|
Plant Physiol. (1999) 120: 1083-1094
Cloning and Expression of a Hexose Transporter Gene Expressed
during the Ripening of Grape Berry1
Laurent Fillion,
Agnès Ageorges,
Sarah Picaud,
Pierre Coutos-Thévenot,
Rémi Lemoine,
Charles Romieu, and
Serge Delrot*
Laboratoire de Physiologie et Biochimie Végétales,
Equipe Scientifique Associée Centre National de la
Recherche Scientifique 6161, Bâtiment Botanique, Unité de
Formation et de Recherches Sciences, 40 Avenue du Recteur
Pineau, Université de Poitiers, 86022 Poitiers cedex, France
(L.F., S.P., R.L., S.D.); Laboratoire de Biochimie Métabolique,
Institut des Produits de la Vigne, Institut National de la Recherche
Agronomique, 2 Place Jean Viala, 34062 Montpellier cedex, France (A.A.,
C.R.); and Louis Vuitton Moet Hennessy Recherches, 20 Avenue de
Champagne, BP 140, 51333 Epernay cedex, France (P.C.-T.)
 |
ABSTRACT |
The ripening of grape (Vitis
vinifera L.) is characterized by massive sugar import into the
berries. The events triggering this process and the pathways of
assimilate transport are still poorly known. A genomic clone
Vvht1 (Vitis
vinifera hexose transporter1) and the
corresponding cDNA encoding a hexose transporter whose expression is
induced during berry ripening have been isolated. Vvht1
is expressed mainly in the berries, with a first peak of expression at
anthesis, and a second peak about 5 weeks after véraison (a
viniculture term for the inception of ripening). Vvht is
strictly conserved between two grape cultivars (Pinot Noir and
Ugni-Blanc). The organization of the Vvht1 genomic sequence is
homologous to that of the Arabidopsis hexose transporter, but differs
strongly from that of the Chlorella kessleri hexose
transporter genes. The Vvht1 promoter sequence contains several
potential regulating cis elements, including ethylene-,
abscisic acid-, and sugar-responsive boxes. Comparison of the Vvht1
promoter with the promoter of grape alcohol dehydrogenase, which is
expressed at the same time during ripening, also allowed the
identification of a 15-bp consensus sequence, which suggests a possible
co-regulation of the expression of these genes. The expression of Vvht1
during ripening indicates that sucrose is at least partially cleaved before uptake into the flesh cells.
 |
INTRODUCTION |
The grape (Vitis vinifera L.) is a productive plant
considered as the world's premier fruit (Coombe, 1989 ), with nearly 9 million hectares of viticultural land in 1990 (Kanellis and
Roubelakis-Angelakis, 1993 ). It is used for wine, distilled liquors,
juice, dried fruit (raisins), fresh consumption (table grapes), and
concentrate. In spite of this major economic importance, the process of
grape maturation is still poorly understood (Coombe, 1992 ). The
ripening of grapes is nonclimacteric, and the growth pattern of the
berries follows a double-sigmoid curve that is usually divided into
three stages (Kanellis and Roubelakis-Angelis, 1993; Tattersall et al., 1997 ).
Stage I, immediately following flowering, is characterized by a short
period of cell division, followed by vacuolar swelling resulting from
the storage of organic acids and by cell enlargement. The acidity of
the berries reaches a maximum at the end of this stage. Stage II,
approximately 7 to 10 weeks after flowering, is a lag phase
characterized by slow growth. Stage III starts with fast softening,
rapid accumulation of sugars and amino acids, decrease of acidity, and
expansion of the flesh cells. The entry into stage III, which may occur
within 24 h (Coombe, 1992 ), is called véraison and
corresponds to the inception of ripening. During this stage, a decrease
in organic acid content and an increase in soluble sugars induce a
rapid decline of the acid/sugar balance. Just before véraison,
the grape berry is hard, green, acidic, and unsweet, and contains no
more than 150 mM hexose, with a Glc/Fru ratio of 2 (Findlay
et al., 1987 ). Twenty days after véraison, the hexose
concentration of the berry is close to 1 M, with a Glc/Fru
ratio of 1. Due to the size increase of the berry, its hexose content
is increased about 7-fold during ripening. Because Suc is the major
form of translocated sugar in grape, the rapid accumulation of hexose
characterizing the ripening of the berry must involve the activity of
Suc, of hexose transporters located at the plasma membrane and/or
tonoplast, and of invertases located in the soluble
compartments.
The triggers of ripening in nonclimacteric fruits such as grape are
poorly known. Davies and Robinson (1996) have cloned two cDNAs (GIN1
and GIN2) encoding vacuolar invertase from grape berries. Expression
studies indicated that the rise in invertase activity considerably
precedes the phase of rapid hexose accumulation. This suggests that
although soluble invertases may be important for the accumulation of
hexose in the vacuole, the synthesis of these enzymes does not trigger
sugar accumulation in the berry (Davies and Robinson, 1996 ). The sugar
status of the berry itself may be important for the induction of
ripening-related genes. Indeed, the expression of a number of different
genes encoding proteins with a wide range of biological functions (Jang
and Sheen, 1994 ; Salzman et al., 1998 ) may be induced by the sugar
status of the cells. Tattersall et al. (1997) , who recently cloned a thaumatin-like protein expressed during grape ripening, suggested that
the temporally and spatially defined induction of ripening-related genes may be directly or indirectly caused by the onset of sugar accumulation, possibly due to the presence of so-called "sugar boxes" identified within the promoters of these genes (Tsukaya et
al., 1991 ).
The extent of sugar import in a sink organ depends on sugar utilization
and/or compartmentation. As mentioned above, invertase activity is not
tightly related to sugar accumulation in the berry (Davies and
Robinson, 1996 ). Suc synthase activity remains at a low level
throughout the maturation of berries (Hawker, 1969 ). This suggests that
in grape berry, sugar accumulation may depend more on compartmentation
than on metabolism.
The pathways of sugar unloading in grape are poorly understood
(Patrick, 1997 ). Numerous plasmodesmata connect the flesh cells of the
storage parenchyma of the berry (P. Fleurat-Lessard, unpublished data).
However, at the phloem/storage parenchyma interface, sufficient plasma
membrane surface area is available to support exchange with the
apoplast. The high sugar concentrations found in the berry apoplast and
their sensitivity to changes in phloem import rates also suggest an
apoplastic step (Patrick, 1997 ), which makes it important to study the
sugar transporters that may control this step.
Although various Suc transporters have now been cloned from plant
tissues (Riesmeier et al., 1992 , 1993 ; Gahrtz et al., 1994 , 1996 ; Sauer
et al., 1994 ), little is known so far about the expression and the
activity of these transporters in sink tissues. AtSUC2 encodes a Suc
transporter strongly expressed in the roots and seeds of Arabidopsis,
which suggests that it may be involved in phloem unloading (Truernit
and Sauer, 1995 ). Recently, Weber et al. (1997) characterized a Suc
transporter clone (VfSUT1) whose expression is correlated with the
differentiation of the epidermal transfer cells of broad bean
cotyledons. This clone is also expressed, although at a lower level, in
other parts of the plant.
Hexose transporters are encoded by a multigene family of up to 12 members in various species (for review, see Chiou and Bush, 1996 ;
Tanner and Caspari, 1996 ). MST1, a cDNA clone for a monosaccharide transporter isolated from tobacco is most strongly expressed in various
sink tissues, such as roots, flowers, and young leaves (Sauer and
Stadler, 1993 ). The STP4 hexose transporter of Arabidopsis is primarily
expressed in roots and flowers and is regulated by environmental stress
(Truernit et al., 1996 ). Among the many putative hexose carriers cloned
from higher plants, only a few have been functionally described by
heterologous expression in yeast (Sauer et al., 1990 ; Sauer and
Stadler, 1993 ; Weig et al., 1994 ). Some evidence also suggests that
hexose transporters are involved in a hexokinase-independent signaling
pathway in sugar sensing (Smeekens and Root, 1997).
For a better understanding of the unloading process and sugar
accumulation, a research program aimed at the characterization of
various membrane transporters in grape berry is being developed. The work described below was focused at the characterization of a
hexose transporter expressed during the ripening of the berries.
The accession numbers for the sequences reported in the article are:
AJ001061, coding sequence for Vvht1; AJ001062, DNA for the Vvht1 promoter; and Y09590, mRNA for
Vvht1.
 |
MATERIALS AND METHODS |
Plant Material
Tissue samples were collected from the grape (Vitis
vinifera L.) cv Ugni-Blanc (from the Combe de Rudard in Juillac le
Coq vineyard near Cognac, France and ENSAM-INRA vineyard, Le Chapitre, Montpellier, France) or from cv Pinot noir (from the Germaine vineyard,
Epernay, France) in the 1995 and 1996 seasons.
