Plant Physiol. (1999) 120: 739-746
Lysophosphatidic Acid Acyltransferase from Coconut Endosperm
Mediates the Insertion of Laurate at the sn-2 Position of
Triacylglycerols in Lauric Rapeseed Oil and
Can Increase Total
Laurate Levels
Deborah S. Knutzon,
Thomas R. Hayes,
Annette Wyrick,
Hui Xiong,
H. Maelor Davies1, and
Toni A. Voelker*
Calgene, 1920 Fifth Street, Davis, California 95616
 |
ABSTRACT |
Expression of a California bay laurel
(Umbellularia californica) 12:0-acyl-carrier protein
thioesterase, bay thioesterase (BTE), in developing seeds of oilseed
rape (Brassica napus) led to the production of oils
containing up to 50% laurate. In these BTE oils, laurate is found
almost exclusively at the sn-1 and sn-3 positions of the triacylglycerols
(T.A. Voelker, T.R. Hayes, A.C. Cranmer, H.M. Davies [1996] Plant J
9: 229-241). Coexpression of a coconut (Cocos nucifera)
12:0-coenzyme A-preferring lysophosphatitic acid acyltransferase (D.S.
Knutzon, K.D. Lardizabal, J.S. Nelsen, J.L. Bleibaum, H.M. Davies, J.G.
Metz [1995] Plant Physiol 109: 999-1006) in BTE oilseed rape seeds
facilitates efficient laurate deposition at the
sn-2 position, resulting in the
acccumulation of trilaurin. The introduction of the coconut protein
into BTE oilseed rape lines with laurate above 50 mol % further
increases total laurate levels.
 |
INTRODUCTION |
In most plant seeds, a fraction of the stored carbon consists of
TAGs and is commonly called the seed oil. Vegetable oils are a large
renewable resource, harvested at a rate of about 60 million tons
annually (Padley et al., 1994
). Seed oils normally contain
predominantly C18 unsaturated fatty acids; saturated fatty acids
represent only a minor fraction (Hilditch and Williams, 1964
).
Interestingly, the saturated acyl groups are normally found only in the
sn-1 and sn-3 positions of
TAGs (Frentzen, 1998
; Padley et al., 1994
).
There are many angiosperm oilseed species that produce TAGs with
elevated levels of saturated fatty acids. Highly saturated oils from
different plants fall into two classes with respect to TAG structure.
An example of the first class is cocoa butter, which contains
approximately 60 mol % saturates, predominantly 16:0 and 18:0. These
saturated fatty acids are not found randomly distributed between all
three positions at the glycerol backbone, but reside almost exclusively
in positions sn-1 and sn-3
of the TAGs. Such saturated-unsaturated-saturated TAGs have very
specific melting characteristics that make them suitable for a variety of specialized applications (Padley et al., 1994
). There is a large
body of evidence that this fatty acyl distribution results from the
respective specificities of the acyltransferases involved in the
biosynthesis of TAGs. The transferases responsible for the
esterification at sn-1 and
sn-3, glycerol-3-P acyltransferase and
diacylglycerol acyltransferase, respectively, appear to accept saturated and unsaturated acyl-CoA substrates (Frentzen, 1998
). In
contrast, LPAAT, which catalyzes the esterification at
sn-2, appears to discriminate against saturates
in most oilseeds (Sun et al., 1988
). Based on biochemical evidence it
was proposed that this enzyme might be responsible for the production
of such structured TAGs (Bafor et al., 1990
; for review, see Frentzen,
1998
).
In contrast to cocoa butter, the oils of the second class are from
natural, medium-chain (C8-C14)-producing species, and include many
palms, Lauraceae, Myristicaceae, and Cuphea spp. These oils contain almost exclusively saturated fatty acids (Hilditch and Williams, 1964
); coconut (Cocos nucifera) oil, for example,
has 92% saturates, predominantly laurate, and most of its TAGs are trisaturated. Laurate is found enriched at sn-2
(Padley et al., 1994
), which indicates that a laurate-CoA-preferring
LPAAT is active during endosperm maturation. Davies et al. (1995)
were able to detect such an enzyme from this tissue, which allowed Knutzon
et al. (1995)
to perform the protein purification and cloning of a cDNA
encoding the 299-amino acid CLP protein from coconut. When expressed in
Escherichia coli, and using 12:0-LPA as an acceptor, this
enzyme preferred medium-chain CoAs over 18:1-CoA as acyl donors. This
is direct evidence that in coconut endosperm, not only had the common
fatty acid biosynthesis pathway been modified to produce almost
entirely saturated medium chains, but at least one enzyme of lipid
biosynthesis (LPAAT) had been modified.
