|
Plant Physiol. (1999) 120: 1049-1056
Functional Characterization and Expression Analysis of the Amino
Acid Permease RcAAP3 from Castor Bean1
Anil Neelam2,
Allison C. Marvier,
J.L. Hall, and
Lorraine E. Williams*
School of Biological Sciences, University of Southampton, Bassett
Crescent East, Southampton SO16 7PX, United Kingdom
 |
ABSTRACT |
A
polymerase chain reaction-based library screening procedure was used to
isolate RcAAP3, an amino acid permease cDNA from castor
bean (Ricinus communis). RcAAP3 is 1.7 kb
in length, with an open reading frame that encodes a protein with a
calculated molecular mass of 51 kD. Hydropathy analysis indicates that
the RcAAP3 protein is highly hydrophobic in nature with nine to 11 putative transmembrane domains. RcAAP3-mediated uptake of citrulline in
a yeast transport mutant showed saturable kinetics with a
Km of 0.4 mM. Transport was higher
at acidic pH and was inhibited by the protonophore
carbonylcyanide-m-chlorophenylhydrazone, suggesting a
proton-coupled transport mechanism. Citrulline uptake was strongly inhibited (72%) by the permeable sulfydryl reagent
N-ethylmaleimide, but showed lower sensitivity (30%
inhibition) to the nonpermeable reagent
p-chloromercuribenzenesulfonic acid.
Diethylpyrocarbonate, a histidine modifier, inhibited citrulline uptake
by 80%. A range of amino acids inhibited citrulline uptake, suggesting
that RcAAP3 may be a broad substrate permease that can transport
neutral and basic amino acids with a lower affinity for acidic amino
acids. Northern analysis indicated that RcAAP3 is widely
expressed in source and sink tissues of castor bean, and that the
pattern of expression is distinct from RcAAP1 and
RcAAP2.
| |
INTRODUCTION |
In higher plants, inorganic nitrogen is assimilated in the roots
or leaves, and the reduced nitrogen (mainly in the form of amino acids,
amides, and ureides) is transported around the plant in the vascular
system to various metabolically active organs, where it is utilized for
growth and development. Transport of solutes across cell membranes is
fundamental to this process of partitioning. Studies in castor bean
(Ricinus communis) have suggested that transport of amino
acids across the plasma membrane is mediated by specific transporters
driven by the proton electrochemical gradient (Williams et al., 1992 ,
1996; Weston et al., 1994, 1995). Our previous studies in roots of
castor bean using isolated membrane vesicles indicated that several
different amino acid transporters exist (Weston et al., 1995). However,
these studies were limited by the presence of multiple transporter
systems with overlapping specificities.
During the past few years, significant progress has been made toward
the understanding of amino acid transport in higher plants using
Arabidopsis as a model. This results largely from the isolation of the
genes encoding amino acid permeases using complementation of yeast
transport mutants (Fischer et al., 1998). The biochemical properties of
the Arabidopsis amino acid permeases have been described in a number of
cases (Fischer et al., 1995, 1998). However, almost nothing is known
about amino acid permeases in other plant species. For example, do
related transporters in different species have comparable biochemical
properties? Do they show similarities in their tissue distribution?
This information is important in providing an insight into their
physiological role.
The transport of amino acids is very important during seed germination
and seedling development, and castor bean has been used as a model
system to investigate this (Williams et al., 1996). The germinating
seedling relies exclusively on amino acids derived from the endosperm
as a source of nitrogen. Since these are released into the apoplast,
specific carriers must exist for transport of amino acids into
cotyledon cells and also for loading into the phloem for delivery to
the rest of the seedling. We recently isolated two partial cDNA clones
(RcAAP1 and RcAAP2) from germinating seedlings of
castor bean (Bick et al., 1998) with homology to transporters in the
AAP (amino acid permease) gene family from Arabidopsis. Using yeast
complementation, we were able to isolate a full-length cDNA for
RcAAP1. Transport studies showed that this transporter had
the highest affinity for basic amino acids (Marvier et al., 1998).
The present paper describes the use of a different strategy for the
isolation of amino acid transporter genes. This is the first report, to
our knowledge, of the isolation of a plant transporter cDNA based on a
screening technique using the PCR that was originally developed by
Israel (1993). This method resulted in the isolation of the amino acid
permease RcAAP3 from developing seedlings of castor bean.
The biochemical characteristics were investigated following expression
of RcAAP3 in a yeast mutant. Northern analysis indicated
that RcAAP3 has a pattern of expression distinct from the
other castor bean amino acid permeases, RcAAP1 and
RcAAP2.
| |
MATERIALS AND METHODS |
Plant Material
Seeds of castor bean (Ricinus communis L. var Sanguineous) were imbibed in cold running water for 24 h and
then grown in vermiculite in the dark at 28°C for 6 d. To obtain
mature plants, 4- to 5-d-old seedlings were potted in Levington's F2
compost, and grown in a temperate greenhouse for at least 3 months.