RNA Extraction
Berries collected at different stages of development (as
indicated in ``Results'') were frozen in liquid nitrogen and stored
at 80°C until use. Various procedures were tested to achieve RNA
isolation from the berries, which contained high levels of sugars and
of phenolic compounds. Two procedures were finally selected for
extracting the RNAs and studying the amounts of hexose transporter
transcripts.
In the first procedure, total RNA was extracted from the samples
according to a method modified from Davies and Robinson (1996) . The berries were deseeded before the extraction. The frozen samples (1.5 g) were ground to a powder in liquid nitrogen and added to 10 mL
of extraction buffer containing 5 M sodium perchlorate, 0.3 M Tris-HCl, pH 8.3, 8.5% (w/v) insoluble PVPP, 2% (w/v)
PEG 4000, 1% (w/v) SDS, and 1% (w/v) -mercaptoethanol. The
resulting slurry was stirred for 30 min at 37°C and layered on a
pierced tube (tube bottle adapter, Sorvall) containing a 1-cm layer of glass wool. This tube was inserted into a 50-mL centrifuge tube (Corning) and centrifuged at 200g for 10 min. After addition
of 2.5 volumes of 95% ethanol, nucleic acids were precipitated for at
least 20 min at 20°C, recovered by centrifugation at
7,700g for 15 min, and rinsed with 70% ethanol. The pellet
was dried under vacuum, and resuspended in 2 mL of DEPC-treated water.
The proteins were extracted twice with an equal volume of
phenol:chloroform:isoamylic alcohol (25:24:1, v/v) and once with
chloroform:isoamylic alcohol (24:1, v/v). After precipitation with 0.1 volume of 3 M sodium acetate (pH 5.2) and 2.5 volumes of 95% ethanol, total RNA was resuspended in 0.1 mL of
DEPC-treated water.
The purity and the quality of RNA were checked by gel electrophoresis
and its concentration was estimated by measuring the A260. This procedure was also used to
extract total RNA from young leaves (2 cm long), mature leaves,
petioles, tendrils, and roots of plants at the véraison stage.
The yield of RNA extraction obtained with this procedure was about 75 µg g 1 fresh weight for the berries and 100 µg g 1 fresh weight for all other organs
except the roots (40 µg g 1 fresh weight).
These RNAs were used for northern analysis as described below.
Isolation of intact RNA with a reasonable yield was also achieved by a
second procedure, which was modified from that described by
Tesnière and Vayda (1991) . All glassware was sterilized by heating at 180°C for at least 6 h. The grinding buffer contained 200 mM Tris-HCl (pH 8.5), 300 mM LiCl, 10 mM Na2 EDTA, 1% (w/v) sodium
dexycholate, and 1% (w/v) SDS. After sterilization at 120°C for 20 min, 1 mM aurintricarboxylic acid, 5 mM
thiourea, and 10 mM DTT were dissolved in the medium and
1% (v/v) Nonidet P-40 was added. The seeds were removed, the berries
were crushed to a fine powder in liquid nitrogen, and 2% (w/v)
PVPP was mixed with the brei. The powder was transferred to test tubes
(Corning) containing the grinding buffer with 0.3 g plant material
mL buffer. After
thawing, the content of the tubes was mixed by manual inversions for 10 min.
To remove intracellular debris and PVPP, the samples were centrifuged
at 12,000g for 15 min. The supernatant (still containing some PVPP) was
then transferred to another tube, centrifuged at 12,000g for
5 min, and the final supernatant was filtered on two layers of
Miracloth (Calbiochem). CsCl was added (0.2 g/mL filtrate) at room
temperature. After total dissolution of the salts, 20 mL of the
filtrate was transferred to a tube (Ultraclear, Sorvall) containing 10 mL of a 5.7 M CsCl solution prepared in 10 mM Tris-HCl (pH 7.5). The filtrate was
centrifuged on this CsCl cushion for 26 h at 20°C at
110,000g in a swinging rotor (model AH-629, Sorvall). The
supernatant was discarded by aspiration, and the RNA pellet was
resuspended in 1 mL of DEPC-treated water. The samples were kept on ice
until the end of the procedure, and the centrifugations were run at
4°C. RNA was reprecipitated for 75 min at 80°C after addition of
2.5 volumes of 96% ethanol and 0.2 volume of 3 M
LiCl. After centrifugation for 30 min at 12,000g, the RNA
pellet was washed three times with 1 mL of 2.5 M
sodium acetate (pH 5.5) before rinsing with 1 mL of 70% ethanol. The
pellet was dried under vacuum for 5 min, and resuspended in
DEPC-treated water (about 50 µL per centrifugation tube).
RNAs obtained with this extraction procedure (with yields ranging from
50 to 60 µg g 1 fresh weight at anthesis to 20 µg g 1 fresh weight at the latest stages of
ripening) were used to estimate the amount of hexose transporter
transcripts by RT-PCR at different stages of development of the berries
and to prepare the cDNA library from berries at the véraison
stage.
cDNA Library Construction and Screening
Total RNA was extracted from grape (cv Pinot noir) berries
collected at the véraison stage using the CsCl procedure
described above. Poly(A+) RNA was isolated from
RNA (2 mg) using oligo(dT) columns (Stratagene). Double-stranded cDNA
was prepared using a cDNA synthesis kit, and a cDNA library was
constructed using the Lambda ZAP-cDNA synthesis kit (Stratagene). The
fragments were inserted at the EcoRI site of the Lambda ZAP
II phage. The size of the DNA fragments ranked between 0.5 and 2.7 kb,
with a mean size of 1.2 kb. Approximately 1.2 × 106 independent clones were obtained. The library
was packaged using a gold packaging extract (Gigapack II, Stratagene).
A grape hexose transporter probe was obtained by RT-PCR starting from
15 µg of total RNA extracted from berries (cv Ugni-Blanc) harvested
at the véraison stage. After denaturation of RNA for 10 min at
65°C, first-strand cDNA was synthesized by RT using a first-strand
cDNA synthesis kit (Pharmacia) in a medium containing 45 mM
Tris-HCl (pH 8.3), 68 mM KCl, 15 mM DTT, 9 mM MgCl2, 0.08 mg
mL 1 BSA, and 1.8 mM each dNTP. The
mRNA/cDNA complexes were denaturated for 5 min at 90°C. The following
degenerated oligonucleotides were used as primers for PCR:
TTTGC(G/T)TGGTC(C/G)TGGGG(A/C)CC (forward primer H2) and
(A/C)CC(C/T)TT(C/G/T) GTCTG(A/C/G)GGCAA (reverse primer H3). The
forward primer corresponds to a FAWSWGP conserved motif and the reverse
primer to a LPETKG conserved motif (Bush, 1993 ). PCR amplification was
performed for 30 cycles (1 min at 92°C, 1.5 min at 48°C, 1 min at
72°C), and the amplified fragments were cloned in the
EcoRV site of the pSK+ vector.
Approximately 500,000 plaques were screened with the
[ -32P]dATP-labeled 250-bp hexose transporter
fragment obtained by RT-PCR. Seven positive plaques were obtained after
three rounds of screening. The pBlueScript SK(+) (Stratagene) phagemids
containing the positive cDNAs were excised from Lambda ZAP II phage in
vivo with the R408 helper phage and cloned into Escherichia
coli DH5 cells. One of the seven positive clones was lost at
this stage. The size of the inserts was estimated for the six other
clones using PCR with the T3 and T7 primers located on each side of the
multicloning site.
Genomic Library Construction and Screening
DNA was extracted from young leaves of the grape cv Ugni-Blanc and
partially digested by MboI. The resulting DNA fragments were
cloned in the EMBL3 SP6/T7 phage at the BamHI site.
Independent clones (800,000) were obtained, with DNA fragments ranking
between 9 and 22 kb. About 350,000 plaques were screened using the
hexose transporter probe.
Sequence Analysis
Sequencing was run on the two DNA strands using the dideoxy method
on a sequencer (ALF, Pharmacia). For long DNA fragments, progressive
unidirectional deletions were made using the Erase-a-Base kit
(Promega). Homology searches were done using the program BLAST (Altschul et al., 1990 ) and the promoter sequence was analyzed with the PLACE database using a signal scan program
(http://www.dna.affrc.go.jp/htdocs/PLACE/). Sequences were also
analyzed using the computer program Geneworks (Intelligenetics,
Mountain View, CA).