Canola varieties of B. napus produce seed oil that contains
only about 7% saturates, mostly 16:0 and 18:0. Expression of BTE, a
12:0-ACP thioesterase cDNA derived from seeds of California bay laurel
(Umbellularia californica), in canola seeds resulted in a
highly saturated canola oil (BTE canola), with saturated levels up to
about 60%. Laurate alone was found to represent up to 48 mol % of the
total fatty acid composition (Voelker et al., 1996
). More detailed
analysis of high-laurate canola oil showed that 12:0 was found almost
exclusively at the sn-1 and
sn-3 positions. For example, at 48 mol % total
laurate, sn-2 laurate was only 4% and almost no
trilaurin accumulated (Voelker et al., 1996
). These transgenic seeds
provided in vivo confirmation of the previously accumulated biochemical
evidence that in conventional oilseeds, the resident LPAAT
discriminates highly against saturates at the second step of the TAG
assembly, whereas the other two transferases apparently accept this
novel, saturated substrate (Frentzen, 1998
). High-laurate canola,
therefore, falls into the class of cocoa-butter-like oils and, indeed,
it can be used in applications where structured TAGs are preferred (Del
Vecchio, 1996
). Stearate-containing, structured TAGs accumulated after
antisense suppression of the resident delta 9 desaturase (Knutzon et
al., 1992
; G. Thompson, personal communication) or expression of a
specialized thioesterase (Hawkins and Kridl, 1998
; G. Thompson,
personal communication). In summary, the metabolic engineering
demonstrated that the redirection of fatty acid biosynthesis to
saturates results in the production of cocoa-butter-like structured TAGs.
We wanted to find the minimum number of enzyme modifications required
for the reprogramming of a conventional oilseed such as canola to the
production of trisaturate TAGs, which can be found in coconut oil. We
therefore crossed BTE canola with transgenic canola plants expressing a
CLP cDNA. Seed oil from lines harboring both transgenes (BTE/CLP
plants) showed a drastic increase of laurate at
sn-2. In addition, we present evidence that CLP
can boost the overall laurate levels in the resulting BTE/CLP seed oil.
 |
MATERIALS AND METHODS |
Plants
Canola-type oilseed rape (Brassica napus) plants
transformed with BTE, a 12:0-ACP thioesterase from California bay
laurel (Umbellularia californica) that is driven by a napin
promoter, were derived from the original transformant pCGN3828-23, as
described previously (Voelker et al., 1996
). This plant had 37 mol % of laurate in pools of segregating seeds, and its genome contained approximately 11 to 14 copies of the transgene on at least four to five
segregating loci (not shown). Single seeds had up to 56 mol % laurate.
After several generations of self-pollination and crossing to other
canola varieties, homozygous lines were obtained and contained up to 58 mol % laurate. Line DH22 (full designation [A112X3828-23-198]-14-DH22-125) contained 51 mol % laurate; line DH63 (full designation LA30056-5-DH63-14-2) contained 59 mol % laurate.
Expression of CLP in Transgenic Plants
To facilitate cloning into plant expression vectors, the CLP cDNA
clone pCGN5503 (Knutzon et al., 1995
) was modified by PCR to insert
SalI and BamHI restriction sites immediately
upstream of the start and downstream of the termination codons,
respectively. The CLP-coding region was inserted as a
SalI/BamHI fragment into the seed-specific napin
expression cassette pCGN3223 (Kridl et al., 1991
), which had been
digested with SalI and BglII, creating pCGN5509.
The HindIII fragment of pCGN5509 containing the napin 5
-regulatory region, the CLP-coding region, and the napin
3
-regulatory region was inserted into the HindIII site of
the binary vector pCGN1578PASS (McBride and Summerfelt, 1990
) to create
pCGN5511. pCGN5511 was transferred to Agrobacterium
tumefaciens EHA101 and used to transform B. napus as
described by Radke et al. (1988)
. Two different canola varieties were
used for transformation: LP004, a low-linolenic line, and Quantum, a
line with a standard canola composition. Plant cultivation and sample
harvesting have been described previously (Voelker et al., 1996
).
Dihaploid plants were generated by the procedure of Eickenberry (1994)
.
Enzyme Assays and Total Fatty Acyl Composition
For LPAAT assays, developing seed pools at the mid-maturation
stage (approximately 30 d after pollination) were harvested. Crude
(P2) membrane fractions were prepared and assayed using radiolabeled
acyl-CoA substrates, as described previously (Davies et al., 1995
).
Total fatty acid composition was determined via quantitative GC
analysis of methyl esters, as described previously (Browse et al.,
1986
).
sn-2 Analysis of Triglycerides
Procedures for the extraction of seed oil, for analysis of the
sn-2 composition of oil using Rhizopus
arrhizus lipase and for reversed-phase HPLC of seed oil TAGs, were
modifications of Voelker et al. (1996)
. For sn-2
determinations, R. arrhizus lipase was diluted to
approximately 600,000 units/mL and held on ice. The reaction mixture
contained 2.0 mg of oil, 200 µL of 0.1 M Tris-HCl, pH 7.4, 40 µL of 2.2% (w/v)
CaCl2·2H2O, and 100 µL
of 0.05% (w/v) bile salts. After 5 min of sonication to disperse the
oil, 20 µL of dilute lipase was added and the mixture was vortexed
continuously for 1 min at room temperature. The reaction was stopped
with 100 µL of 6 M HCl. Subsequently, 500 µL
of CHCl3:MeOH (2:1, v/v) was added. The organic
extract was removed, and the aqueous phase was re-extracted with 300 µL of CHCl3. The organic extracts were combined
and held on ice to minimize acyl migration before HPLC separation. The
digestion products were dried down in chloroform to approximately 200 µL, and 60 µL was used for HPLC analysis.