Construction of a cDNA Library from Castor Bean Seedlings
Total RNA was extracted from 7-d-old castor bean
seedlings (including cotyledons, endosperm, hypocotyl, and roots) using
the method described by Logemann et al. (1987). mRNA was isolated from
total RNA with an mRNA isolation system (PolyATract, Promega) using
biotinylated oligo(dT) in conjunction with streptavadin paramagnetic
particles according to the manufacturer's protocol (Promega).
Double-stranded cDNA was synthesized from the mRNA (SuperScript Choice
system, Life Technologies) according to the manufacturer's
instructions, and was cloned into EcoRI-digested arms of
 gt10. Recombinant phages were packaged in vitro with packaging
extract (Gigapack Gold, Stratagene). A primary cDNA library of more
than 106 pfu in size was constructed and later
amplified.
PCR Screening of the cDNA Library
Screening of the castor bean library for amino acid permease cDNAs
was carried out at high stringency using a PCR-based technique, largely
as described by Israel (1993). The library was divided into 64 wells of
a microtiter plate in a grid of eight rows and eight columns, each well
containing 3,000 pfu and propagated in bacteria. After amplification of
phage in the wells, aliquots of the phage from eight wells across the
rows and eight wells down the columns were pooled, giving eight rows
and eight columns of samples. PCR was performed on the 16 pooled phage
aliquots with nondegenerate oligonucleotide primers designed from
the nucleotide sequence of RcAAP1 (Bick et al., 1998).
The RcAAP1 forward primer (RcAAP1 F) was
5 GGTGATCCTGTCAATGGCAAGAGG3 and the RcAAP1 reverse primer
was (RcAAP1 R) 5AGGAGACATGTCTCCAAAAGCAGC3. Positives from
the 16 PCR reactions were identified by the amplification of a PCR
product of the expected size as visualized by agarose gel
electrophoresis.
For the secondary screen the phage from the positive well was
subdivided into 64 wells of the microtiter plate (each well containing
100 pfu) repropagated in bacteria and screened using the same PCR
protocol. The positives were taken to the tertiary screen with 2 to 3 pfu per well and the procedure was repeated. Individual clones from the
final positive wells were plated out as single plaques and screened by
plaque PCR. The majority of the randomly picked plaques were found to
contain inserts of the desired size. Since the PCR amplification with
the primers that we used resulted in the amplification of a single
strong PCR product of the expected size, hybridization with an internal
oligonucleotide probe as described by Israel (1993) was omitted in the
screening procedure.
Subcloning and Sequence Analysis
Phage DNA was isolated from positive plaques using the standard
protocols (Sambrook et al., 1989). The cDNAs were excised from phage
with NotI and subcloned into pBluescript SK vectors. Subclones were generated for the cDNA and both strands were sequenced using an automated sequencer (LI-COR) with IRD-labeled M13 forward and
reverse primers and T7 and T3 promoter primers using a cycle sequencing
kit (Thermosequenase, Amersham). Sequence analyses were performed using
the University of Wisconsin Genetics Computer Group software offered by
the Seqnet computing facility (Daresbury, UK). The cDNA sequence of
RcAAP3 appears in the database under the accession no.
AJ132228.
Functional Complementation in a Yeast Transport Mutant
Saccharomyces cerevisiae strain 2512c
(Mat-a, gap1) was modified by the introduction of
the ura3-52 mutation as previously described
(Marvier et al., 1998). The resulting strain (referred to as the
gap1 mutant) was maintained on yeast/peptone/dextrose medium
containing 1% (w/v) yeast extract, 2% (w/v) peptone,
2% (w/v) dextrose and 2% (w/v) agar. RcAAP3
cDNA was excised with NotI (using the internal restriction
sites incorporated into adapters during cDNA library construction) and
cloned into the E. coli/yeast expression vector NEV-N (Sauer
and Stolz, 1994). NEV-N/RcAAP3 clones containing cDNAs in
sense and antisense orientations in relation to the constitutive
PMA1 promoter in the vector were identified by restriction
analysis. These constructs, together with the NEV-N control vector,
were transformed into the gap1 mutant essentially as
described by Dohmen et al. (1991). Transformants were first selected on
synthetic dextrose medium containing yeast nitrogen base (DIFCO
Laboratories, Detroit, MI) without ammonium sulfate and amino acids,
2% (w/v) dextrose, 0.5% (w/v) ammonium sulfate, and 2%
(w/v) agar. Colonies were washed from the plates with sterile
distilled water and plated onto low-citrulline, nitrogen-free medium
(DIFCO) supplemented with 2% dextrose and 0.2 mg
mL 1 citrulline as the sole source of nitrogen
and solidified with 2% (w/v) agar. Growth of the yeast amino
acid transport mutant containing NEV-N/RcAAP3 (sense and
antisense constructs) and NEV-N controls were analyzed on different
liquid media such as yeast/peptone/dextrose, synthetic dextrose, and on
a range of citrulline concentrations (0.1-1.0 mg
mL1). A600
readings were taken twice a day for 5 d.
