-bound
tyramine levels increased 2-fold in mature BN11-6 and BN11-9 leaves
compared with wild-type plants (Table I). In contrast, cell wall-bound
tyramine extracted from mature BN214-2 and BN214-6 leaves was similar
to wild-type levels (Table I). No difference in cell wall-bound
tyramine was detected in young leaves from wild-type and transgenic
plants.
The difference in cell wall-bound tyramine levels between some
transgenic and wild-type plants prompted a microscopic examination of
UV autofluorescence in corresponding leaf sections. This method has
been used for the detection of cell wall-bound phenolic amides (Clarke,
1982
), ferulic acid (Nicholson, 1992
; Kato et al., 1994
), and lignin
and suberin (Monties, 1989
; Schmutz et al., 1993
). As shown in Figure
9, the autofluorescence intensity of
mesophyll cells from mature BN11-9 leaves (Fig. 9B) was stronger than
that from mature, wild-type leaves (Fig. 9A). In contrast, the
autofluorescence intensity of mesophyll cells from mature BN214-6
leaves (Fig. 9C) was weaker than that from mature wild-type leaves
(Fig. 9A). Relative autofluorescence intensity was consistent in plants
that showed similar levels of TYDC activity. No difference in
autofluorescence intensity was detected in young leaves from wild-type
or transgenic plants.

View larger version (59K):
[in this window]
[in a new window]
| Figure 9.
UV autofluorescence microscopy
of leaf mesophyll cross-sections from wild-type (A) and transgenic (B
and C) canola plants. B, BN11-9 leaf; C, BN214-6 leaf. Tissues were
photographed immediately after hand sectioning. Magnification, ×150.
|
|

View larger version (16K):
[in this window]
[in a new window]
| Figure 10.
Comparison of relative TYDC activity with
protoplast release efficiency in mature leaves of individual
T2 and T3 progeny of BN11
(35S::TYDC1) and BN214
(35S::TYDC2) transgenic canola lines. TYDC
activity and protoplast release efficiency were measured in the same
leaf. Wild-type TYDC activity (100%) was equal to approximately 10 pkat mg 1 protein.
|
|
Cell Wall Digestibility
Oxidative crosslinking of hydroxycinnamic acid amides of tyramine
in the cell wall has been suggested to increase cell wall strength and
provide a barrier against microbial penetration (Clarke, 1982
; Negrel
et al., 1993a
). The cell wall digestibility of leaves from wild-type
and transgenic plants was tested by measuring the number of protoplasts
released after incubation with cellulase and pectinase (Brisson et al.,
1994
; Yao et al., 1995
). This approach assumes that the efficiency of
protoplast release is directly proportional to cell wall digestibility.
No significant difference in protoplast release efficiency was found in
young leaves from wild-type or transgenic plants (data not shown).
However, BN11-6 and BN11-9 leaf sections released an average of only
42% of the protoplasts released by wild-type leaf sections (Table
II). In contrast, BN214-2 and BN214-6
leaf sections released an average of 87% more protoplasts than
wild-type canola leaf sections (Table II).
View this table:
[in this window]
[in a new window]
|
Table II.
Release of protoplasts from wild-type and
transgenic mature canola leaves
Values represent the means ± SE from three
independent experiments.
|
|
Data presented in Table II suggest a correlation between TYDC activity
and cell wall digestibility in select T1 (i.e.
those with the highest and lowest levels of TYDC activity) and
wild-type plants. To further test this relationship, protoplast release efficiency was directly compared with relative TYDC activity in mature
leaves from randomly selected T2 and
T3 progeny of the BN11 and BN214 transgenic lines
(Fig. 10). The mean TYDC activity approached wild-type levels in
successive progeny of both lines (Fig. 8), but individual
T2 and T3 plants displayed
a wide range of relative TYDC activity. As shown in Figure 10, high
levels of TYDC activity correlated with reduced protoplast release
efficiency, whereas low levels of TYDC activity relative to wild-type
plants resulted in an increased recovery of protoplasts.
 |
DISCUSSION |
Canola was transformed with chimeric transgenes under the
transcriptional control of the CaMV 35S promoter and
encoding two TYDC isoforms from opium poppy. The transgenic plants were
used to test the hypothesis that higher levels of TYDC activity will promote the conversion of the cellular Tyr pool to tyramine, which in
turn will increase cell wall-bound hydroxycinnamic acid amide formation. Elevated amide levels would be expected to decrease cell
wall susceptibility to digestion by hydrolytic enzymes.