The HPLC system was equipped with an evaporative light-scattering
detector (Varex ELSD IIA, Alltech, Deerfield, IL) with the tube
temperature set at 105°C and the nitrogen gas flow at 40 mL/min, an
autosampler (model 712 Wisp, Waters), three solvent-delivery modules
(model 114M, Beckman), a controller (model 421A, Beckman), a
pneumatically actuated stream splitter (Rheodyne L.P., Rohnert Park,
CA), and a microfractionator (Gilson USA, Middleton, WI). The
chromatography column was a 220- × 4.6-mm, 5-µm, normal-phase silica cartridge (Brownlee Precision Co., Santa Clara, CA). The mobile
phases were hexane:toluene, (1:1, v/v) (solvent A), toluene:ethyl acetate, (3:1, v/v) (solvent B), and 5% (v/v) formic acid in ethyl acetate (solvent C). At a flow rate of 2.0 mL/min, an isocratic gradient of 10% solvent B and 2% solvent C for 2 min were applied, followed by a linear gradient of 2% to 25% solvent C over 6 min and
then an isocratic gradient of 25% C for 8 min and a linear gradient of
25% to 2% solvent C over 1 min. A chromatographic standard mixture
was prepared in hexane:toluene (1:1) containing the following: 0.2 mg/mL tri-16:0, 2.0 mg/mL 16:0 FFA, 0.2 mg/mL di-16:0 mixed isomers,
0.2 mg/mL 3-mono-16:0, and 0.2 mg/mL 2-mono-16:0. For each sample, the
fraction containing the 2-monoacylglycerol peak was collected
automatically by controlled timed events relays, the fractions were
evaporated at room temperature overnight, and the fatty acyl
composition was obtained as described by Browse et al. (1986)
.
Triglyceride Chromatography
Silver-phase HPLC resolution of TAGs was performed with the
chromatograph described for the sn-2 analysis. A
lipid column (250 × 0.6 mm; Chrompack, Raritan, NJ) fitted with a
cation-exchange guard column was held at 30°C. The detector's drift
tube temperature and nitrogen flow were maintained at 130°C and 40 mL/min, respectively. The mobile phase was composed of 1:1
hexane:toluene (solvent A), 3:1 toluene:ethyl acetate (solvent B), and
500:0.12 toluene:formic acid (solvent C). The mobile phase gradient was
programmed as isocratic at 90% solvent A and 10% solvent B for 1.5 min, a linear gradient to 100% solvent B from 1.5 to 1.75 min,
isocratic at 100% solvent B for 7.5 min, a step change to 100%
solvent C at 9.25 min, followed by a step change to the initial
conditions at 9.99 min, and an equilibration delay of 6 min. The flow
rate was 2 mL/min and the stream splitter was set at 60/40
(fraction/detector). Seeds were crushed and extracted overnight with
100 µL of toluene containing tri-11:0 as an internal standard at 0.5 mg/mL. Whole-sample extracts were filtered (0.2 µm) and injected (25 µL) onto the silver-phase column. The trisaturated TAG peak fraction
including the tri-11:0 was collected and dried at room temperature
overnight, and methyl esters were produced by the addition of 50 µL
of toluene and 105 µL of 0.5 N NaOH, incubation
at 90°C for 10 min, and addition of 500 µL of acetic acid and 60 µL of heptane. After GLC analysis, the trilaurin content was
calculated.
Oil Level Determination
Seed oil levels were determined by NMR. Mature seeds (1-2 g) were
dried at 130°C for 2 h and equilibrated to room temperature for
12 h before NMR analysis (model 4000, Oxford Instruments, Concord,
MA) with an RF level of 20 µA, an AF gain of
500, and a gate width of 1.0 G. The time of analysis was two times for 30 s (averaged signal/mass). Samples were run in triplicate in 2.0-mL Nessler cylinders of identical weight against 0% and 100% oil
calibration controls.
PCR
To detect the CLP gene in transformants, leaf DNA was isolated
(Bernatzky and Tanksley, 1986
) and coconut (Cocos nucifera) sequences were amplified with the primers
TGTGGAACATGATCATGCTGATTTTGCTCC and ATCGAGTACCCTCTGGAAAAATGATCAGCG using
standard procedures.
 |
RESULTS |
Expression of CLP Alters the LPAAT Substrate Specificity Profile of
Transgenic Canola Seeds
Knutzon et al. (1995)
identified a coconut cDNA encoding CLP, a
299-amino acid protein with LPAAT activity. Expression of this cDNA in
Escherichia coli conferred upon these cells a novel, laurate-preferring LPAAT activity whose substrate specificity profile
matched that of the coconut enzyme. We were interested in evaluating
whether this CLP enzyme would be capable of competing with the
endogenous LPAAT activity in transgenic canola and facilitate the
incorporation of laurate into the sn-2 position
of TAG. To obtain information on the expression of CLP in canola, the
cDNA was expressed in seeds under the control of a seed-specific napin promoter. Seeds at mid-stage maturation were collected and assayed for
LPAAT activity using 12:0-LPA and a variety of acyl-CoA donors. As
shown in Figure 1 for one transgenic
event, the activity profile of the transgenic seeds differed
considerably from that of control, nontransformed seeds. 12:0-CoA was
the preferred substrate in the transgenic seeds. Overall, the profile
matches that of CLP expressed in E. coli or of a coconut
endosperm extract (Davies et al., 1995
; Knutzon et al., 1995
) overlayed
on the endogenous 18:1-CoA activity of the canola control.

View larger version (16K):
[in this window]
[in a new window]
| Figure 1.