Transport Measurements
For transport studies, yeast transformants
(NEV-N/RcAAP3) were grown to the logarithmic phase, washed
in 1% (w/v) Glc in 50 mM potassium
phosphate buffer (pH 4.5), and resuspended in 50 mM potassium phosphate buffer (pH 4.5). The cells
were preincubated for 5 min in 5 mM Glc (in
potassium phosphate buffer, pH 4.5) prior to performing uptake assays.
The standard assay contained [14C]citrulline
(0.5 mM) and potassium phosphate buffer (pH 4.5). The reaction was started by the addition of 9 to 15 mg fresh weight of
cells to give a final volume of 200 µL. For time course experiments, 45-µL samples were taken at 15, 75, 150, and 300 s, transferred to 5 mL of ice-cold water, filtered on glass fiber filters, and washed
with 3 × 5 mL of ice-cold water. Filters were dried and radioactivity determined with liquid scintillation spectroscopy (model
1209 Rackbeta, Pharmacia LKB, Uppsala, Sweden). The inhibitory effect
of a range of amino acids on citrulline uptake was determined by
including them at a 10-fold molar excess. For inhibition, kinetic, and
pH dependence studies, transport was determined from a 150-µL sample
after 5 min, during which time uptake was linear.
Southern Analysis
Young leaves obtained from mature castor bean plants were frozen
in liquid nitrogen and pulverized using a mortar and pestle. Genomic
DNA was isolated according to the method of Murray and Thompson (1980).
Samples of genomic DNA (10 µg) were digested with several different
restriction enzymes, electrophoresed in 0.8% (w/v) agarose
gels, and then transferred onto Hybond N+
(Amersham) membranes using a vacuum-blotting apparatus (Pharmacia Biotech) according to manufacturers' protocol. The blots were hybridized in a buffer containing 5× SSC, 2% (w/v) Boehringer and Mannheim blocker, 0.02% (w/v) SDS, and 0.1% (w/v)
laurylsarcosine at 65°C for 16 h with a
32P-labeled RcAAP3-cDNA probe prepared
using a labeling kit (Ready-To-Go, Pharmacia Biotech). The blots were
washed twice in 2× SSC and 0.1% (w/v) SDS at room temperature
for 15 min and the final washes were done at high stringency (60°C in
0.2× SSC and 0.1% [w/v] SDS). The blots were
autoradiographed at 80°C with intensifying screens.
Northern Analysis
Total RNA was extracted from various tissues of castor bean using
the method described by Logemann et al. (1987). RNA samples (10 µg)
were electrophoresed in 1% (w/v) agarose/formaldehyde gel and
blotted onto Hybond N+ membranes (Amersham). The
blots were hybridized with
32P-labeled-RcAAP3 probe at 68°C in
a buffer containing 5× SSC, 1% (w/v) Boehringer blocking
agent, 0.1% (w/v) N-laurosarcosine, and 0.02%
(w/v) SDS. After hybridization the blots were washed under
high-stringency conditions (2× SSC, 0.1% [w/v] SDS, room temperature; 0.5× SSC, 0.1% [w/v] SDS, 55°C; 0.1× SSC,
0.1% [w/v] SDS, 68°C). Equal loading of RNA was confirmed
by staining with ethidium bromide, stripping the blots, and reprobing
with a 32P-labeled 25S ribosomal cDNA probe from
Linum usitatissium (Goldsbrough and Cullis, 1981) using the
same hybridization and washing conditions described above.
| |
RESULTS |
Isolation of Castor Bean Amino Acid Permease cDNA
(RcAAP3) by High-Stringency Library Screening Using PCR
To isolate cDNA clones encoding AAPs, a cDNA library in gt10
was constructed (using mRNA isolated from 7-d-old castor bean seedlings) and screened using a PCR-based procedure (Israel, 1993). This method relies on the identification of particular cDNA clones in a
library using PCR. Nondegenerate oligonucleotide primers (RcAAP1 forward and reverse) designed from the nucleotide
sequence of the RcAAP1 partial-length cDNA clone were used
(Bick et al., 1998). The screening resulted in the isolation of four
positive phage pools after primary screening. One of these PCR
positives was carried through secondary and tertiary screens, and a
clone containing a cDNA 1.7 kb in size was selected for sequencing and further analysis.
Sequence analysis revealed similarities and differences at the
nucleotide sequence level with RcAAP1 and RcAAP2
(Bick et al., 1998). This indicated that we had isolated a third amino
acid permease from castor bean, which we designated as
RcAAP3 (Fig. 1). Thus, this
permease is related to but not identical to RcAAP1, even
though the primers were designed originally from the nucleotide sequence of RcAAP1. Comparison of the RcAAP3
nucleotide sequence with that of RcAAP1 showed that the
forward primer sequence was identical and the reverse primer region
differed only in two bases.
View larger version (72K):
[in this window]
[in a new window]
| Figure 1.