Southern Hybridization
Genomic DNA isolation from young leaves of the grape cv Ugni-Blanc
was performed according to the method of Steenkamp et al. (1994) . The
DNA (15 µg) was digested with EcoRI, HindIII,
BglII, or BamHI restriction enzymes. Digested
genomic DNA was separated by electrophoresis in 0.8% agarose gel, and
blotted on nylon membrane (Hybond N, Amersham). Blots were hybridized
to 32P-labeled KpnI/HpaI
fragment of Vvht1 (Vitis
vinifera hexose transporter 1). Southern
hybridization was performed in 6× SSPE (saline sodium phosphate EDTA
buffer), 0.5% SDS, 5× Denhardt's solution, and 100 µg
mL 1 salmon-sperm DNA for 16 h at 65°C.
Filters were washed for 20 min at room temperature in 3× SSC and 0.5%
SDS, then two times for 30 min at 65°C in 1× SSC and 0.1% SDS.
Final washing steps were performed in 0.2× SSC and 0.1% SDS at 65°C
for 45 min.
Northern Analysis
Northern analysis was according to the method of Sambrook et al.
(1989) with minor modifications. Twenty micrograms of RNA was deposited
on each lane. A 400-bp fragment located in the 3 end of the Vvht1
sequence, starting from base 1,170, was prepared by digestion with
BstXI and NotI, and used for hybridization. This
probe was 32P labeled with the Ready-to-Go DNA
labeling kit (Pharmacia). The nylon membrane was prehybridized for
4 h at 65°C in a medium containing 250 mM
sodium phosphate (pH 5.2), 6.6% SDS (w/v), 1 mM
EDTA (pH 8.0), and 1% (w/v) BSA. After hybridization for 16 h at
65°C, the membranes were washed with SSC (2×, 1×) and 0.1% SDS
at 65°C.
The quality and the amount of RNAs were checked by hybridization with a
constitutive probe (grape -tubulin) prepared by PCR with the
following primers: CTGGTATTGTTGRTAYTC and ATGAGRGARATCCTTCAC (generous
gift from Nathalie Noiraud, University of Poitiers, France). The
membranes were read with an imager (Instant Imager, Packard
Instruments). All data were corrected with this internal standard for
the amount of RNA deposited per lane.
Quantitative RT-PCR
RT was run with reverse transcriptase (Superscript II RNase H,
GIBCO-BRL) on 5 µg of total RNA extracted from cv Ugni-Blanc berries
harvested at different stages of development. The RNA was denaturated
at 70°C for 10 min and RT was run in 20 µL for 50 min at 42°C in
the presence of 0.5 µg of oligo(dT) 12 to 18 primers. One microliter
of cDNA was amplified in a total volume of 25 µL containing 10 mM Tris-HCl, pH 9.0, 1.5 mM
MgCl2, 50 mM KCl, 1% (w/v) Triton
X-100, 0.1% (w/v) gelatin, 2 mM dNTP, and 0.2 unit of
Taq polymerase (A.T.G.C., Noisy-Le-Grand, France). PCR was run using the degenerated primers H2 and H3 described above to
allow a general amplification of all transcripts related to the hexose
transporters. Twenty cycles of amplification were run in the following
conditions: 92°C for 50 s, 50°C for 60 s, and 72°C for
90 s. With this number of cycles, amplification occurs in the
linear range and allows good quantification of amplified products.
Three independent RT-PCR reactions were performed using two different
batches of RNA and yielded similar results. Amplification products were
separated in a 1.5% agarose gel and transferred onto nylon membrane
(Hybond N, Amersham).
Hybridization was run with two kinds of probe. One probe, specific for
Vvht1, was obtained by PCR with the primers H2 = TTGCATGGTCCTGGGGTCC, and H4 = GTCATCAATCAATTATTTGAGAGG, which allowed amplification of a
482-bp fragment covering the 3 noncoding sequence of Vvht1. The other
probe, Vvht2, was a 250-bp fragment obtained after PCR with the H2/H3
degenerated primers and cloning in pSK+. Preliminary analysis (data not
shown) indicated that although they both are highly homologous to
hexose transporters, Vvht1 and Vvht2 possess significantly different
sequences and do not cross-hybridize.
Blots were hybridized at 42°C overnight to the
32P-labeled hexose transporter probes in 50%
(w/v) formamide, 5× SSPE, 4× Denhardt's solution, 0.5% SDS, and 100 µg of salmon-sperm DNA. Filters were washed for 20 min at room
temperature in 2× SSC and 0.5% SDS, for 20 min at room temperature in
1× SSC and 0.2% SDS, and twice for 40 min each at 65°C with 0.1×
SSC and 0.5% SDS. Signals on the hybridization membranes were
quantified by a phosphor imager (STORM, Molecular Dynamics) and the
membranes were used for autoradiography.
Sugar Assays
Berries were deseeded, weighed, immediately frozen in liquid
nitrogen, and stored at 80°C until use. Sugars were measured by
high-performance anion-exchange chromatography as described in
Ollé et al. (1996) .
 |
RESULTS |
Isolation and Characterization of the VvHT1 cDNA Clone
RT of total RNA extracted from berries harvested at the
véraison stage followed by amplification with the H2 and H3
primers yielded a single band about 250 bp long. The amplified DNA was purified and cloned in the ECORV site of pSK+. Restriction analysis and
sequence analysis made on 20 independent clones showed the presence of
two different inserts exhibiting 62% to 72% identity to the different
plant hexose transporters found in the database. The DNA fragments
carried by these clones were called Vvht1L and Vvht2A. The fragment
Vvht1L was used to screen a cDNA library prepared from grape berries at
the véraison stage. Out of nine positive signals observed after
the first round of screening, seven independent clones were isolated
after the third round. One clone was lost during in vivo excision. The
size of the DNA insert carried by the six other clones was estimated by
PCR using the T3 and T7 primers located on each side of the insertion
site. Clones 2 and 3 contained a 4.3-kb insert, clones 20 and 30 contained a 2.3-kb insert, and clones 10 and 17 contained,
respectively, a 1.0- and a 1.3-kb insert. Because the size of the
inserts contained in clones 2 and 3 was much higher than would be
expected for a hexose transporter (about 2 kb), partial sequencing was
only run for DNA inserts carried by clones 10, 17, 20, and 30. Clones
20 and 30 were identical and contained a full-length cDNA highly homologous to STP1, a hexose transporter from Arabidopsis (Sauer et
al., 1990 ). Clone 20 was used for further analysis. Clones 10 and 17 contained partial fragments corresponding to clones 20 and 30 and were
thus not further analyzed.
The insert carried by clone 20 contained a 1,560-bp ORF followed by a
217-bp sequence containing a poly(A+) tail. The
500-bp sequence located upstream of the start codon was highly
homologous to rRNA. The presence of this ribosomal sequence was likely
due to contamination during the preparation of the library by RT. The
ORF carried by clone 20, Vvht1, encodes a 519-amino acid (57,483 D)
protein (pI = 9.19) exhibiting high homology to various
monosaccharide transporters cloned from plant tissues (Fig.
1). The hydropathy pattern analyzed
according to Kyte-Doolittle suggested the presence of 12 transmembrane-spanning domains, which could be resolved into two
parts of six hydrophobic loops each, separated by a large central
hydrophilic fragment of about 50 amino acids (Fig. 1). Alignment of
VvHT1 with the five closest hexose transporter sequences: RcSCP
(Ricinus communis, accession no. L08196; Weig et al., 1994 ),
AtSTP1 (Arabidopsis thaliana, accession no.
X55350; Sauer et al., 1990 ), NtMST1 (Nicotiana tabacum,
accession no. X66856; Sauer and Stadler, 1993 ), MtuSTC (Medicago
truncatula, accession no. U38651; Harrison, 1996 ), and VfSTP1
(Vicia faba, accession no. Z93775; Weber et al., 1997 ) shows
the presence of three long identical stretches, between Val-29 and
Met-50, between Tyr-157 and Val-185, and between Gly-400 and Ser-427.

View larger version (109K):
[in this window]
[in a new window]
| Figure 1.