LPAAT substrate specificity of CLP-expressing
canola seeds. A pool of mid-maturation seeds from a control plant
(white bars) and from a transgenic plant, pCGN5511-LP004-5 (black
bars), were assayed for LPAAT substrate specificity using 12:0-LPA and
various 14C-labeled acyl-CoAs. PA, Phosphatitic acid.
|
|
Expression of CLP in Canola Results in Incorporation of Laurate
into the sn-2 Position of TAG
Since the activity of the CLP was highest using 12:0-LPA and
12:0-CoA, and since the activity of the endogenous LPAAT was low, those
substrates were used to evaluate CLP activity in maturing seeds of all
of the pCGN5511-transformed B. napus LP004 lines. All of the
transgenic lines showed increased 12:0-LPAAT activity compared with
control (x axis of Fig. 2).
However, since these transformants produce no 12:0-CoA, it was not
possible to directly observe the effects of the CLP in planta on
altered oil composition. To evaluate CLP in a laurate-containing
background, each pCGN5511 primary transformant was crossed with DH22, a
homozygous BTE line that contains 51 mol % laurate. Since the BTE
parent was homozygous, each resulting F1 seed
should have a complement of BTE alleles. As predicted, all
F1 seeds from these crosses contained laurate, albeit at a lower level then the homozygous parent. Seed-to-seed laurate levels ranged from 30% to 40% (not shown). Since the CLP parents were the primary hemizygous transformants, CLP alleles were
expected to segregate in the F1 population and,
depending on the genetic loci of the CLP in the parents, up to 50% of
these seeds were expected not to contain any CLP allele (nulls).

View larger version (17K):
[in this window]
[in a new window]
| Figure 2.
Correlation of 12:0-LPAAT activity with 12:0
accumulation at sn-2. LPAAT activity
using 12:0-CoA and 12:0-LPA was determined in membrane fractions
derived from developing untransformed, control canola seeds, as well as
from independent CLP LP004 transformants. In addition, the proportion
of 12:0 at sn-2 was measured in 20-seed
pools of mature F1 seeds derived from crosses of the same
set of CLP plants with a homozygous BTE-containing line, DH22. The
figure correlates these two determinations. , Control;
×, individual CLP × BTE F1 seed lots. PA,
Phosphatitic acid.
|
|
Twenty F1 seeds from each of these crosses were
pooled and the sn-2 fatty acid composition
determined. These values are shown plotted against the 12:0 LPAAT
activity, as previously determined with the respective primary CLP
transformants (Fig. 2). In all cases, laurate levels at
sn-2 were greater than 5%, with maximum levels
at 30%. Canola oil from BTE-only transformants with 30% to 40%
laurate contains less than 5% laurate at the
sn-2 position (Voelker et al., 1996
). Clearly,
the combination of BTE and CLP increased this value, in some cases
drastically, demonstrating the efficient competition of CLP with the
canola LPAAT in planta. The plot indicates only a weak correlation
between 12:0-LPAAT activity of the CLP parent and the resulting
invasion of 12:0 into sn-2 in
F1 seeds. We attribute this imperfect correlation to several factors. The LPAAT assay is only semiquantitative, and a
variability of up to 2-fold has been observed when repeatedly assaying
developing seeds from the same transformants. This was compounded by
the fact that the respective maturing seed pools were segregating for
the respective LPAAT alleles (homozygous, heterozygous, and null
seeds), and we could not ensure that we always had a representative
sample.
Coconut LPAAT Induces the Accumulation of Trilaurin
The large amounts of laurate produced by the BTE in developing
canola seeds are deposited almost exclusively in the sn1 and sn3 positions of TAGs. Even at 47 mol % laurate, trilaurin
represents only 2.68 weight % of all TAGs (Voelker et al.,
1996
). We wanted to study whether the laurate invasion into
sn-2 catalyzed by CLP boosted the trilaurin
fraction.
In a first experiment, F1 plants from crosses of
several LPAAT transformants with the 50 mol % laurate-containing BTE
homozygous line DH22 were grown and CLP-homozygous
F2 lines selected in the next generation. Since
the laurate trait was carried by several loci in the BTE parent, we
observed a wide range of laurate levels in F2
plants. Seeds from canola lines harboring the BTE alone served as
controls. Extracted oil was analyzed by reversed-phase HPLC. Under
these conditions, TAGs with an equal total number of unsaturations in
their fatty acyl moieties migrated with almost the same mobility, which
was nearly independent of the total carbon number (Hammond, 1993
;
Voelker et al., 1996
).
In Figure 3 the overall laurate
proportion of the respective oil samples is plotted against their
trilaurin fraction. As reported earlier, a BTE transformant line with
47 mol % of laurate accumulated only a few percent of TAGs as
trilaurin (Voelker et al., 1996
). This was not unexpected, since the
canola LPAAT does not accept 12:0-CoA (Bafor et al., 1990
). However,
when CLP is present, the trilaurin fraction at a given laurate level is
drastically higher. Even at 30% of total laurate, more than 5% of the
TAGs are trilaurin. The trilaurin fraction increased to up to 15% when
total laurate was at 50%. In summary, at all laurate levels measured,
the trilaurin fraction was significantly higher with the CLP present
than what is found in lines harboring BTE alone; it was even higher
than calculated values that assume random distribution for laurate at
all three glycerol positions. This result demonstrated that CLP is
active in vivo and that during TAG biosynthesis it facilitates the
entry of a significant portion of laurate into position 2. Since the
seeds look normal and germinate, it also demonstrates that the invasion
of laurate into the sn-2 position of
glycerolipids is not harmful to the canola seeds.