Deduced amino acid sequence and nucleotide
sequence of RcAAP3 encoding an amino acid permease from
castor bean. The underlined regions indicate the primer annealing
sites.
|
|
RcAAP3 Has the Characteristics of a Hydrophobic
Membrane Protein
The 1.7-kb RcAAP3 cDNA has an open reading frame of 467 amino acids encoding a predicted 51-kD protein (Fig. 1). It has 60 bases of 5 UTR and 213 bases of 3 noncoding region. RcAAP3
has neither a poly(A+) tail nor any distinct
polyadenylation signals. Hydropathy profile analysis of this
transporter, as analyzed by the Kyte-Doolittle algorithm, indicated its
highly hydrophobic nature and predicted about nine to 11 putative
transmembrane domains (Fig. 2).
View larger version (19K):
[in this window]
[in a new window]
| Figure 2.
Hydropathy plot for the amino acid sequence of
RcAAP3 calculated according to the method of Kyte and Doolittle with a
window size of 19 amino acids.
|
|
RcAAP3 showed significant sequence identities with the
castor bean amino acid permeases RcAAP1 and
RcAAP2, as well as with all the members of AAP
gene family of Arabidopsis. RcAAP3 showed highest identity with
RcAAP1 (86%) and 59% with RcAAP2. However, RcAAP2 is only a partial-length sequence and thus the level
of identity may change when information for the full-length sequence is available. The amino acid identities shared with the members of the Arabidopsis AAP family ranged from 57% to 77%. A phylogenetic analysis of amino acid permease genes is shown in Figure
3.
View larger version (9K):
[in this window]
[in a new window]
| Figure 3.
Phylogenetic tree for a range of plant amino acid
permeases. The tree was constructed from alignments of full-length
amino acid sequences for each gene. This analysis was performed using
the phylogeny interference package (Fitch-Margoliash method, version
3.5; J. Felsenstein, unpublished data). Accession numbers:
RcAAP1, AJ007574; RcAAP3, AJ132228; AtAAP1, x67124; AtAAP2, X71787;
AtAAP3, X77499; AtAAP4, X77500; AtAAP5, X77501; AtAAP6, X95736;
AtProt1, X95737; AtProt2, X95738; AtAUX1, X98772; NsAAP1, U31932;
AtLHT1, U39782; AtLHT2, AC000103; AtLHT3, AC002294; AtCAT1, X77502;
AtCAT2, AC004238; AtGABA, AF019637.
|
|
Heterologous Expression of RcAAP3 in the Yeast
Transport Mutant
The yeast gap1 mutant is unable to grow on a medium
containing citrulline (0.2 mg mL1) as the sole
source of nitrogen due to a mutation in the general amino acid permease
(Marvier et al., 1998). Transformation of this mutant with
RcAAP3 in the yeast/E. coli shuttle vector NEV-N (Sauer and Stolz, 1994) in sense orientation under the control of a
constitutive yeast plasma membrane H+-ATPase
(PMA1) promoter, restored the growth of this mutant on a low-citrulline
medium (Fig. 4). Antisense constructs of
RcAAP3 and vector controls grew extremely slowly on the
low-citrulline medium (Fig. 4) but were able to grow at high citrulline
concentrations, probably due to passive uptake (results not shown). All
three types of transformants had similar growth patterns on the
ammonium-sulfate-based medium (synthetic dextrose medium) (Fig. 4). The
transport properties of RcAAP3 were investigated further by determining
the uptake of [14C]citrulline. The sense
construct of RcAAP3 mediated the uptake of
[14C]citrulline (Fig.
5), which was linear for at least 30 min
(results not shown), whereas the antisense construct showed no
significant uptake (Fig. 5).
View larger version (17K):
[in this window]
[in a new window]
| Figure 4.
Growth analysis of gap1 mutants
transformed with RcAAP3-sense ( ),
RcAAP3-antisense ( ), or control NEV-N ( ) vector.
a, Growth on low-citrulline medium (0.2 mg mL1). b,
Growth on synthetic dextrose medium. Cultures were grown over a 5-d
period at 30°C with shaking. Results shown are the means of
three replicates from a representative experiment. The growth curves
were repeated twice with similar results.
|
|
View larger version (13K):
[in this window]
[in a new window]
| Figure 5.
Time course of [14C]citrulline
uptake (0.5 mM, 37 kBq) at pH 4.5 by RcAAP3
sense () and antisense () transformants. Uptake by
RcAAP3 (sense) transformants in the presence of 5 µM CCCP is also shown ( ). Results shown are the means
of three replicate experiments.
|
|
RcAAP3 Has Properties of a Proton-Coupled Amino Acid Symporter
RcAAP3-mediated citrulline uptake showed saturable kinetics, with
a Km of 0.4 mM
and a Vmax of 384 nmol
g1 min1 (Fig.
6). Citrulline uptake was inhibited by
the protonophore CCCP (Fig. 5; Table I)
and the uptake was higher at acidic pH (Fig.