Increased TYDC activity in transgenic plants is potentially harmful
because of the phytotoxicity of hydroxyphenylethylamines such as
tyramine (Negrel et al., 1993b
). Detoxification of tyramine was
reported in cultured tobacco cells only under conditions that favored
THT induction. The exclusive recovery of T0
plants with suppressed TYDC activity relative to wild-type plants (Fig.
5) suggests that expression of 35S::TYDC
transgenes inhibited the plant-regeneration process. Moreover, the low
transformation efficiency is consistent with the suggestion that only
T0 plants that exhibited specific
trans-silencing of 35S::TYDC1 and
35S::TYDC2, but not NOS::NPT
II, were recovered. In contrast, tobacco transformed with
35S::TDC (Songstad et al., 1990
) was reported to
accumulate both soluble tryptamine and tyramine because of a proposed
modification in the substrate specificity of Trp decarboxylase in
tobacco (Songstad et al., 1991
). Similarly, canola (Chavadej et al.,
1994
) and potato (Yao et al., 1995
) transformed with
35S::TDC accumulated high levels of tryptamine
without any apparent adverse effects; therefore, we cannot rule out the
possibility that the transformation efficiency was low for unknown
reasons.
In the BN10 and BN11 lines, 35S::TYDC1 was active
in T1 plants, whereas
35S::TYDC2 remained silent in all transgenic
progeny of the BN212 and BN214 lines. The consistent results obtained for independent lines transformed with each construct suggests that
transgene expression was related to the specific nucleotide sequences
of TYDC1 and TYDC2. Expression of
35S::TYDC transgenes might have been affected by
homologous TYDC genes in canola (Matzke and Matzke, 1995
).
TYDC genes from opium poppy (Facchini and De Luca, 1994
) and
parsley (Kawalleck et al., 1993
) share >60% nucleotide identity.
Similar homology between TYDC genes from opium poppy and
canola is probable. Reactivation of a silenced transgene after passage
through successive generations has been reported previously. For
example, transformation of tobacco with the bean PAL2 gene resulted in transgenic plants with severely reduced PAL activity (Elkind et al., 1990
). The sense suppression of PAL in
T0 plants was progressively overcome in pedigrees
of homozygous progeny (Bate et al., 1994
). A
-1,3-glucanase
transgene (gn1) in tobacco driven by the CaMV 35S
promoter was silent during seed germination and vegetative growth but
was activated in meiotically derived seed tissues (Castresana and
Balandin, 1997
). Expression of gn1 was not
reactivated in plantlets regenerated mitotically from leaf explants of
gn1-suppressed plants.
Reactivation of 35S::TYDC1 in canola might also
require passage through meiosis. The expression of
NOS::NPT II in T0 plants shows that T-DNA insertions occurred in transcriptionally active genomic regions (Fig. 4). NPT II activity was detected in consecutive generations of all transgenic lines except BN219 (data not shown); thus, the silencing of 35S::TYDC1 in
T0 plants, its reactivation in
T1 plants, and its subsequent and gradual
re-suppression in T2 and T3
plants are related to the TYDC transgene. Canola might be
prone to silencing aromatic amino acid decarboxylase transgenes. Expression of a 35S::TDC transgene in canola,
which was not initially silenced in T0 plants
(Chavadej et al., 1994
), also became completely suppressed over four
successive generations (V. De Luca, personal communication). Such
meiotically heritable alterations in transgene activity have been
demonstrated for trans-silencing mechanisms mediated by
reading frame (Matzke and Matzke, 1995
) and promoter homology (Park et
al., 1996
). TYDC1 mRNA levels in BN11 T1 progeny did not always translate into a proportional increase in TYDC activity
(Figs. 6 and 7), suggesting that posttranslational regulation of
heterologous TYDC activity might have also occurred in plants that
expressed 35S::TYDC1.
The increase in TYDC activity in young leaves of BN11-6 and BN11-9
T1 plants resulted in decreased cellular Tyr
pools and increased cell wall-bound tyramine in corresponding mature
leaves compared with wild-type plants (Table I). In contrast, the
increased Tyr pools in young leaves of BN214-2 and BN214-6 plants are
consistent with the reduced TYDC activity relative to wild-type levels.