View larger version (18K):
[in this window]
[in a new window]
| Figure 3.
Relationship between total laurate content and
trilaurin. Seed oil was extracted from transformed canola plants and
the total laurate content of the oil and proportion of trilaurin
compared with other TAGs in the oil were determined. Each symbol
reflects a sample derived from a seed pool from one dihaploid plant as
described. ×, Canola lines transformed with BTE alone; ,
seeds from F2 plants resulting from crosses of several
different Q04 CLP transformants with the homozygous BTE plant DH22. The
line was calculated by assuming that laurate was positioned randomly at
all three positions of the triglyceride.
|
|
CLP Can Channel Laurate Preferentially to
sn-2
Since we had previously found that measuring LPAAT activity in
maturing seeds of primary transformants was a poor predictor of induced
phenotype (Fig. 2), we initiated a second transformation (this time in
a conventional canola variety with higher agronomic yield than QO4) and
screened the resulting CLP transformants by measuring the in vivo
impact on triglyceride assembly. To achieve this goal, all primary CLP
transformants were crossed to a homozygous BTE plant. Assuming
Mendelian segregation, we could predict that all resulting
F1 seeds had an identical BTE gene dosage, namely one copy of each BTE parent locus. Because of the nature of the plant
transformation, all CLP parents were hemizygous for CLP, and therefore
the CLP transgene should segregate in the cross according to locus
number. In the resulting F1 seeds, the impact of
the different CLP transgenic alleles on laurate deposition at
sn-2 was measured. Since the direct determination
of laurate at sn-2 in single cotyledons was not
feasible, we choose to measure trilaurin levels.
F1 seeds with highest levels of trilaurin were considered to harbor the highest CLP-expression alleles and were selected for the establishment of the BTE/CLP lines.
For this experiment, the canola var Quantum was transformed with
pCGN5511, and 20 independent transformants were generated. Each
original transformant was crossed with the homozygous BTE line DH63,
which featured 59 mol % laurate in the seeds. In this BTE line the
laurate phenotype was caused by three or four genetic loci (not shown).
After seed maturation, one cotyledon each of several
F1 seeds from each cross was analyzed for
trilaurin and the total laurate fraction. Total laurate levels were
between 50 mol % and 60 mol %, and the trilaurin fraction ranged from very low to up to 25% (not shown). For further study, we selected F1 lines that harbored the coconut LPAAT at one
genetic locus and had induced the highest trilaurin levels in single
F1 seeds.
Since in such lines BTE and CLP together were expected to segregate in
four to five genetic loci, breeding to complete homozygosity would have
required a multigeneration breeding program. For a more efficient
strategy, microspores were grown from the pollen of
F1 plants, and approximately 100 dihaploid plants
were generated (Eickenberry, 1994
). Since genetic segregation during
the generation of dihaploid plants is at the haploid level, the
probability for any given combination of four loci is 1 in 32. We
therefore calculated that 100 independent dihaploids should contain all
possible combinations of these four loci with a high probability.
Because of the nature of dihaploid plants, they are exclusively in the
homozygous state.
In the resulting population of 100 dihaploid plants, the CLP transgene
was detected via PCR of leaf tissue extracts. In addition, the total
fatty acid composition was determined in mature seed pools. The laurate
fraction ranged from 0 mol % to 67 mol %. We also analyzed the
proportion of laurate at sn-2 of the seed oil TAGs in a subset of dihaploids. In Figure
4 the total laurate levels for each
selected line is plotted against the laurate at sn-2 for both populations. The graph demonstrates
that in BTE-only plants with less than 45 mol % total laurate, very
little laurate accumulates at sn-2, as was
observed for the two lines in Voelker et al. (1996)
. However, at
laurate levels above 45 mol %, sn-2 laurate
unexpectedly rose rapidly to significant levels. When CLP was present,
however, laurate sn-2 infusion was much higher at
any given total laurate level. In the very highest laurate plants,
laurate makes up to 75% of the acyl groups in this position, indicating that in this plant sn-2 is the
preferred position for this saturated fatty acid.

View larger version (22K):
[in this window]
[in a new window]
| Figure 4.
Laurate proportion at
sn-2 is dependent on total laurate levels
and coconut LPAAT. The primary CLP transformants (pCGN5511 in var
Quantum) were crossed with the homozygous BTE line DH63. A
F1 plant harboring CLP and BTE alleles was grown.