7), suggesting a proton-coupled transport
mechanism. Citrulline uptake was strongly inhibited by the permeable
sulfydryl reagent NEM (72% inhibition), but showed lower sensitivity
to the nonpermeable reagent p-chloromercuribenzenesulfonic
acid (30% inhibition) (Table I). DEPC (a His modifier) inhibited
citrulline uptake by 80% (Table I). Phenolglyoxal (an Arg modifier)
and 2,4,6-trinitrobenzenesulfonic acid (a sulfydryl reagent) showed no
appreciable inhibition of RcAAP3-mediated citrulline uptake (Table I).
View larger version (16K):
[in this window]
[in a new window]
| Figure 6.
Concentration dependence of
[14C]citrulline (9 kBq) uptake by RcAAP3 at pH 4.5. Values for antisense controls have been subtracted. Hanes-Wolf plot of
RcAAP3 concentration curve data, Km = 0.4 mM and Vmax = 384 nmol
g1 min1. Results are from a representative
experiment repeated twice with similar results.
|
|
View this table:
[in this window]
[in a new window]
|
Table I.
Effect of various reagents on RcAAP3-mediated
citrulline transport
The citrulline concentration was 0.5 mM and the control
uptake rate was 187 nmol g1 min1.
|
|
View larger version (12K):
[in this window]
[in a new window]
| Figure 7.
pH dependence of [14C]citrulline
uptake (0.5 mM, 37kBq) by RcAAP3 sense
transformants. Values for antisense controls have been deducted.
Results shown are the means of two replicate experiments.
|
|
RcAAP3-Mediated Citrulline Uptake Is Inhibited by a Wide Range of
Amino Acids
A range of amino acids inhibited citrulline uptake mediated by the
RcAAP3 transformants (Fig. 8),
suggesting that this permease could have a fairly broad substrate
specificity for neutral and basic amino acids and a lower affinity for
acidic amino acids. The strongest inhibitors of citrulline uptake were
Ala (90% inhibition) and Met (91%); the weakest were Asp (42%), Glu
(52%), and Asn (46%) (Fig. 8).
View larger version (36K):
[in this window]
[in a new window]
| Figure 8.
Effect of a range of amino acids on
RcAAP3-mediated citrulline uptake. Results show the inhibition of
[14C]citrulline uptake (0.1 mM, 9 kBq) by a
10-fold excess (1 mM) of unlabeled amino acids at pH 4.5. Values for antisense controls have not been deducted. Results shown are
the means of two replicate experiments.
|
|
RcAAP3 Is Encoded by a Single Gene and Is Expressed in Both Source
and Sink Tissues of Castor Bean
Genomic DNA isolated from castor bean was restricted with five
different enzymes and the Southern blots were probed with radiolabeled RcAAP3 cDNA probes. The probe hybridized strongly to one
main restriction band on the blots, indicating that RcAAP3 is encoded by a single gene (Fig. 9). The expression
of RcAAP3 was investigated by RNA gel-blot analysis of total
RNA isolated from various organs of castor bean (Fig.
10). Transcripts of 1.85 kb
were observed in all organs tested, indicating the wide distribution of
RcAAP3 in castor bean.
View larger version (65K):
[in this window]
[in a new window]
| Figure 9.
Southern analysis of castor bean genomic DNA using
RcAAP3 as a probe. Genomic DNA (10 µg) was digested to
completion with restriction enzymes as indicated and hybridized with
32P-labeled RcAAP3 cDNA probe and washed
under high-stringency conditions. Lane 1, EcoRI; lane 2, NotI; lane 3, BamHI; lane 4, HindIII; lane 5, XbaI.
|
|
View larger version (62K):
[in this window]
[in a new window]
| Figure 10.
Expression of the castor bean gene,
RcAAP3, as determined by northern hybridization. Total
RNA (10 µg) from various tissues of the seedling (lanes 1-4) and
mature plant (lanes 5-6) was hybridized with a 32P-labeled
RcAAP3 cDNA probe. Lane 1, Cotyledons; lane 2, root;
lane 3, hypocotyl; lane 4, endosperm; lane 5, sink leaf; and lane 6, source leaf. RNA loading was determined by probing with a
32P-labeled 25S ribosomal cDNA probe.
|
|
| |
DISCUSSION |
Castor bean has been used extensively as a model plant for
studying assimilate transport (Komor et al., 1991; Williams et al.,
1996). Studies on amino acid transport with isolated plasma membrane
vesicles from castor bean seedlings suggested the presence of a number of amino acid transporter systems, with evidence in certain
cases of a proton symport mechanism (Weston et al., 1994, 1995;
Williams et al., 1996). Further studies in castor bean were hampered by
lack of data on the biochemical and molecular properties of individual
transporters, mainly due to difficulties encountered in the isolation
and purification of these proteins. In addition, because of the
presence of more than one transporter system in the vesicle
preparations, it was difficult to determine the kinetic properties of
individual transporters (Williams et al., 1996).
During the past few years, the use of yeast transport mutants and their
complementation with plant cDNA libraries has resulted in the isolation
and characterization of different families of amino acid permeases from
Arabidopsis (Frommer et al., 1993; Kwart et al., 1993; Fischer et al.,
1995; Rentsch et al., 1996). The use of sequence homology also enabled
the identification of transporters from ESTs and genomic clones (Chen
and Bush, 1997). Based on sequence similarities, the plant transporters
can be classified into two major superfamilies (Fischer et al., 1998).