Features of VvHT1 protein sequence and alignment
with other hexose transporter sequences, RcSCP, AtSTP1, NtMST1, MtuSTC,
and VfSTP1. Putative transmembrane domains are underlined.
|
|
VvHT1 contained several potential phosphorylation sites in the
cytoplasmic zones, Thr-11, Ser-228, Tyr-498, and Ser-505. Of these,
Ser-228 is conserved in the five hexose transporter sequences closest
to VvHT1. Three N residues belong to consensus sequences Asn-X-Ser or
Asn-X-Thr, allowing possible N-glycosylation (Asn-18, Asn-151, and Asn-429). Only Asn-151 is conserved among the five closest
sequences. Asn-18 is located in a cytoplasmic loop, and Asn-151 and
Asn-429 are located in the fourth and eleventh transmembrane-spanning domain, respectively. It is therefore unlikely that VvTH1 is
glycosylated.
Some motifs found in hexose transporters from mammals, fungi, and
bacteria are also found in VvHT1. Thus, the (R/K)XGR(R/K) motif found
in position 106 through 110 in Vvht1 is also present in the GLUT1 human
Glc transporter mediating facilitated diffusion (Mueckler et al.,
1985 ), in HXT1, one of the hexose transporters from Saccharomyces
cerevisiae (Lewis and Bisson, 1991 ), and in Ara E, a
hexose transporter from E. coli (Maiden et al., 1987 ). The
V/LPETK motif found in the C-terminal part of the sequence (position
474-478), at the beginning of the last hydrophilic loop is a
characteristic feature of all hexose transporters cloned so far. This
sequence is immediately followed by another consensus sequence,
(M/V)XX(V/L)(W/Y)XXHW(F/Y)WX(R/K), which is found in all hexose
transporters cloned thus far from higher plants.
Expression of Vvht1
Expression of Vvht1 in different parts of the plant was studied
with RNAs extracted by the perchlorate methods from young leaves,
mature leaves, tendrils, and roots of plants at the anthesis stage (Fig. 2). Vvht1 is expressed at a
significant level mainly in the berries and young leaves.

View larger version (38K):
[in this window]
[in a new window]
| Figure 2.
Northern analysis of Vvht1 expression in different
organs. B(a), Berries at anthesis; ML, mature leaves; YL, young leaves;
P, petiole; T, tendrils; R, roots. The nylon membranes were hybridized
with a probe corresponding to the 3 end of the Vvht1 sequence. Data
were read with a phosphor imager and calibrated with a constitutive
probe (grape tubulin). Intensities were expressed in percentages of the
maximal value detected on the hybridization membrane.
|
|
The time course of Vvht1 expression during the maturation of the
berries was studied with two independent series of samples and with two
different methods: northern blot (Fig. 3)
and quantitative RT-PCR (Fig. 4). The
first series of samples were collected on grapes grown in the Cognac
region and analyzed by northern blot using a Vvht1 fragment located in
the 3 end of the cDNA sequence (Fig. 3). Vvht1 was expressed in the
berries according to a biphasic mode, with a first peak at the time of
anthesis, followed by a decrease in the amounts of transcripts and a
second peak about 5 weeks after véraison. The expression strongly
decreased during the latest stages of berry maturation and
overripening. No close relationship between the total amount of sugar
in the berries and the amount of Vvht1 transcripts was apparent.
However, a rise in the relative rate of sugar accumulation between 12 and 14 weeks after flowering correlated with the peak of Vvht1
expression. Vvht1 expression rapidly decreased before harvest and at
the time of harvest, although the sugar content of the berries still
increased. Attempts to obtain readable autoradiographs from the
northern blots quantified in Figures 2 and 3 were unsuccessful,
suggesting that the amounts of Vvht1 transcripts do not represent a
large population among the total RNA from the berries.

View larger version (21K):
[in this window]
[in a new window]
| Figure 3.
Northern analysis of Vvht1 expression along the
developmental cycle of the berries. A, Sugar content of the berries; B,
relative amounts of vvht1 transcripts. Berries from grape (cv
Ugni-Blanc) were sampled in the Cognac region from the time of anthesis
to the time of harvest. The dashed vertical line indicates the
approximate date of véraison. Other details are as in the legend
of Figure 2.
|
|

View larger version (27K):
[in this window]
[in a new window]
| Figure 4.
Quantitative RT-PCR analysis of hexose transporter
expression during ripening of cv UgniBlanc grape berries. Berries were
sampled from 1 to 16 weeks postflowering from grapevines located in the
Montpellier area. A, Sugar content of the berries, determined on
free-run juice; B, signal intensity obtained with hexose transporter
probes expressed in arbitrary units (A.U.) on a per microgram of RNA
basis; C, corresponding autoradiograms showing the signals obtained
with the vvht1 (down) and Vvht2A (up) probes. , Expression pattern
obtained with a probe specific for the 3 end of the Vvht1 sequence;
, expression pattern obtained after RT-PCR and hybridization with
the Vvht2A hexose transporter probe. Intensities are expressed as a
percentage of the maximal value detected on the hybridization membrane.
The vertical line indicates the approximate date of véraison.
|
|
The results described above led us to study the expression of Vvht1 by
quantitative PCR on an independent series of berries collected along
the developmental cycle in Montpellier. Vvht1 was expressed at all
stages of development (Fig. 4B); however, its expression also seemed to
be biphasic, with a decrease between anthesis and véraison, and a
continuous increase until 5 weeks after véraison. Although the
accumulation of Vvht1 transcripts could not explain the initial rise in
sugar content that accompanied véraison, it did correlate well
with the accumulation of sugars occurring between 10 and 13 weeks after
flowering. The overripe stages were not studied in these series. Both
series of data concerning Vvht1 (Figs. 3 and 4) suggested that the
expression of this gene along the development of the berries was
biphasic and correlated with the phase of massive accumulation of
sugars.
RT-PCR was also run with degenerated primers, allowing a more general
amplification of hexose transporter transcripts, and the amplification
products were hybridized with the Vvht2 probe, which does not
cross-hybridize with Vvht1 (Fig. 4B). Under these conditions, a
different pattern of expression was obtained, with a very low
expression at 3 and 5 weeks after flowering and a transcript accumulation that started about 3 weeks before véraison and
peaked shortly after véraison. These data indicate that there are
several transcripts homologous to hexose transporters that exhibit a
different pattern of accumulation during the ripening of grape berry.
Autoradiographs obtained after amplification and hybridization of the
samples used in Figure 4B are shown in Figure 4C.
Isolation and Characterization of the Gene Encoding VvHT1
Out of 350,000 clones (equivalent to about 10 genomes), five
positive phages were obtained after the first round of screening of the
genomic library with the hexose transporter probe prepared by RT-PCR.
Nine clones were still present after the third round of screening.
Digestion by XhoI and SacI showed that seven of these clones contained inserts between 13 and 15 kb. These clones were
used for a maxipreparation of DNA. Restriction analysis with SacI, XhoI, KpnI, Sa1I,
HindII, EcoRI, and Bg1II indicated
that the DNA inserts could be classified into three groups: A, B, and C. The restriction patterns observed with these genomic DNA fragments were compared with the restriction patterns previously observed with
Vvht1 cDNA. Both Vvht1 cDNA and the three genomic clones of group B
contained only one KpnI site. On the Vvht1 cDNA, this site
is located 27 bp after the start codon. This feature and the
restriction maps were used to select the most interesting genomic
clone. Clone 4, belonging to group B, was used for further analysis.
This clone contains a 3-kb genomic sequence obtained by double
digestion with KpnI and SacI. A 2.5-kb sequence
containing the promoter region was obtained by digestion with Sa1I and
KpnI. Upstream of this sequence, clone 4 also contained a
9-kb region that was not analyzed. Both the
KpnI/SacI 3-kb fragment and the Sa1I/KpnI 2.5-kb fragment were cloned in pSK+ and
completely sequenced.
The coding sequence of the Vvht1 gene is 3101 bp long and comparison
with the cDNA sequence allowed us to determine the site of
polyadenylation and the sites of splicing. The sequence between the
site of translation initiation and the site of fixation of the
poly(A+) tail is 2,821 bp long. The gene is
composed of three introns and four exons. The nucleotidic sequence of
the exons is completely identical with that of Vvht1 cDNA, except for
three bases located in the first position of the codons corresponding
to Leu-82, Arg-202, and Glu-263. Therefore, there is a high degree of
conservation between different cultivars of grape, since the genomic
library was prepared from cv Pinot Meunier and the cDNA library was
prepared from cv Ugni-Blanc. The structure of the gene encoding Vvht1
is similar to that of AtSTP1 (data not shown), but differs from the structure of the HUP1 and HUP3 genes of Chlorella kessleri,
which contain 14 introns (Wolf et al., 1991 ; Stadler et al., 1995 ). The
splicing consensus sequences AG/GT (Breathnach and Chambon, 1981 ; Hanley and Schuler, 1988 ) are conserved for the introns of Vvht1.