Independently segregating F2 microspores derived from this
plant were made diploid and grown into (homozygous) dihaploid plants as
described. The presence or absence of the coconut LPAAT gene in the
individual dihaploid plants was determined via PCR of leaf tissue. All
plants were selfed, and oil was extracted from the resulting seeds. The
sn-2 analysis of seed oil was executed
using R. arrhizus lipase. Each symbol represents a seed
pool derived from one dihaploid plant. , CLP-positive plant;
×, CLP-negative plant. For this analysis, we selected the
top 12 laurate producers of the generated dihaploids, as well as
randomly chosen plants throughout the laurate range.
|
|
CLP Can Boost Laurate Levels in Seeds
There are several lines of evidence indicating that in developing
seeds of BTE canola that accumulate more than 45% laurate, a fraction
of newly synthesized laurate might enter a futile cycle during seed
development (Voelker et al., 1996
; Eccleston and Ohlrogge, 1998
). It
was reasoned that in such seeds, since the sn-2
position in the TAG could not be used efficiently and the
sn-1 and sn-3 positions
were nearly filled with laurate, a fraction of the laurate output of
the plastid could not be utilized and was subsequently degraded. The
introduction of the CLP was therefore predicted to not only allow
access of laurate to position sn-2, but also to
increase total laurate levels when expressed in very high laurate lines.
To test this hypothesis, we determined the absence or presence of the
coconut LPAAT gene in all 100 dihaploid plants used in this study. As
predicted by the underlying genetics, the dihaploid population was
split equally into CLP positives and CLP negatives. In Figure
5, the data are sorted by total laurate
levels and by the absence or presence of CLP. Plants without CLP have
oil with up to 59 mol % laurate, and the BTE parent used for the cross had 59 mol % of laurate; therefore, it was expected that a dihaploid (homozygous) plant with all of the BTE loci reassembled after the cross
should also have about the same laurate levels. However, plants with
the coconut LPAAT gene had up to 67 mol % laurate. Altogether, we
obtained about 12 BTE/LPAAT plants that had more laurate than any of
their BTE-only siblings (up to almost 10% more). It is also
interesting to note that a disproportionate number of BTE plants had
laurate levels between 56 mol % and 58 mol % laurate. Detailed
genomic analysis revealed no trend of higher BTE gene dosage in
CLP-positive versus CLP-negative plants (not shown).

View larger version (19K):
[in this window]
[in a new window]
| Figure 5.
Coconut LPAAT can boost laurate levels. Each
symbol represents a seed-pool analysis of an individual dihaploid
plant. All dihaploid plants resulting from crosses described in Figure
4 were sorted via PCR into a CLP-containing (CLP +) and a CLP-free (CLP
) populations. Plants of both populations were grouped into
1% laurate intervals.
|
|
We conclude that the presence of CLP allows a more efficient laurate
TAG deposition in very high BTE-expressing plants. We also wanted to
determine whether the presence of CLP leads to more total lipid per
seed. Therefore, we determined the total oil as a percentage of dry
weight in mature seeds of all dihaploid plants. In Figure
6, these data are shown correlated with
laurate levels. It is obvious that there was wide plant-to-plant
variability, which is common for greenhouse-grown plants, but for both
subgroups the distribution is similar. The average oil percentage for
plants with laurate levels less than 40 mol % laurate was 34% to
35%, but the average of plants with more than 50 mol % laurate
was only 30% to 32%.

View larger version (16K):
[in this window]
[in a new window]
| Figure 6.
Correlation of oil levels with BTE and CLP. The
total seed oil mass as a percentage of dry weight of the dihaploid
plants described in Figure 4 were determined by NMR. The data are shown
separately for CLP-free (CLP ) and CLP-containing (CLP+) populations,
with the oil percentage plotted against total laurate levels.
|
|
 |
DISCUSSION |
We used CLP, a LPAAT from coconut endosperm, to increase the
proportion of trilaurin in laurate-producing canola plants previously transformed with a 12:0-ACP thioesterase. Our results demonstrate that
fatty acid biosynthesis and lipid biosynthesis can be redirected simultaneously by introduced enzymes from different species. In BTE-transformed canola lines, laurate accumulated predominantly at the
sn-1 and sn-3 positions and
was underrepresented at the sn-2 position of the
seed triglycerides. Only at total laurate levels above 50% did the
proportion at sn-2 begin to increase (Fig. 4). In
such plants, with sn-1 and sn3
positions nearly saturated with laurate, cytoplasmic 12:0-CoA levels
might have risen to sufficiently high levels that the 12:0-CoA could
compete with the long-chain CoA substrates for the canola LPAAT. As
shown in Figure 1, in developing canola seeds, LPAAT activity on 12:0
substrates is low relative to long-chain CoAs, but the discrimination
is not complete (Sun et al., 1988
). This low activity could explain the
observed trend.
In the presence of CLP, however, laurate is accepted at the
sn-2 position, and for the ranges tested the
correlation between total laurate levels and the
sn-2 laurate proportions was essentially linear
(Fig. 4). This was also reflected in the drastic increase of trilaurin
in the resulting oil (Fig. 3). In BTE/CLP dihaploids with 60% laurate,
we found oils with up to 40% of trilaurin, a value higher than
expected if random assembly occurs at all positions (21.6%). The
induced CLP can effectively compete with the endogenous LPAAT,
providing in vivo proof that a LPAAT specialized for saturated substrates can drastically alter the stereochemical composition of
triglycerides during biosynthesis. This effect was demonstrated previously with a different LPAAT. Lassner et al. (1995)
isolated a
LPAAT cDNA from meadowfoam seeds, a plant that accumulates seed oil
rich in triglycerides with very-long-chain (
20 carbons)
monounsaturates in sn-2. Subsequently, this
cDNA was expressed the seeds of a high erucic acid (22:1) canola
variety containing approximately 40% of 22:1, almost all of which is
excluded from sn-2 (Sun et al., 1988
). Meadowfoam
LPAAT transformants contain up to 22% of this fatty acid at
sn-2, demonstrating that the transgenic, specialized LPAAT
from meadowfoam competed efficiently with the endogenous enzyme for
substrates. We conclude from these results and from the results of the
present study that a specialized LPAAT is probably present when unusual
fatty acids are found at sn-2 in a plant oil.