ATF (amino acid transport family), the largest of these families,
includes the AAP gene family (Fischer et al., 1995), transporters that
prefer Pro (ProT) (Rentsch et al., 1996), Lys/His transporters (LHT)
(Chen and Bush, 1997), and AUX1-related proteins (Bennett et al.,
1996). The second superfamily, APC (amino acid-polyamine-choline
facilitator), consists of two families: CAT (cationic amino acid
transporter), which contains AtCAT1, a high-affinity uptake system for
basic amino acids (Frommer et al., 1995), and the GABA permease-related
transporter family for which a homolog has recently been identified
(Fischer et al., 1998). A high-affinity oligopeptide transporter gene
(NTR1) and a nitrate transporter (BnNRT1;2) have also been
shown to have affinity for His (Rentsch et al., 1995; Zhou et al.,
1998).
Studies to date describing the biochemical characteristics of cloned
amino acid permeases have been carried out exclusively on those derived
from Arabidopsis. Thus, it is important to ascertain if similar
properties are displayed by related transporters from other plant
species. We have pursued an alternative methodology for the isolation
of castor bean amino acid permeases in addition to the proven yeast
complementation strategies. We have recently isolated two
partial-length cDNA sequences for amino acid permeases (RcAAP1 and RcAAP2) by RT-PCR from RNA extracted
from castor bean seedlings (Bick et al., 1998). Because conventional
plaque hybridization screening of libraries for the isolation of cDNA
clones is often time consuming, we used an alternative screening
approach that involved screening at high stringency using a technique
based on PCR (Israel, 1993) with specific primers for the isolation of
castor bean amino acid permease cDNA clones. This has resulted in the
identification of a third amino acid permease cDNA, RcAAP3. This is the first report, to our knowledge, of the use of this PCR-library screening method to isolate a plant transporter gene from a
cDNA library. RcAAP3 was isolated entirely by using PCR as a technique
without additional hybridization techniques, as reported earlier
(Israel, 1993). To isolate related cDNAs from a library (e.g. cDNAs
from the same gene family) the level of primer degeneracy and the
stringency of the PCR conditions can be altered.
Southern analysis with RcAAP3 indicated that it was derived
from a single gene. On the basis of sequence homology,
RcAAP3 falls into the ATF superfamily and is most closely
related to the AAP subfamily of Arabidopsis. Hydropathy analysis
indicates that RcAAP3 is a highly hydrophobic protein with nine to 11 transmembrane domains. Chang and Bush (1997) recently provided
experimental evidence to suggest the presence of 11 hydrophobic
segments in AtAAP1/NAT2, with the N terminus in the cytoplasm and the C
terminus facing outside the cell.
Heterologous expression of RcAAP3 in the yeast transport
mutant lacking a functional yeast general amino acid permease
(gap1 mutant) has allowed us to investigate its transport
characteristics. Several features indicate that RcAAP3 is a
proton-coupled permease: sensitivity to the protonophore CCCP and to
uncouplers, increased uptake at acidic pH, and saturable kinetics.
However, the pH dependence could be explained by the intrinsic pH
optimum of the transporter rather than by a dependence on the
proton-motive force; the inhibitors may have a direct effect on the
permease as opposed to the driving force. Detailed electrophysiological
studies following expression in oocytes could be used to help resolve
whether transport is indeed proton coupled.
Protein-modifying reagents such as NEM and DEPC significantly inhibited
citrulline uptake. It is not clear at present whether these inhibitors
directly affect the permease or if they act on the driving force.
Interestingly, RcAAP1 showed only low inhibition by these inhibitors
(Marvier et al., 1998); however, this could have been due to
differences in the yeast strains that were used for expression. It has
previously been found that while NEM inhibits solute transport in
intact tissue, it has no effect on uptake into castor bean plasma
membrane vesicles. It has been suggested that in castor bean there is
little direct effect on the permease but, rather, the response is due
to an indirect effect on the driving force (Williams et al., 1992;
Weston et al., 1994). The His modifier DEPC has been shown to inhibit
amino acid uptake into plasma membrane vesicles (Li and Bush, 1990;
Weston et al., 1994). Based on substrate protection assays, Bush et al.
(1996) suggested that DEPC binds at, or binding is conformationally
linked to, the substrate-binding site. DEPC also inhibited amino acid uptake by the Arabidopsis AAP2 expressed in the yeast transport mutant
22574d (Kwart et al., 1993). Site-directed mutagenesis studies on AAP1
have shown that a single amino acid change at His-337 results in a loss
of amino acid transport activity in transformed yeast (Bush et al.,
1996). Both RcAAP1 (Marvier et al., 1998) and RcAAP3 contain a
conserved His residue at this site and so this may not explain the
differences in the response of the transformants to DEPC
inhibition.