TYDC activity levels were not much different in mature leaves of
transgenic plants, so little difference was found between the cellular
Tyr pools of mature leaves. In contrast, increased cell wall-bound tyramine levels were only detected in mature leaves that also showed
high THT activity. A temporal discrepancy between the optimum expression of TYDC transgenes and the maximum
insolubilization of tyramine was apparent; therefore, TYDC activity was
altered most abundantly in young leaves, but cell wall modifications
(i.e. tyramine levels and digestibility) were not detectable until
leaves matured. This discrepancy might be related to the transient
nature of heterologous TYDC activity in canola and the low endogenous THT activity in young leaves.
Our data provide in vivo evidence that the formation of tyramine
represents a sink for Tyr in canola and that TYDC activity appears to
determine, at least in part, the level of cell wall-bound tyramine in
mature leaves. This conclusion is supported by the kinetic properties
of THT from various species. THT follows Michalis-Menton kinetics in
the presence of low concentrations of hydroxycinnamoyl-CoA derivatives
but exhibits negative cooperativity at concentrations above 2 to 3 µM, resulting in a decrease in the affinity for tyramine (Hohlfeld et al., 1995
; Negrel and Javelle, 1997
; Yu and Facchini, 1999
). This negative cooperativity has been proposed as a physiological mechanism involved in the regulation of amide biosynthesis (Negrel and
Javelle, 1997
). The cellular concentrations of hydroxycinnamoyl-CoA derivatives are probably much lower than the level of tyramine (Hahlbrock and Scheel, 1989
). Negative cooperativity implies that an
increase in the cellular tyramine pool will lead to an increase in
amide formation, even at constant levels of hydroxycinnamoyl-CoA derivatives (Negrel and Javelle, 1998). An increase in the cellular pool of hydroxycinnamoyl-CoA esters would result in increased amide
formation only if tyramine levels also increase; thus, the level of
TYDC activity should play a role in the regulation of cell wall-bound
amide biosynthesis.
Tyramine released by alkaline hydrolysis was probably insolubilized in
cell walls as hydroxycinnamic acid amides. The harsh treatment required
to extract tyramine would also be expected to hydrolyze amide bonds. In
addition, most amides are highly cross-linked in the cell wall,
preventing their extraction by alkaline hydrolysis. Numerous bond types
between cell wall components and tyramine derivatives have been
demonstrated (Borg-Olivier and Monties, 1993
).
UV autofluorescence examination of leaf sections from transgenic canola
confirmed that cell wall modification had occurred (Fig. 9). The
stronger autofluorescence of mature mesophyll cell walls from BN11-6
and BN11-9 T1 plants relative to wild-type leaves suggests an increased content of aromatic residues. In contrast, the
weaker autofluorescence of mature mesophyll cell walls from BN214-2 and
BN214-6 T1 plants suggests a reduced
incorporation of aromatic compounds. These data are consistent with the
relative levels of tyramine solubilized from cell walls of wild-type
and transgenic plants (Table I). However, the alkaline-hydrolyzed tyramine might not reflect the entire hydroxycinnamic acid amide content of the cell walls; thus, UV autofluorescence intensity might
not always have been proportional to extracted tyramine levels.
A change in the availability of tyramine could be expected to result in
an alteration of cell wall strength, because tyramine-derived amides
are purported to become oxidatively cross-linked, together with other
phenolics, in the cell wall (Clarke, 1982
; Negrel and Lherminier, 1987
; Matern and Kneusel, 1988
; Iiyama et al., 1994
). An
inverse relationship between the level of TYDC activity and the
susceptibility of cell walls to enzymatic hydrolysis was revealed by
measuring protoplast release efficiency (Fig. 10). Protoplast recovery
from mature leaf sections was reduced by 60% in BN11-6 and BN11-9
T1 plants, with a mean TYDC activity that was 3- to 4-fold higher than that in wild-type plants (Table II). In contrast, the 50% reduction in mean TYDC activity in BN214-2 and BN214-6 T1 plants corresponded to an increase in the cell
wall digestibility of mature leaves. The similar protoplast release
efficiency of young leaf tissue from wild-type and transgenic plants
was consistent with our inability to detect differences in cell
wall-bound tyramine levels in young leaves with altered TYDC activity.
We have shown that 35S::TYDC transgenes in canola
are subject to transcriptional silencing mechanisms. In transgenic
plants with elevated TYDC activity, internal Tyr pools decreased and cell wall-bound tyramine levels increased compared with wild-type plants. Increased TYDC activity also correlated with decreased enzymatic digestibility of cell walls. Overall, our data suggest that
TYDC and tyramine affect cell wall properties that might have implications in plant-pathogen interactions.
 |
FOOTNOTES |
1
This work was supported by grants from the
Natural Sciences and Engineering Research Council of Canada and the
Alberta Agricultural Research Institute to P.J.F.