A TATATATA motif located in position 2,667 to 2,674 in the genomic
sequence of Vvht1 is absent in the untranslated region of Vvht1 cDNA.
The existence of such an octanucleotide in this position has not yet
been reported in the literature and its possible function is unknown.
The promoter fragment is 2,471 bp long and is terminated by the 33 first bp after the ATG. All sequences referred to below are numbered
from the first base of the ATG. The ATG is not located in one of the
consensus sequences ([C/G]AANNATGG or TAAACAATGGCT) that have been
described for the translation initiation site in plants (Joshi, 1987 ;
Lütcke et al., 1987 ). The main boxes found in the promoter region
of Vvht1 are mapped in Figure 5. A single CTATATATA sequence corresponding to the consensus sequence
(C/G)TATA(T/A)A1-3(C/T)A for TATA boxes in
plants is found 110 bp before the ATG. Four CCAAT boxes, commonly found
in the 5 noncoding region of eukaryotic genes (Hanley and Schuler,
1988 ), are found in the distal region of the promoter sequence. The
1.5-kb region upstream of the ATG is rich in A/T repetitive sequences,
which is a characteristic feature of the plant promoters. Among these
sequences, a TATTT(A/T)AT sequence found in two positions of the Vvht1
promoter also belongs to the cis regions that have been
previously identified as controlling the spatial or developmental
specificity of gene expression (Forde et al., 1990 ). This motif has
been found in seven genes of nodulins (Forde et al., 1990 ), in the
promoter of the tomato vacuolar invertase (Elliott et al., 1993 ), and
in the Arabidopsis Suc transporter AtSUC2 (Truernit and Sauer, 1995 ).
Four repeats of the SEF4 motif (RTTTTTR), which was also identified in
the -conglycinin promoter, and one motif (CAGAAGATA) driving
phloem-specific gene expression of the rice tungro bacilliform virus
(Yin et al., 1997 ) are also present in the Vvht1 promoter.

View larger version (26K):
[in this window]
[in a new window]
| Figure 5.
Map of the Vvht1 promoter. The consensus sequences
corresponding to various putative cis elements are
described in the text. Positions are numbered with respect to the first
base of the translation start ATG.
|
|
A P-box (TGTAAAG) is present in position 650. In cereals this box is
located closer to the translation initiation site (about 300) of
several genes encoding seed storage proteins (Colot et al., 1987 ;
Vicente-Carbajosa et al., 1997 ). Two ERELEE4 boxes (AWTTCAAA) are found
in positions 1,242 and 1,236. The ERELEE box has been described as
an ethylene-responsive enhancer element of a carnation
glutathione-S-transferase gene involved in senescence (Itzahki et al., 1994) and of the E4 gene expressed during
tomato ripening (Montgomery et al., 1993 ).
A number of repetitive CANNTG sequences identified as
E-box/ABA-responsive elements (Stalberg et al., 1996 ) are also found in
the sequence. A GCCGAC low-temperature-responsive element (Baker et
al., 1994 ; Jiang et al., 1996 ) is located in position 531.
The AATAGAAAA sequence described as a Suc-responsive element (Grierson
et al., 1994 ) is found in position 1,266, and two 15-bp regions
homologous to the Suc box 3 described in the promoters of various genes
including chalcone synthase and sporamine (Tsukuya et al., 1991) are
located at positions 1,322 and 228 in the promoter of Vvht1 (Fig.
6). A TATCCAT motif identified as a
cis element of the Amy3D gene of rice responsive to sugar
starvation (Hwang et al., 1998 ) is present in position 567 of the
Vvht1 promoter.

View larger version (16K):
[in this window]
[in a new window]
| Figure 6.
Putative Suc box B in the promoter region of
Vvht1, as deduced from comparison with the promoters of various other
genes in which this box was identified. AmCHS, Antirrhinum
majus chalcone synthase (Sommer and Saedler, 1986 ); gspoB1,
Ipomoea batatas sporamin clone A (Hattori et al.,
1990 ); StPATG1, Solanum tuberosum patatin (Bevan et al.,
1986 ); gspo1A, I. batatas sporamin clone B
(Hattori et al., 1990 ).
|
|
An important feature of the promoter of Vvht1 is its similarity to the
promoter of the grape alcohol dehydrogenase recently cloned
(Sarni-Manchado et al., 1997 ). Indeed, alignment of the 350-bp sequence
available for the alcoholde hydrogenase promoter with the corresponding
region of the Vvht1 promoter reveals 52% identity over the 270 bp
flanking the ATG (Fig. 7), with regions as long as 15 nucleotides nearly identical. The two most conserved sequences are a 16-bp sequence located in position 213
(GAAAGA-ATTGAAAA) and a 14-bp sequence located in position 114 of
the Vvht1 promoter, which includes the TATA box (GT/GGGCTATAT/AATA). In
contrast, alignment of the Vvht1 promoter with other promoters of
hexose or Suc transporters did not reveal any important identity (data not shown).

View larger version (34K):
[in this window]
[in a new window]
| Figure 7.
Homology between the proximal part of the Vvht1
promoter (270 bp) and that of the Adh1 grape alcohol dehydrogenase
promoter (Sarni-Manchado et al., 1997 ). Alignments were made
with Geneworks (Intelligenetics) software.
|
|
Southern Analysis of Genomic DNA
With the VvHT1 cDNA probe used for hybridization, a complex
restriction-fragment pattern was obtained from genomic DNA of grape
(Fig. 8). The restriction enzyme
EcoRI, which cuts only once within the probe, produced three
fragments that hybridized to the cDNA probe, one of which had a weak
intensity. HindIII, which also cuts only once in the probe
produced four labeled fragments, two of which were much less labeled.
Digestion by BamHI, which does not cut Vvht1, resulted in
two bands. These results indicate that the hexose transporter should be
encoded by at least two distinct genes in the grape cv Ugni-Blanc.
Comparable results were obtained with cv Shiraz (data not shown).

View larger version (31K):
[in this window]
[in a new window]
| Figure 8.
Southern hybridization of genomic DNA isolated
from the leaves of the grape cv Ugni-Blanc. The DNA (15 µg/lane) was
digested with EcoRI (lane 1), HindII
(lane 2), BglII (lane 3), and BamHI (lane
4) prior to separation in a 0.8% agarose gel. The
32P-labeled KpnI/HpaI
fragment of Vvht1 was used for hybridization.
|
|
 |
DISCUSSION |
The ripening stage at which the berries are harvested, and in
particular their sugar/acid balance at this time, play an important part in the final quality of the molt and of the resulting wines. It is
therefore important to understand, characterize, and, if possible,
control the maturation process. This control is more difficult for
grape than for climacteric fruits, for which maturation can be
triggered by ethylene treatments. In this context, the isolation and
characterization of a cDNA clone and of a genomic clone encoding a
hexose transporter expressed during the ripening of the berries provide
initial clues for the understanding of this process. Sugar accumulation
may also be important from the standpoint of grape resistance to
phytopathogens, since accumulation of hexoses in Vitis
labruscana berries was shown to be accompanied by a
developmental-stage-specific increase of antifungal proteins (Salzman
et al., 1998 ).
Hexose transporters cloned so far have been isolated from herbaceous
species, and no data are available for woody species. The Vvht1 cDNA
sequence shares a strong homology with the other hexose transporters
already cloned from herbaceous species. The highest homologies were
found with transporters cloned from R. communis (RcScP),
M. trunculata (not trunculata; MtStc), V. faba (VfStp1), N. tabacum (NtMst1), and
Arabidopsis (AtStp1). MtuStc (Harrison, 1996 ), VfStp1 (Weber et al.,
1997 ), and NtMst1 (Sauer and Stadler, 1993 ) are also expressed
in sink tissues. However, AtStp1 is poorly expressed in heterotrophic
tissues, and strongly expressed in leaves (Sauer et al., 1990 ), and
therefore there is no direct relationship between sequence homologies
and tissue-specific expression. It is noteworthy that a perfect
identity at the nucleotide level was found between the Vvht1 cDNA
sequence obtained after screening of the library from cv Pinot Noir
leaves and the cDNA sequence deduced from the genomic clone obtained
after screening of the genomic library from cv Ugni-Blanc. Vvht1
sequence is therefore conserved between those two cultivars, and
possibly in other grape cultivars.