RcAAP3-mediated citrulline uptake was inhibited by a number of amino
acids (neutral, basic, and acidic), indicating that RcAAP3 recognized a
broad range of amino acids differing markedly in structure. However,
inhibition was higher with neutral and basic amino acids compared with
acidic amino acids. Direct transport measurements would be required
with individual radiolabeled amino acids in order to differentiate
between inhibition due to competition for transport and that for
binding alone. Fischer et al. (1995) have grouped the AAPs into two
subfamilies based on their recognition of basic amino acids: AAP1,
AAP2, and AAP4 recognize acidic and neutral amino acids and ureides,
whereas AAP3 and AAP5 are general transporters that also recognize
basic amino acids. The inhibition studies indicate that RcAAP3 is
similar to the latter subfamily, and in the phylogenetic analysis
RcAAP3 appears to be the most closely related to
AtAAP3 in the Arabidopsis AAP family. Interestingly, however, RcAAP1 is also closely related to RcAAP3
and AtAAP3, but this permease was shown to have a higher
specificity for basic amino acids (Marvier et al., 1998). Further
studies are in progress using heterologous expression in oocytes to
determine more accurately the specificity of RcAAP1 and RcAAP3.
Northern analysis indicated that RcAAP3 is expressed in a
wide range of tissues in both the developing seedling and mature castor
bean plant. This is in contrast to the expression patterns seen for
RcAAP1 and RcAAP2, which are predominantly
expressed in the cotyledons, to a lesser extent in the roots, and at
low levels in endosperm, hypocotyl, and the source and sink tissues of
mature plants (Bick et al., 1998). In addition, AtAAP3, the most closely related gene in Arabidopsis, is almost exclusively found
in roots, where it has been suggested to function in uptake and
retrieval of amino acids from the soil (Fischer et al., 1995). This
suggests a different biological role for RcAAP3, possibly functioning more generally in the accumulation of amino acids for
protein synthesis. Further expression analysis at the cellular level
would help to clarify this point. Thus, it is possible that highly
related transporters (in terms of structure) may serve quite different
physiological roles. This may depend on the specific tissue and cell in
which they are expressed and also on the availability of particular
amino acids in the local environment.
In conclusion, there is a family of amino acid permeases in castor bean
(RcAAPs) that are related to the AtAAP family of Arabidopsis. Although
the RcAAPs show high homology to AtAAPs in terms of their protein
identity, there are differences both in terms of their tissue-specific
expression and their functional characteristics. Even members of the
AtAAPs show differences in these properties despite their relatedness.
Identification of structural domains involved in the amino acid
transport process would help to elucidate these functional differences.
It is clear that although Arabidopsis is a useful model, it is also
important to study amino acid transporters in other plant species for a
more comprehensive understanding of their contribution to nitrogen
nutrition and distribution.
| |
FOOTNOTES |
1
This work was supported by the Biotechnology and
Biological Sciences Research Council and The Royal Society.
2
Present address: Centre for Plant Sciences,
Leeds Institute for Plant Biotechnology and Agriculture, Irene Manton
Building, University of Leeds, Leeds LS2 9JT, UK.
*
Corresponding author; e-mail l.e.williams{at}soton.ac.uk; fax
44-0-1703-594319.
Received February 4, 1999;
accepted May 6, 1999.
| |
ABBREVIATIONS |
Abbreviations:
CCCP, carbonylcyanide-m-chlorophenylhydrazone.
DEPC, diethylpyrocarbonate.
NEM, N-ethylmaleimide.
pfu, plaque
forming unit.
| |
ACKNOWLEDGMENTS |
We are grateful to Prof. N. Sauer (Universität
Erlangen-Nürnberg, Erlangen, Germany) for generously providing
the yeast/E. coli expression vector NEV-N. We also
acknowledge the National Collection of Yeast Cultures, Biotechnology
and Biological Science Research Council Institute of Food Research,
Norwich, UK, for supplying the 2512c yeast mutant and Dr. J.A. Bick
(Rutgers University, New Brunswick, NJ) for generating the
gap1 yeast mutant.
| |
LITERATURE CITED |
Bennett MJ,
Marchant A,
Green HG,
May ST,
Ward SP,
Millner PA,
Walker AR,
Schulz B,
Feldmann KA
(1996)
Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism.
Science
273:
948-950
[Abstract]
Bick JA,
Neelam A,
Hall JL,
Williams LE
(1998)
Amino acid carriers of Ricinus communis expressed during seedling development: molecular cloning and expression analysis of two putative amino acid transporters, RcAAP1 and RcAAP2.
Plant Mol Biol
36:
377-385
[CrossRef][ISI][Medline]
Bush DR,
Chiou TJ,
Chen L
(1996)
Molecular analysis of plant sugar and amino acid transporters.
J Exp Bot
47:
1205-1210
Chang H-C,
Bush DR
(1997)
Topology of NAT2, a prototypical example of a new family of amino acid transporters.