*
Corresponding author; e-mail pfacchin{at}ucalgary.ca; fax
1-403-289-9311.
Received December 7, 1998;
accepted April 5, 1999.
 |
ABBREVIATIONS |
Abbreviations:
CaMV, cauliflower mosaic virus.
NPT, neomycin
phosphotransferase.
PAL, phenylalanine ammonia lyase.
THT, tyramine
hydroxycinnamoyltransferase.
TYDC, Tyr/dihydroxyphenylalanine
decarboxylase.
 |
ACKNOWLEDGMENTS |
We thank Dr. Carl Douglas (University of British Columbia,
Canada) for the gift of the pQE19 plasmid, Dr. Ed Yeung (University of
Calgary, Canada) for assistance with the autofluorescence microscopy, and Dr. Gabriel Guillet (Université de Montréal, Canada)
for the amino acid analysis.
 |
LITERATURE CITED |
An G
(1987)
Binary Ti vectors for plant transformation and promoter analysis.
Methods Enzymol
153:
292-305
Bate NJ,
Orr J,
Ni W,
Meromi A,
Nadler-Hassar T,
Dierner PW,
Dixon RA,
Lamb CJ,
Elkind Y
(1994)
Quantitative relationship between phenylalanine ammonia-lyase levels and phenylpropanoid accumulation in transgenic tobacco identifies a rate-determining step in natural product synthesis.
Proc Natl Acad Sci USA
91:
7608-7612
[Abstract/Free Full Text]
Borg-Olivier O,
Monties B
(1993)
Lignin, suberin, phenolic acids, and tyramine in the suberized wound-induced periderm.
Phytochemistry
32:
601-606
[CrossRef]
Bradford MM
(1976)
A rapid and sensitive method for quantitation of microgram quantities of protein using the principle of protein-dye binding.
Anal Biochem
72:
248-254
[CrossRef][Web of Science][Medline]
Brisson LF,
Tenhaken R,
Lamb CJ
(1994)
Function of oxidative cross-linking of cell wall structural proteins in plant disease resistance.
Plant Cell
6:
1703-1712
[Abstract/Free Full Text]
Castresana C,
Balandin T
(1997)
Silencing of a
-1,3-glucanase transgene is overcome during seed formation.
Plant Mol Biol
34:
125-137
[CrossRef][Medline]
Chavadej S,
Brisson N,
McNeil JN,
De Luca V
(1994)
Redirection of tryptophan leads to production of low indole glucosinolate canola.
Proc Natl Acad Sci USA
91:
2166-2170
[Abstract/Free Full Text]
Clarke DD (1982) The accumulation of cinnamic acid amides in the
cell walls of potato tissues as an early response to fungal attack.
In RKS Wood, ed, Active Defense Mechanisms in Plants, Vol
37. NATO Advanced Study Institute Series A: Life Sciences. Plenum
Press, New York, pp 321-322
Elkind Y,
Edwards R,
Mavandad M,
Hedrick SA,
Ribak O,
Dixon RA,
Lamb CJ
(1990)
Abnormal plant development and down-regulation of phenylpropanoid biosynthesis in transgenic tobacco containing a heterologous phenylalanine ammonia lyase gene.
Proc Natl Acad Sci USA
87:
9057-9061
[Abstract/Free Full Text]
Facchini PJ,
De Luca V
(1994)
Differential and tissue-specific expression of a gene family for tyrosine/dopa decarboxylase in opium poppy.
J Biol Chem
269:
26684-26690
[Abstract/Free Full Text]
Facchini PJ,
Johnson AG,
Poupart J,
De Luca V
(1996)
Uncoupled defense gene expression and antimicrobial alkaloid accumulation in elicited opium poppy cell cultures.
Plant Physiol
111:
687-697
[Abstract]
Facchini PJ,
Penzes-Yost C,
Samanani N,
Kowalchuk B
(1998)
Expression patterns conferred by tyrosine/dihydroxyphenylalanine decarboxylase promoters from opium poppy are conserved in transgenic tobacco.
Plant Physiol
118:
69-81
[Abstract/Free Full Text]
Feinberg AP,
Vogelstein B
(1984)
A technique for radiolabeling DNA restriction endonuclease fragments for high specific activity.