As reported previously (Voelker et al., 1996
), the correlation between
BTE enzyme activity during seed maturation and laurate levels in mature
seeds is approximately linear between 0 and 35 mol % laurate. Above
35%, however, the linear relationship is lost even though thioesterase
activity can still be increased. It was reasoned therefore that in
seeds in which sn-1 and
sn-3 are almost completely filled with laurate,
not all of the 12:0-CoA could be deposited in triglycerides and would
therefore be recycled by the cells. This hypothesis was examined in
detail using BTE canola transformants with 60 mol % laurate in seed
lipids (Eccleston and Ohlrogge, 1998
). When developing embryos from
these BTE plants were fed radioactive acetate, only 50% of the tracer
accumulated as lipids; the remainder accumulated predominantly as Suc
and malate. In control embryos more than 90% of the radioactivity was channeled to lipids. In addition, it was found that in
developing BTE-canola embryos, fatty-acid-biosynthesis enzymes were
significantly elevated and enzymes of
-oxidation were drastically
induced. Altogether, this study provides evidence that in these
developing seeds a coordinated induction of the fatty acid synthesis
pathway occurred, presumably to compensate for the lauric acid lost
through
-oxidation.
We reasoned that, since the introduction of CLP in 60% laurate BTE
lines leads to the efficient use of the sn-2
position, much higher laurate levels might be attained than with BTE
alone. Indeed, when we sorted the dihaploid lines resulting from a
BTE/CLP cross with respect to the absence or presence of CLP (Fig. 5), we observed a clustering around 57 ± 2 mol % for plants without CLP;
no plant had more than 59 mol % laurate. In contrast, 12 CLP-containing plants had more than 59 mol % laurate, with the highest
one containing 67 mol %. We conclude that the presence of CLP allowed
a more efficient deposition of laurate into TAG in very high
BTE-expressing cells.
In summary, the addition of CLP to 60 mol % laurate BTE canola leads
to an approximately 5% laurate increase of the mature seed lipid
composition, indicating that in such BTE-only seeds as much as 10% of
the de novo laurate might be recycled, probably by
-oxidation. This
is in contrast to the embryo-feeding data, where in developing embryos
50% of acetate label was found to be incorporated into nonlipids
(Eccleston and Ohlrogge, 1998
), indicating a much higher rate of
-oxidation. We cannot explain this discrepancy, but it could be that
the predominant source of recycled laurate during development might not
be TAGs, but laurate-containing phospholipids. Indeed, during the phase
of active laurate deposition, laurate is found in all phospholipid classes. For example, developing embryos of BTE laurate canola, which
had 48 mol % laurate in TAGs, had about 30 mol % laurate in PC, but
after cessation of fatty acid production, the laurate proportion in PC
was reduced to 5% (Wiberg et al., 1997
). The addition of CLP to such
plants did not lead to a reduced infusion of laurate into
phospholipids, as might have been expected (E. Wiberg and S. Stymne,
personal communication). It was also observed (Lassner et al., 1995
)
that the expression of a 22:1-preferring LPAAT from meadowfoam in
transgenic canola, although it had a drastic effect on
sn-2 levels of 22:1, did not lead to the
elevation of 22:1 in the total oil composition. We interpret this as
evidence that in this canola variety, LPAAT is not a limiting factor
for total 22:1 deposition.
Crossing a BTE canola line with CLP expressors transformed the
cocoa-butter type high-laurate canola to a predominantly trisaturate oil. This type of oil resembles seed oil deposited by natural medium-chain producers such as coconut or Cuphea species,
and it provides further evidence that in the evolution of such oil plants only a very few key enzymes needed to be modified to achieve such drastically different oil compositions and triglyceride
species. Certain natural medium chain producers accumulate just one
triglyceride. For example, Actinodaphne hookeri seeds
contain 95% trilaurin, nutmeg oil contains more than 80% tri-14:0,
and it has been suggested that "pure" triglycerides produced in
commercial crops could become important feed stocks for a wide range of
industries (Shukla and Blicher-Mathiesen, 1993
). This study
demonstrates a next step toward the development of such crops by
genetic engineering.
 |
FOOTNOTES |
1
Present address: Tobacco and Health Institute,
Cooper and University Drives, Lexington, KY 40546-0236.
*
Corresponding author; e-mail toni.voelker{at}monsanto.com; fax
1-530-792-2453.
Received January 14, 1999;
accepted March 30, 1999.
 |
ABBREVIATIONS |
Abbreviations:
ACP, acyl-carrier protein.
BTE, bay
thioesterase.
CLP, coconut 12:0-CoA preferring lysophosphatitic acid
acyltransferase.
LPA, lysophosphatidic acid
(1-acyl-sn-glycerol-3-P).
LPAAT, LPA
acyltransferase.