J Biol Chem
272:
30552-30557
[Abstract/Free Full Text]
Chen L,
Bush DR
(1997)
Plant Physiol
115:
1127-1134
[Abstract]
Dohmen RJ,
Strasser AWM,
Honer CB,
Hollenberg CP
(1991)
An efficient transformation procedure enabling long term storage of competent cells of various yeast genera.
Yeast
7:
691-692
[CrossRef][ISI][Medline]
Fischer W-N,
Andre B,
Rentsch D,
Krolkiewicz S,
Tegeder M,
Breitkreuz K,
Frommer WB
(1998)
Amino acid transport in plants.
Trends Plant Sci
3:
188-195
[CrossRef][ISI]
Fischer W-N,
Kwart M,
Hummel S,
Frommer WB
(1995)
Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis.
J Biol Chem
270:
16315-16320
[Abstract/Free Full Text]
Frommer WB,
Hummel S,
Riesmeier J
(1993)
Proc Natl Acad Sci USA
90:
5944-5948
[Abstract/Free Full Text]
Frommer WB,
Hummel S,
Unseld M,
Ninnemann O
(1995)
Seed and vascular expression of a high-affinity transporter for cationic amino acids in Arabidopsis.
Proc Natl Acad Sci USA
92:
12036-12040
[Abstract/Free Full Text]
Goldsbrough,
Cullis CA
(1981)
Characterization of the genes for ribosomal RNA in flax.
Nucleic Acids Res
9:
1301-1309
[Abstract/Free Full Text]
Israel DI
(1993)
A PCR based method for high stringency screening of DNA libraries.
Nucleic Acids Res
21:
2627-2631
[Abstract/Free Full Text]
Komor E, Orlich G, Kohler J, Hall JL, Williams LE (1991) The
Ricinus seedling: a model plant to study phloem transport.
In JL Bonnemain, S Delrot, WJ Lucas, J Dainty, eds, Recent
Advances in Phloem Transport and Assimilate Compartmentation. Quest
Editions/Presses Academiques, Nantes, France, pp 301-308
Kwart M,
Hirner B,
Hummel S,
Frommer WB
(1993)
Plant J
4:
993-1002
[CrossRef][ISI][Medline]
Li ZC,
Bush DR
(1990)
 pH-dependent amino acid transport into plasma membrane vesicles isolated from sugar beet (Beta vulgaris L.) leaves. I. Evidence for carrier-mediated, electrogenic flux through multiple transport systems.
Plant Physiol
94:
268-277
[Abstract/Free Full Text]
Logemann J,
Schell J,
Willmitzer L
(1987)
Improved method for the isolation of RNA from plant tissues.
Anal Biochem
163:
16-20
[CrossRef][ISI][Medline]
Marvier AC,
Neelam A,
Bick JA,
Hall JL,
Williams LE
(1998)
Cloning of a cDNA coding for an amino acid carrier from Ricinus communis (RcAAP1) by functional complementation in yeast: kinetic analysis, inhibitor sensitivity and substrate specificity.
Biochim Biophys Acta
1373:
321-331
[Medline]
Murray HG,
Thompson WF
(1980)
Rapid isolation of high molecular weight plant DNA.
Nucleic Acids Res
8:
4321-4325
[Abstract/Free Full Text]
Rentsch D,
Hirner B,
Schmeizer E,
Frommer WB
(1996)
Salt stress-induced proline transporters and salt stress-repressed broad specificity amino acid permeases identified by suppression of a yeast amino acid permease-targeting mutant.
Plant Cell
8:
1437-1446
[Abstract]
Rentsch D,
Laloi M,
Rouhara I,
Schmelzer E,
Delrot D,
Frommer WB
(1995)
NTR1 encodes a high affinity oligopeptide transporter in Arabidopsis.
FEBS Lett
370:
264-268
[CrossRef][ISI][Medline]
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual, Ed 2.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Sauer N,
Stolz J
(1994)
SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana: expression and characterization in baker's yeast and identification of the histidine tagged protein.
Plant J
6:
67-77
[CrossRef][ISI][Medline]
Weston K,
Hall JL,
Williams LE
(1994)
Characterization of a glutamine/proton cotransporter from Ricinus communis roots using isolated plasma membrane vesicles.
Physiol Plant
91:
623-630
[CrossRef]
Weston K,
Hall JL,
Williams LE
(1995)
Characterization of amino acid transport in Ricinus communis roots using isolated membrane vesicles.
Planta
196:
166-173
Williams LE,
Bick JA,
Neelam A,
Weston KN,
Hall JL
(1996)
J Exp Bot
47:
1211-1216
Williams LE,
Nelson SJ,
Hall JL
(1992)
Characterization of solute proton cotransport in plasma membrane vesicles from Ricinus cotyledons and a comparison with other tissues.
Planta
186:
541-550
Zhou J-J,
Theodoulou FL,
Muldin I,
Ingemarsson B,
Miller AJ
(1998)
Cloning and functional characterization of a Brassica napus transporter that is able to transport nitrate and histidine.
Proc Natl Acad Sci USA
273:
12017-12023
|
|
Top
Abstract
Introduction