Anal Biochem
137:
266-269
[CrossRef][Web of Science][Medline]
Fleurence J,
Negrel J
(1987)
Partial purification of tyramine feruloyl transferase from TMV inoculated tobacco leaves.
Phytochemistry
28:
733-736
[CrossRef]
Hahlbrock K,
Scheel D
(1989)
Physiology and molecular biology of phenylpropanoid metabolism.
Annu Rev Plant Physiol Plant Mol Biol
40:
347-369
[CrossRef][Web of Science]
Hohlfeld H,
Scheel D,
Strack D
(1996)
Purification of hydroxycinnamoyl-CoA: tyramine hydroxycinnamoyltransferase from cell-suspension cultures of Solanum tuberosum L. cv. Datura.
Planta
199:
166-168
Hohlfeld H,
Schürmann W,
Scheel D,
Strack D
(1995)
Partial purification and characterization of hydroxycinnamoyl-coenzyme A. Tyramine hydroxycinnamoyltransferase from cell suspension cultures of Solanum tuberosum.
Plant Physiol
107:
545-552
[Abstract]
Hosoi K,
Yoshida S,
Hasegawa M
(1970)
L-Tyrosine carboxylyase of barley roots.
Plant Cell Physiol
11:
899-906
[Abstract/Free Full Text]
Iiyama K,
Lam TBT,
Stone BA
(1994)
Covalent cross-links in the cell wall.
Plant Physiol
104:
315-320
[Web of Science][Medline]
Kato Y,
Yamanouchi H,
Hinata K,
Ohsumi C,
Hayashi T
(1994)
Involvement of phenolic esters in cell aggregation of suspension-cultured rice cells.
Plant Physiol
104:
147-152
[Abstract]
Kawalleck P,
Keller H,
Hahlbrock K,
Scheel D,
Somssich IE
(1993)
A pathogen-responsive gene of parsley encodes tyrosine decarboxylase.
J Biol Chem
268:
2189-2194
[Abstract/Free Full Text]
Lee D,
Douglas CJ
(1996)
Two divergent members of a tobacco 4-coumerate:coenzyme A ligase (4CL) gene family. cDNA structure, gene inheritance and expression, and properties of recombinant proteins.
Plant Physiol
112:
193-205
[Abstract]
Logemann J,
Schell J,
Willmitzer L
(1987)
Improved method for the isolation of RNA from plant tissues.
Anal Biochem
163:
16-20
[CrossRef][Web of Science][Medline]
Maher EA,
Bate NJ,
Ni W,
Elkind Y,
Dixon RA,
Lamb CJ
(1994)
Increased disease susceptibility of transgenic tobacco plants with suppressed levels of preformed phenylpropanoid products.
Proc Natl Acad Sci USA
91:
7802-7806
[Abstract/Free Full Text]
Marques IA,
Brodelius P
(1988)
Elicitor-induced L-tyrosine decarboxylase from plant cell suspension cultures. II. Partial characterization.
Plant Physiol
88:
52-55
[Abstract/Free Full Text]
Martin-Tanguy J,
Cabanne F,
Perdrizet E,
Martin C
(1978)
The distribution of hydroxycinnamic acid amides in flowering plants.
Phytochemistry
17:
1927-1928
[CrossRef]
Matern U,
Kneusel RE
(1988)
Phenolic compounds in plant disease resistance.
Phytoparasitica
16:
153-170
Matzke MA,
Matzke AJM
(1995)
How and why do plants inactivate homologous (trans)genes?
Plant Physiol
107:
679-685
[Web of Science][Medline]
Meng H,
Campbell WH
(1997)
Facile enzymatic synthesis of caffeoyl CoA.
Phytochemistry
44:
605-608
[CrossRef]
Moloney MM,
Walker J,
Sharma KK
(1989)
High efficiency transformation of Brassica napus using Agrobacterium vectors.
Plant Cell Rep
8:
238-242
[CrossRef]
Monties B
(1989)
Lignins.
In
PM Dey,
JB Harbourne,
eds, Methods in Plant Biochemistry: Plant Phenolics, Vol 1.
Academic Press, London, pp 113-157
Negrel J,
Javelle F
(1997)
Purification, characterization, and partial amino acid sequencing of hydroxycinnamoyl-CoA:tyramine N-(hydroxycinnamoyl)transferase from tobacco cell-suspension cultures.
Eur J Biochem
247:
1127-1135
[Web of Science][Medline]
Negrel J,
Javelle F,
Paynot M
(1993a)
Wound-induced tyramine hydroxycinnamoyl transferase in potato (Solanum tuberosum) tuber discs.