Although the length of the central loop is strictly conserved between
VvHT1 protein sequence and the five closest hexose transporter sequences, noticeable differences are found in the 20 C-terminal amino
acids and in the 10 N-terminal amino acids. The presence of a
conserved Ser residue in the central loop of these sequences (Ser-228
in VvHT1) raises the possibility of post-translational regulation of
the transport activity by phosphorylation, which was recently suggested
for a Suc transporter (Roblin et al., 1998 ).
Vvht1 encodes a putative hexose transporter that is expressed mainly in
the berries (Fig. 2). Analysis of Vvht1 expression both by northern
blot (Fig. 3) and by RT-PCR (Fig. 4) on two independent sets of berries
collected at different stages of development in two distinct climatic
areas confirmed that the maximal expression of Vvht1 occurs about 5 weeks after véraison. However, in both series, an earlier peak of
expression was also found shortly after fecondation. High rates of
sugar import may be needed to support active cell division. This
biphasic pattern of expression suggests a complex regulation of the
expression pattern. The only report showing a developmental pattern of
expression for a hexose transporter in sink tissues was published by
Weber et al. (1997) , who found that VfSTP1 transcripts encoding a
V. faba hexose transporter showed a single peak of
accumulation in seed coats and cotyledons.
RT-PCR data with the Vvht2A probe (Fig. 4) also suggest the existence
of another hexose transporter showing only one peak of expression that
occurs shortly after véraison. The probable existence of several
different hexose transporters expressed during the maturation of the
berry is strengthened by the results of Southern analysis (Fig. 8) and
the existence of a multigenic family encoding the plasma membrane
hexose transporters in the species studied so far (Arabidopsis, Caspari
et al., 1994 ; R. communis, Weig et al., 1994 ). The isolation
of other sugar transporter clones from grape is under way in our
laboratory. The exact location of Suc hydrolysis during the hexose
accumulation occurring after véraison is not known. However, the
fact that plasma membrane hexose transporters are expressed during this
stage suggests that at least part of the Suc imported by the berry
phloem is hydrolyzed prior to accumulation in the flesh cells. The fact
that autoradiographic signals can be detected only after RT-PCR
indicates that the vvht1 transcripts only represent a small proportion
of total berry RNA and suggests that they are expressed only in a
limited number of cells.
Among the numerous potential cis sequences found in the
Vvht1 promoter, the ethylene-responsive elements, the ABA-responsive element box, the sugar boxes, and the amy3 box seem particularly relevant for further analysis. Ethylene, ABA, and water stress have
been described as promoting sugar accumulation in grape (for review,
see Coombe, 1992 ). The existence of Suc boxes in the promoter sequence
of Vvht1 opens the possibility that the expression of this gene is
induced by sugar level, and therefore that sugar accumulation would
occur as an autocatalytic process. This fits well with earlier
physiological observations in which sugar accumulation in the berry was
irreversible once it was triggered (Coombe, 1992 ). However, this
sensitivity of Vvht1 to sugar expression and, more generally, the
physiological significance of the different boxes identified in the
promoter should be determined by reporter gene experiments. Although
grape transformation is possible (Mauro et al., 1995 ), about 2 years
are needed to obtain the plants. Experiments using various fusions of
the promoter region with GUS and GFP reporter genes, and transformation
in tobacco and grape suspension cells are under way in our laboratory
for functional analysis of the Vvht1 promoter (R. Atanassova, M. Leterrier, C. Gaillard, P. Coutos-Thévenot, and S. Delrot,
unpublished data).
The pattern of expression of Vvht1 is paralleled by the expression of
one alcohol dehydrogenase gene in grape berries (Sarni-Manchado et al.,
1997 ). Moreover, the promoter sequence of Vvht1 and of this alcohol
dehydrogenase exhibit a high level of homology (Fig. 7), while
comparison of the Vvht1 promoter sequence with that of other hexose
transporter promoters did not reveal any significant homology (data not
shown). These data suggest that Vvth1 and alcohol dehydrogenase are
co-induced during ripening, and that this co-induction may be due to
the binding of a common transcription factor on the cis
sequences that are shared by the promoters of the genes encoding these
enzymes. These promoter sequences may be useful in cloning this
transcription factor, which is involved at an early stage of maturation
induction.
 |
FOOTNOTES |
1
This work was supported in part by a grant from
Louis Vuitton Moet Hennessy to L.F. (contract no. Contrat Industriel
Foramtion Recherche en Entreprise 360/94), by Action Incitative sur
Programme Institut National de la Recherche Agronomique Aptitude
au Dévelopment des Grains et des Fruits (grant no.
P0030), and by the Conseil Régional de la Vienne.
*
Corresponding author; e-mail
serge.delrot{at}campus.univpoitiers.fr; fax 33-5-49-45-41-86.
Received December 10, 1998;
accepted April 17, 1999.
 |
ABBREVIATIONS |
Abbreviations:
DEPC, diethylpyrocarbonate.
PVPP, polyvinylpolypyrrolidone.
RT, reverse transcription.
 |
LITERATURE CITED |
Altschul SF,
Gish W,
Miller W,
Myers EW,
Lipman DJ
(1990)
Basic local alignment search tool.
J Mol Biol
215:
403-410
[CrossRef][Web of Science][Medline]
Baker SS,
Wildhem KS,
Thomashow MF
(1994)
The 5 -region of Arabidopsis thaliana cor15a has cis-acting elements that confer cold-, drought- and ABA-regulated gene expression.
Plant Mol Biol
24:
701-713
[CrossRef][Web of Science][Medline]
Bevan M,
Barker R,
Goldbrough A,
Jarvis M,
Kavanagh T,
Iturriaga G
(1986)
The structure and transcription start site of a major potato tuber protein gene.
Nucleic Acids Res
14:
4625-4638
[Abstract/Free Full Text]
Breathnach R,
Chambon P
(1981)
Organization and expression of split genes coding for proteins.
Annu Rev Biochem
50:
349-383
[CrossRef][Web of Science][Medline]
Bush DR
(1993)
Proton-coupled sugar and amino acid transporters in plants.
Annu Rev Plant Physiol Plant Mol Biol
44:
513-542
[CrossRef][Web of Science]
Caspari T,
Will A,
Opekarova M,
Sauer N,
Tanner W
(1994)
Hexose/H+ symporters in lower and higher plants.
J Exp Biol
196:
483-491
[Abstract/Free Full Text]
Chiou TJ,
Bush DR
(1996)
Molecular cloning, immunochemical localization to the vacuole, and expression in transgenic yeast and tobacco of a putative sugar transporter from sugar beet.
Plant Physiol
110:
511-520
[Abstract]
Colot V,
Robert LS,
Kavanagh TA,
Bevan MW,
Thompson RD
(1987)
Localization of sequences in wheat endosperm protein genes which confer tissue-specific expression in tobacco.
EMBO J
12:
3559-3564
[Web of Science][Medline]
Coombe BG
(1989)
The grape berry as a sink.
Acta Hortic
239:
149-157
Coombe BG
(1992)
Research on development and ripening of the grape berry.
Am J Enol Vitic
43:
101-110
[Abstract/Free Full Text]
Davies C,
Robinson SP
(1996)
Sugar accumulation in grape berries. Cloning of two putative vacuolar invertase cDNAs and their expression in grapevine tissues.
Plant Physiol
111:
275-283
[Abstract]
Elliott KJ,
Butler WO,
Dickinson CD,
Konno Y,
Vedvick TS,
Fitzmaurice L,
Mirkov TE
(1993)
Isolation and characterization of fruit vacuolar invertase genes from tomato species and temporal differences in mRNA levels during fruit ripening.
Plant Mol Biol
21:
515-524
[CrossRef][Web of Science][Medline]
Findlay N,
Oliver KJ,
Nii N,
Coombe BG
(1987)
Solute accumulation by grape pericarp cells. IV. Perfusion of pericarp apoplast via the pedicel and evidence for xylem malfunction in ripening berries.
J Exp Bot
38:
668-679
[Abstract/Free Full Text]
Forde B,
Freeman J,
Oliver JE,
Pineda M
(1990)
Nuclear factor interacts with conserved A/T-rich elements upstream of a nodule-enhanced glutamine synthetase gene from French bean.
Plant Cell
2:
925-939
[Abstract/Free Full Text]
Gahrtz M,
Schmelzer E,
Stolz J,
Sauer N
(1996)
Expression of the PmSUC1 sucrose carrier gene from Plantago major L. is induced during seed development.
Plant J
9:
93-100
[CrossRef][Web of Science][Medline]
Gahrtz M,
Stolz J,
Sauer N
(1994)
A phloem-specific sucrose-H+ symporter from Plantago major L. supports the model of apoplastic phloem loading.