TAG, triacylglycerol.
 |
ACKNOWLEDGMENTS |
The authors would like to thank the Calgene transformation and
greenhouse personnel for the generation and maintenance of the
transgenic plants. Special thanks to Margaret Griggs for the dihaploid
plants and Nick Wagner for Southern analysis. Thanks to several
scientists at Calgene who read the manuscript critically, and special
thanks to John Ohlrogge, Michigan State University, and Sten Styme,
Swedish University of Agricultural Sciences, for many discussions.
 |
LITERATURE CITED |
Bafor M,
Stobart AK,
Stymne S
(1990)
Properties of the glycerol acylating enzymes in microsomal preparations from the developing seeds of safflower (Carthamus tinctorius) and turnip rape (Brassica campestris) and their ability to assemble cocoa-butter type fats.
J Am Oil Chem Soc
67:
217-225
[CrossRef][Web of Science]
Bernatzky R,
Tanksley SD
(1986)
Genetics of actin-related sequences in tomato.
Theor Appl Genet
72:
314-321
[CrossRef][Web of Science]
Browse J,
McCourt J,
Somerville CR
(1986)
Fatty acid composition of leaf lipids determined after combined digestion and fatty acid methyl ester formation from fresh tissue.
Anal Biochem
152:
141-145
[CrossRef][Web of Science][Medline]
Davies HM,
Hawkins DJ,
Nelsen JS
(1995)
Lysophosphatidic acid acyltransferase from immature coconut endosperm having medium chain length substrate specificity.
Phytochemistry
39:
989-996
[CrossRef]
Del Vecchio AJD
(1996)
High laurate canola.
Inform
7:
230-242
Eccleston VO,
Ohlrogge JB
(1998)
Expression of lauroyl-acyl carrier protein thioesterase in Brassica napus seeds induces pathways for both fatty acid oxidation and biosynthesis and implies a set point for triacylglycerol accumulation.
Plant Cell
10:
613-621
[Abstract/Free Full Text]
Eickenberry E
(1994)
Chromosome doubling of microspore-derived canola using trifluralin.
Cruciferae Newsletter
16:
51-52
Frentzen M
(1998)
Acyltransferases from basic science to modified seed oils.
Fett Lipid
100:
161-166
[CrossRef]
Hammond EW (1993) High performance liquid chromatography.
In Chromatography for the Analysis of Lipids. CRC Press,
High Wycombe, Buckinghamshire, UK, pp 113-153
Hawkins DJ,
Kridl JC
(1998)
Characterization of acyl-ACP thioesterases of mangosteen (Garcinia mangostana) seed and high levels of stearate production in transgenic canola.
Plant J
13:
743-752
[CrossRef][Web of Science][Medline]
Hilditch TP,
Williams PN
(1964)
The Chemical Constitution of Natural Fats.
Chapman and Hall, London
Knutzon DS,
Bleibaum JL,
Nelsen J,
Kridl JC,
Thompson GA
(1992)
Isolation and characterization of two safflower oleoyl-acyl carrier protein thioesterase cDNA clones.
Plant Physiol
100:
1751-1758
[Abstract/Free Full Text]
Knutzon DS,
Lardizabal KD,
Nelsen JS,
Bleibaum JL,
Davies HM,
Metz JG
(1995)
Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.
Plant Physiol
109:
999-1006
[Abstract]
Kridl JC,
McCarter DW,
Rose RE,
Scherer DE,
Knutzon DS,
Radke SE,
Knauf VC
(1991)
Isolation and characterization of an expressed napin gene from Brassica rapa.
Seed Sci Res
1:
209-219
Lassner MW,
Levering CK,
Davies HM,
Knutzon DS
(1995)
Lysophosphatidic acid acyltransferase from meadowfoam mediates insertion of erucic acid at the sn-2 position of triacylglycerol in transgenic rapeseed oil.
Plant Physiol
109:
1389-1394
[Abstract]
McBride KE,
Summerfelt KR
(1990)
Improved binary vectors for Agrobacterium-mediated plant transformation.
Plant Mol Biol
14:
269-276
[CrossRef][Web of Science][Medline]
Padley FB,
Gunstone FD,
Harwood JL
(1994)
Occurrence and characteristics of oil and fats.
In
FD Gunstone,
JL Harwood,
FB Padley,
eds, The Lipid Handbook.
Chapman and Hall, London, pp 49-170
Radke SE,
Andrews BM,
Moloney MM,
Crouch ML,
Kridl JC,
Knauf VC
(1988)
Transformation of Brassica napus L. using Agrobacterium tumefaciens: developmentally regulated expression of a reintroduced napin gene.
Theor Appl Genet
75:
685-694
Shukla SH,
Blicher-Mathiesen U
(1993)
Studies in evaluation of unconventional oils from southeast Asia.
Fat Sci Technol
95:
367-369
Sun C,
Cao Y-Z,
Huang AHC
(1988)
Acyl coenzyme A preference of the glycerol phosphate pathway in the microsomes from the maturing seeds of palm, maize, and rapeseed.
Plant Physiol
88:
56-60
[Abstract/Free Full Text]
Voelker TA,
Hayes TR,
Cranmer AC,
Davies HM
(1996)
Genetic engineering of a quantitative trait: metabolic and genetic parameters influencing the accumulation of laurate in rapeseed.
Plant J
9:
229-241
Wiberg E,
Banas A,
Stymne S
(1997)
Fatty acid distribution and lipid metabolism in developing seeds of laurate-producing rape (Brassica napus L.).
Planta
203:
341-348
[Medline]