J Plant Physiol
142:
518-524
Negrel J,
Javelle F,
Paynot M
(1993b)
Biochemical basis of resistance of tobacco callus tissue cultures to hydroxyphenylethylamines.
Plant Physiol
103:
329-334
[Abstract]
Negrel J,
Jeandet P
(1987)
Metabolism of tyramine and feruloyltyramine in TMV-inoculated leaves of Nicotiana tabacum.
Phytochemistry
26:
2185-2190
[CrossRef]
Negrel J,
Lherminier J
(1987)
Peroxidase-mediated integration of tyramine into xylem cell walls of tobacco leaves.
Planta
172:
494-501
[CrossRef]
Negrel J,
Martin
(1984)
The biosynthesis of feruloyltyramine in Nicotiana tabacum.
Phytochemistry
23:
2797-2801
[CrossRef]
Nicholson RL
(1992)
Phenolic compounds and their role in disease resistance.
Annu Rev Phytopathol
30:
369-389
[Web of Science]
Park Y-D,
Papp I,
Moscone EA,
Iglesias VA,
Vaucheret H,
Matzke AJM,
Matzke MA
(1996)
Gene silencing mediated by promoter homology occurs at the level of transcription and results in meiotically heritable alterations in methylation and gene activity.
Plant J
9:
183-194
[CrossRef][Web of Science][Medline]
Radke SE,
Andrews BM,
Moloney MM,
Crouch ML,
Kridl JC,
Knauf VC
(1988)
Transformation of Brassica napus L. using Agrobacterium tumefaciens: developmentally regulated expression of a reintroduced napin gene.
Theor Appl Genet
75:
685-694
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Schmelzer E,
Krüger-Lebus S,
Hahlbrock K
(1989)
Temporal and spatial patterns of gene expression around sites of attempted fungal infection in parsley leaves.
Plant Cell
1:
993-1001
[Abstract/Free Full Text]
Schmidt A,
Scheel D,
Strack D
(1998)
Elicitor-stimulated biosynthesis of hydroxycinnamoyltyramines in cell suspension cultures of Solanum tuberosum.
Planta
205:
51-55
[CrossRef]
Schmutz A,
Jenny T,
Amrhein N,
Ryser U
(1993)
Caffeic acid and glycerol are constituents of the suberin layers in green cotton fibres.
Planta
189:
453-460
[CrossRef][Web of Science]
Showalter AM,
Bell JN,
Cramer CL,
Bailey JA,
Varner JE,
Lamb CJ
(1985)
Accumulation of hydroxyproline-rich glycoprotein mRNAs in response to fungal elicitor and infection.
Proc Natl Acad Sci USA
82:
6551-6555
[Abstract/Free Full Text]
Songstad DD,
De Luca V,
Brisson N,
Kurz WGW,
Nessler CL
(1990)
High levels of tryptamine accumulation in transgenic tobacco expressing tryptophan decarboxylase.
Plant Physiol
94:
1410-1413
[Abstract/Free Full Text]
Songstad DD,
Kurz WGW,
Nessler CL
(1991)
Tyramine accumulation in Nicotiana tabacum transformed with a chimeric tryptophan decarboxylase gene.
Phytochemistry
30:
3245-3246
[CrossRef]
Tocher RD,
Tocher CS
(1972)
Dopa decarboxylase in Cytisus scoparius.
Phytochemistry
11:
1661-1667
[CrossRef]
Trezzini GF,
Horrichs A,
Sommssich IE
(1993)
Isolation of putative defense-related genes from Arabidopsis thaliana and expression in fungal elicitor-treated cells.
Plant Mol Biol
21:
385-389
[CrossRef][Web of Science][Medline]
Villegas M,
Brodelius P
(1990)
Elicitor-induced hydroxycinnamoyl-CoA:tyramine hydroxycinnamoyltransferase in plant cell suspension cultures.
Physiol Plant
78:
414-420
[CrossRef]
Yao K,
De Luca V,
Brisson N
(1995)
Creation of a metabolic sink for tryptophan alters the phenylpropanoid pathway and the susceptibility of potato to Phytophthora infestans.
Plant Cell
7:
1787-1799
[Abstract]
Yu M, Facchini PJ (1999) Purification, characterization, and
immunolocalization of hydroxycinnamoyl-CoA: tyramine
N-(hydroxycinnamoyl)transferase from opium poppy. Planta
(in press)