Plant J
6:
697-706
[CrossRef][Web of Science][Medline]
Grierson C,
Du JS,
De Torres Zabala M,
Beggs K,
Smith C,
Holdsworth M,
Bevan M
(1994)
Separate cis sequences and trans factors direct metabolic and developmental regulation of a potato tuber storage protein gene.
Plant J
5:
815-826
[CrossRef][Web of Science][Medline]
Hanley BA,
Schuler MA
(1988)
Plant intron sequence: evidence for distinct groups of introns.
Nucleic Acids Res
16:
7159-7175
[Abstract/Free Full Text]
Harrison MJ
(1996)
A sugar transporter from Medicago truncatula: altered expression pattern in roots during vesicular-arbuscular (VA) mycorhizal associations.
Plant J
9:
491-503
[CrossRef][Web of Science][Medline]
Hattori T,
Nakagawa S,
Nakamura K
(1990)
High level expression of tuberous root storage protein genes of sweet potato in stems of plantlets grown in vitro on sucrose medium.
Plant Mol Biol
14:
595-604
[CrossRef][Web of Science][Medline]
Hawker JS
(1969)
Changes in the activities of enzymes concerned with sugar metabolism during the development of grape berries.
Phytochemistry
8:
9-12
[CrossRef]
Hwang YS,
Karrer EE,
Thomas BR,
Chen L,
Rodriguez RL
(1998)
Three cis-elements required for rice alpha-amylase Amy3D expression during sugar starvation.
Plant Mol Biol
36:
331-341
[CrossRef][Web of Science][Medline]
Itzhaki H,
Maxson JM,
Woodson WR
(1994)
An ethylene-responsive enhancer element is involved in the senescencerelated expression of the carnation glutathione-S-transferase (GST) gene.
Proc Natl Acad Sci USA
91:
8925-8929
[Abstract/Free Full Text]
Jang JC,
Sheen J
(1994)
Sugar sensing in plants.
Plant Cell
6:
1665-1679
[Abstract]
Jiang C,
Iu B,
Singh J
(1996)
Requirement of a CCGAC cis-acting element for cold induction of the BN115 gene from winter Brassica napus.
Plant Mol Biol
30:
679-684
[CrossRef][Web of Science][Medline]
Joshi CP
(1987)
An inspection of the domain between putative TATA box and translation start site in 79 plant genes.
Nucleic Acids Res
15:
6643-6653
[Abstract/Free Full Text]
Kanellis AK,
Roubelakis-Angelakis KA
(1993)
Grape.
In
G Seymour,
J Taylor,
G Tucher,
eds, Biochemistry of Fruit Ripening.
Chapman & Hall, London, pp 189-234
Lewis DA,
Bisson LF
(1991)
The HXT1 gene product of Saccharomyces cerevisiae is a new member of the family of hexose transporters.
Mol Cell Biol
11:
3804-3813
[Abstract/Free Full Text]
Lütcke HA,
Chow KC,
Mickel FS,
Moss KA,
Kern HF,
Scheele GA
(1987)
Selection of AUG initiation codons differs in plants and animals.
EMBO J
6:
43-48
[Web of Science][Medline]
Maiden MCJ,
Davis EO,
Baldwin S,
Moore DC,
Henderson PJF
(1987)
Mammalian and bacterial sugar transport proteins are homologous.
Nature
325:
641-643
[CrossRef][Medline]
Mauro MC,
Toutain S,
Walter B,
Pinck L,
Otten L,
Coutos-Thévenot P,
Deloire A,
Barbier P
(1995)
High efficiency regeneration of grapevine plants transformed with the GFLV coat protein gene.
Plant Sci
112:
97-106
[CrossRef]
Montgomery J,
Goldman S,
Deikman J,
Margossian L,
Fischer RL
(1993)
Identification of an ethylene-responsive region in the promoter of a fruit ripening gene.
Proc Natl Acad Sci USA
90:
5939-5943
[Abstract/Free Full Text]
Mueckler M,
Caruso C,
Baldwin SA,
Paico M,
Blench I,
Morris HR,
Jeffrey W,
Lienhard GE,
Lodish HF
(1985)
Sequence and structure of a human glucose transporter.
Science
229:
941-945
[Abstract/Free Full Text]
Ollé D,
Lozano YF,
Brillouet JM
(1996)
Isolation and characterization of soluble polysaccharides and insoluble cell wall material of the pulp from four mango (Mangifera indica L.) cultivars.
J Agric Food Chem
44:
2658-2662
[CrossRef]
Patrick JW
(1997)
Phloem unloading: sieve element unloading and post-sieve element transport.
Annu Rev Plant Physiol Plant Mol Biol
48:
191-222
[CrossRef][Web of Science]
Riesmeier JW,
Hirner B,
Frommer WB
(1993)
Potato sucrose transporter expression in minor veins indicates a role in phloem loading.
Plant Cell
5:
1591-1598
[Abstract]
Riesmeier JW,
Willmitzer L,
Frommer WB
(1992)
Isolation and characterization of a sucrose carrier cDNA from spinach by functional expression in yeast.
EMBO J
11:
4705-4713
[Web of Science][Medline]
Roblin G,
Sakr S,
Bonmort J,
Delrot S
(1998)
Regulation of a plant plasma membrane sucrose transporter by phosphorylation.
FEBS Lett
424:
165-168
[CrossRef][Web of Science][Medline]
Salzman RA,
Tikhonova I,
Bordelon BP,
Hasegawa PM,
Bressan RA
(1998)
Coordinate accumulation of antifungal proteins and hexoses constitutes a developmentally controlled defense response during fruit ripening in grape.
Plant Physiol
117:
465-472
[Abstract/Free Full Text]
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Sarni-Manchado P,
Verriès C,
Tesnière C
(1997)
Molecular characterization and structural analysis of one alcohol dehydrogenase gene (GV-Adh1) expressed during ripening of grapevine (Vitis vinifera L.) berry.
Plant Sci
125:
177-187
[CrossRef]
Sauer N,
Friedlander K,
Graml-Wicke U
(1990)
Primary structure, genomic organization and heterologous expression of a glucose transporter from Arabidopsis thaliana.
EMBO J
9:
3045-3050
[Web of Science][Medline]
Sauer N,
Gahrtz M,
Stadler R,
Stolz J,
Truernit E
(1994)
Molecular biology of sugar transporters of the plant plasma membrane.
Symp Soc Exp Biol
48:
155-165
[Medline]
Sauer N,
Stadler R
(1993)
A sink specific H+/monosaccharide cotransporter from Nicotiana tabacum: cloning and heterologous expression in baker's yeast.
Plant J
4:
601-610
[CrossRef][Web of Science][Medline]
Smeekens J,
Rook F
(1997)
Sugar sensing and sugar-mediated signal transduction in plants.
Plant Physiol
115:
7-13
[Web of Science][Medline]
Sommer H,
Saedler H
(1986)
Structure of the chalcone synthase gene of Antirrhinum majus.
Mol Gen Genet
202:
429-434
[CrossRef]
Stadler R,
Wolf K,
Hilgarth C,
Tanner W,
Sauer N
(1995)
Subcellular localization of the inducible Chlorella HUP1 monosaccharide-H+ symporter and cloning of a co-induced galactose-H+ symporter.
Plant Physiol
107:
33-41
[Abstract]
Stalberg K,
Ellerstom M,
Ezcurra I,
Ablov S,
Rask L
(1996)
Disruption of an overlapping E-box/ABRE motif abolished high transcription of the napA storage-protein promoter in transgenic Brassica napus seeds.
Planta
199:
515-519
[Web of Science][Medline]
Steenkamp J,
Wiid I,
Lourens A,
Vanhelden P
(1994)
Improved method for DNA extraction from Vitis vinifera.
Am J Enol Vitic
45:
102-106
[Abstract/Free Full Text]
Tanner W,
Caspari T
(1996)
Membrane transport carriers.
Annu Rev Plant Physiol Plant Mol Biol
47:
595-626
[CrossRef][Web of Science]
Tattersall DB,
Van Heeswijck R,
Hoj PB
(1997)
Identification and characterization of a fruit-specific, thaumatin-like protein that accumulates at very high levels in conjunction with the onset of sugar accumulation and berry softening in grapes.
Plant Physiol
114:
759-769
[Abstract]
Tesnière C,
Vayda ME
(1991)
Method for the isolation of high-quality RNA from grape berry tissues without contaminating tannins or carbohydrates.
Plant Mol Biol Rep
9:
242-251
Truernit E,
Sauer N
(1995)
The promoter of the Arabidopsis thaliana SUC2 sucrose-H+ symporter gene directs expression of beta-glucuronidase to the phloem: evidence for phloem loading and unloading by SUC2.
Planta
196:
564-570
[Web of Science][Medline]
Truernit E,
Schmid J,
Epple P,
Illig J,
Sauer N
(1996)
The sink-specific and stress-regulated Arabidopsis STP4 gene: enhanced expression of a gene encoding a monosaccharide transporter by wounding, elicitors, and pathogen challenge.
Plant Cell
8:
2169-2182
[Abstract]
Tsukaya H,
Ohshima T,
Naito S,
Chino M,
Komeda Y
(1991)
Sugar-dependent expression of the CHS-A gene for chalcone synthase from petunia in transgenic Arabidopsis.
Plant Physiol
97:
1414-1421
[Abstract/Free Full Text]
Vicente-Carbajosa J,
Moose S,
Parsons RL,
Schmidt R
(1997)
A maize zinc-finger protein binds the prolamin box in zein gene promoters and interacts with the basic leucine zipper transcriptional activator Opaque2.
Proc Natl Acad Sci USA
94:
7685-7690
[Abstract/Free Full Text]
Weber H,
Borisjuk L,
Heim U,
Sauer N,
Wobus U
(1997)
A role for sugar transporters during seed development: molecular characterization of a hexose and a sucrose carrier in fava bean seeds.
Plant Cell
9:
895-908
[Abstract/Free Full Text]
Weig A,
Franz J,
Sauer N,
Komor E
(1994)
Isolation of a family of cDNA clones from Ricinus communis L. with close homology to the hexose carriers.
J Plant Physiol
143:
178-183
Wolf K,
Tanner W,
Sauer N
(1991)
The Chlorella H+/hexose cotransporter gene.
Curr Genet
19:
215-219
[Medline]
Yin Y,
Chen L,
Beachy R
(1997)
Promoter elements required for phloem-specific gene expression of the RTBV promoter in rice.
Plant J
12:
1179-1188
[CrossRef][Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
R.-C. Fan, C.-C. Peng, Y.-H. Xu, X.-F. Wang, Y. Li, Y. Shang, S.-Y. Du, R. Zhao, X.-Y. Zhang, L.-Y. Zhang, et al.
Apple Sucrose Transporter SUT1 and Sorbitol Transporter SOT6 Interact with Cytochrome b5 to Regulate Their Affinity for Substrate Sugars
Plant Physiology,
August 1, 2009;
150(4):
1880 - 1901.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Wada, M. A. Matthews, and K. A. Shackel
Seasonal pattern of apoplastic solute accumulation and loss of cell turgor during ripening of Vitis vinifera fruit under field conditions
J. Exp. Bot.,
April 1, 2009;
60(6):
1773 - 1781.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Matus, R. Loyola, A. Vega, A. Pena-Neira, E. Bordeu, P. Arce-Johnson, and J. A. Alcalde
Post-veraison sunlight exposure induces MYB-mediated transcriptional regulation of anthocyanin and flavonol synthesis in berry skins of Vitis vinifera
J. Exp. Bot.,
March 1, 2009;
60(3):
853 - 867.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Terrier, L. Torregrosa, A. Ageorges, S. Vialet, C. Verries, V. Cheynier, and C. Romieu
Ectopic Expression of VvMybPA2 Promotes Proanthocyanidin Biosynthesis in Grapevine and Suggests Additional Targets in the Pathway
Plant Physiology,
February 1, 2009;
149(2):
1028 - 1041.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Lebon, G. Wojnarowiez, B. Holzapfel, F. Fontaine, N. Vaillant-Gaveau, and C. Clement
Sugars and flowering in the grapevine (Vitis vinifera L.)
J. Exp. Bot.,
July 1, 2008;
59(10):
2565 - 2578.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Krasnow, M. Matthews, and K. Shackel
Evidence for substantial maintenance of membrane integrity and cell viability in normally developing grape (Vitis vinifera L.) berries throughout development
J. Exp. Bot.,
March 1, 2008;
59(4):
849 - 859.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Hayes, C. Davies, and I. B. Dry
Isolation, functional characterization, and expression analysis of grapevine (Vitis vinifera L.) hexose transporters: differential roles in sink and source tissues
J. Exp. Bot.,
June 1, 2007;
58(8):
1985 - 1997.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-Y. Zhang, X.-L. Wang, X.-F. Wang, G.-H. Xia, Q.-H. Pan, R.-C. Fan, F.-Q. Wu, X.-C. Yu, and D.-P. Zhang
A Shift of Phloem Unloading from Symplasmic to Apoplasmic Pathway Is Involved in Developmental Onset of Ripening in Grape Berry
Plant Physiology,
September 1, 2006;
142(1):
220 - 232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Keller, J. P. Smith, and B. R. Bondada
Ripening grape berries remain hydraulically connected to the shoot
J. Exp. Bot.,
August 1, 2006;
57(11):
2577 - 2587.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Conde, A. Agasse, D. Glissant, R. Tavares, H. Geros, and S. Delrot
Pathways of Glucose Regulation of Monosaccharide Transport in Grape Cells
Plant Physiology,
August 1, 2006;
141(4):
1563 - 1577.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Y. Rogiers, D. H. Greer, J. M. Hatfield, B. A. Orchard, and M. Keller
Solute Transport into Shiraz Berries during Development and Late-Ripening Shrinkage
Am. J. Enol. Vitic.,
March 1, 2006;
57(1):
73 - 80.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Azevedo, C. Conde, H. Geros, and R. M. Tavares
The Non-host Pathogen Botrytis cinerea Enhances Glucose Transport in Pinus pinaster Suspension-cultured Cells
Plant Cell Physiol.,
February 1, 2006;
47(2):
290 - 298.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Vignault, M. Vachaud, B. Cakir, D. Glissant, F. Dedaldechamp, M. Buttner, R. Atanassova, P. Fleurat-Lessard, R. Lemoine, and S. Delrot
VvHT1 encodes a monosaccharide transporter expressed in the conducting complex of the grape berry phloem
J. Exp. Bot.,
May 1, 2005;
56(415):
1409 - 1418.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-Y. Zhang, Y.-B. Peng, S. Pelleschi-Travier, Y. Fan, Y.-F. Lu, Y.-M. Lu, X.-P. Gao, Y.-Y. Shen, S. Delrot, and D.-P. Zhang
Evidence for Apoplasmic Phloem Unloading in Developing Apple Fruit
Plant Physiology,
May 1, 2004;
135(1):
574 - 586.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-P. WANG, A. DELOIRE, A. CARBONNEAU, B. FEDERSPIEL, and F. LOPEZ
An in vivo Experimental System to Study Sugar Phloem Unloading in Ripening Grape Berries During Water Deficiency Stress
Ann. Bot.,
October 1, 2003;
92(4):
523 - 528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Cakir, A. Agasse, C. Gaillard, A. Saumonneau, S. Delrot, and R. Atanassova
A Grape ASR Protein Involved in Sugar and Abscisic Acid Signaling
PLANT CELL,
September 1, 2003;
15(9):
2165 - 2180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Leterrier, R. Atanassova, L. Laquitaine, C. Gaillard, P. Coutos-Thevenot, and S. Delrot
Expression of a putative grapevine hexose transporter in tobacco alters morphogenesis and assimilate partitioning
J. Exp. Bot.,
April 1, 2003;
54(385):
1193 - 1204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Gao, L. Maurousset, R. Lemoine, S.-D. Yoo, S. van Nocker, and W. Loescher
Cloning, Expression, and Characterization of Sorbitol Transporters from Developing Sour Cherry Fruit and Leaf Sink Tissues
Plant Physiology,
April 1, 2003;
131(4):
1566 - 1575.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Atanassova, M. Leterrier, C. Gaillard, A. Agasse, E. Sagot, P. Coutos-Thevenot, and S. Delrot
Sugar-Regulated Expression of a Putative Hexose Transport Gene in Grape
Plant Physiology,
January 1, 2003;
131(1):
326 - 334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Oliveira, R. M. Tavares, and H. Geros
Utilization and Transport of Glucose in Olea Europaea Cell Suspensions
Plant Cell Physiol.,
December 15, 2002;
43(12):
1510 - 1517.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Pratelli, B. Lacombe, L. Torregrosa, F. Gaymard, C. Romieu, J.-B. Thibaud, and H. Sentenac
A Grapevine Gene Encoding a Guard Cell K+ Channel Displays Developmental Regulation in the Grapevine Berry
Plant Physiology,
February 1, 2002;
128(2):
564 - 577.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|