|
|
||||||||
|
Plant Physiol, October 1999, Vol. 121, pp. 345-352
A Point Mutation in the Ethylene-Inducing Xylanase Elicitor
Inhibits the
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
Ethylene-inducing xylanase (EIX)
elicits plant defense responses in certain tobacco (Nicotiana
tabacum) and tomato cultivars in addition to its xylan
degradation activity. It is not clear, however, whether elicitation
occurs by cell wall fragments released by the enzymatic activity or by
the xylanase protein interacting directly with the plant cells. We
cloned the gene encoding EIX protein and overexpressed it in insect
cells. To determine the relationship between the two activities,
substitution of amino acids in the xylanase active site was performed.
Substitution at glutamic acid-86 or -177 with glutamine (Gln), aspartic
acid (Asp), or glycine (Gly) inhibited the
-1-4-endoxylanase
activity. Mutants having Asp-86 or Gln-177 also lost the ability to
induce the hypersensitive response and ethylene biosynthesis. However, mutants having Gln-86, Gly-86, Asp-177, or Gly-177 retained ability to
induce ethylene biosynthesis and the hypersensitive response. Our data
show that the xylanase activity of EIX elicitor can be separated from
the elicitation process, as some of the mutants lack the former but
retain the latter.
| |
INTRODUCTION |
|---|
|
|
|---|
Pathogens secrete polysaccharide-cleaving enzymes to penetrate the
plant cell during infection (Cooper et al., 1988
; Xu and Mendgen,
1997
). There is evidence that endo-
-1,4-xylanases that cleave the
-1,4 linkage of the xylosyl backbone play a role in pathogenicity
(Ishii, 1988
; Walton, 1994
; Wu et al., 1997
). Proteinaceous elicitors
exhibiting hydrolytic activity have been isolated from different fungi.
It was suggested that different cell wall constituents, originating
either from the host plant or the invading pathogen, can induce the
plant defense responses (Walker-Simmons et al., 1984
; Hahn et al.,
1989
; Bucheli et al., 1990
; Cheong and Hahn, 1991
).
A 22-kD fungal protein (
-1-4-endoxylanase) referred to as
ethylene-inducing xylanase (EIX), has been isolated from xylan-induced Trichoderma viride cultures (Fuchs et al., 1989
; Dean et
al., 1991
). Similar xylanases have been identified in xylan-induced filtrates of plant pathogenic fungi (Dean et al., 1989
; Wu et al.,
1997
). When applied to cut roots or petioles,
EIX is translocated in the xylem tissues and induces symptoms in leaves
both above and below the point of EIX application (Bailey et al., 1991
;
Sharon et al., 1992
). Injection of EIX into the leaf-mesophyll
intercellular spaces induces ethylene production and cell death, as
well as other plant defense responses in the tobacco (Nicotiana
tabacum) cv Xanthi (Bailey et al., 1990
, 1992
; Lotan and Fluhr,
1990
), in tomato leaf tissue (Avni et al., 1994a
), and in cell
suspensions (Bailey et al., 1992
; Felix et al., 1993
; Yano et al.,
1998
). These are characteristic responses of plants to exogenously
applied elicitors (Keen et al., 1990
; Blein et al., 1991
; Felix et al., 1993
).
EIX induces the plant defense responses only in certain plant species
(Bailey et al., 1993
, 1995
; Avni et al., 1994b
; Yano et al., 1998
). The
interaction between EIX and plants has been shown to follow the
gene-for-gene model (Flor, 1971
). The tomato cv M82 responds to EIX
treatment, while an isogenic line, cv IL75, does not (Avni et al.,
1994a
). Therefore, it was hypothesized that the elicitor activity of
EIX might be unrelated to the xylan-degrading activity (Sharon et al.,
1993
). In the present study we used a molecular approach to show that
the elicitation of ethylene biosynthesis and the hypersensitive
response (HR) can be separated from the endoxylanase activity of this protein.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plant Material and Tissue Treatment
Tobacco (Nicotiana tabacum L. cv Xanthi) plants were
grown under greenhouse conditions until they were 25 to 35 cm tall.
Young, fully expanded leaves were cut and incubated for 14 h in an
atmosphere containing 120 µL/L ethylene to make them more responsive
to EIX. EIX was applied to leaf discs prepared from ethylene-treated
leaves (1 cm in diameter) as previously described (Avni et al., 1994b
). Ethylene production was measured by GC after sealing 25-mL flasks containing leaf discs (six per flask, average total weight 85 mg) for
4 h (Avni et al., 1994b
). Alternatively, EIX (1 µg/mL) was
injected into leaf tissue and development of cell death was analyzed
after 96 h (Bailey et al., 1990
).
Endo-1,4-
-Xylanase Assay
Xylanase activity was determined as described by Biely et al.
(1985)
. Enzyme activity was determined with 5.75 mg/mL Remazol Brilliant Blue Xylan (Sigma, St. Louis) in 0.05 M acetate
buffer (pH 5.4) at 30°C for 90 min. The reaction was terminated by
the addition of 2 volumes of 96% (v/v) ethanol. Insoluble
material was removed by centrifugation at 2,000g for 5 min.
The absorbency of the supernatant was measured at 595 nm.
Isolation of the EIX Gene
Two degenerate primers,
AT[GT]GG[CT]CC[AG]GG[CT]AC[TC]GG[CT]TT[TC]AACAACGG
corresponding to residues 34 to 44 of the coding strand
and GACCA[AG]TA[TC]TG[AG]TA[AG]AA[AG]GT[TA]GC[AG]GT
corresponding to residues 133 to 141 of the noncoding
strand of the EIX protein (Dean et al., 1994
), were used to amplify a
320-bp EIX gene fragment from a Trichoderma viride cDNA,
using PCR. This fragment was used as a probe to screen a T. viride cDNA library constructed in Lambda ZAP II (Stratagene, La
Jolla, CA). Screening was performed by standard procedures (Sambrook et
al., 1989
).
Construction of Recombinant Baculovirus
The ORF of the EIX gene was amplified with the primers
CATCGGATCCATGGTCTCCTTCAC and GTCGGAGCTCCAACAATGATGACTCC to
generate BamHI-SacI sites. The ORF was cloned
into the BamHI-SaclI sites of a baculovirus
transfer vector (pFastBac1, Gibco-BRL, Cleveland). Recombinant
baculoviruses were generated by using the Bac-to-Bac system (Gibco-BRL)
based on targeted transposition of the expression cassette to the
baculovirus genome maintained in Escherichia coli as a
bacmid (Luckow et al., 1993
). The resulting recombinant bacmids were
used to transfect Spodoptera frugiperda (Sf9) cells using Cellfectin (Gibco-BRL), and the presence of recombinant virus was
verified 3 to 4 d after the transfection by immunoblotting using
EIX antibody. The amplified virus stocks were generated according to
standard protocols (O'Reilly and Miller, 1989
) and used to infect sf9
insect cells growing in 25-cm2 tissue culture
flasks. The cells were harvested 3 to 4 d post infection.
Modifying the EIX Gene
Site-directed mutagenesis was performed as described by
Kunkel (1985)
. In vitro mutagenesis was performed on single-stranded DNA isolated from pBS-KS (Stratagene) vector harboring the EIX gene
using two different sets of
oligonucleotides:
5'-AACCCATTAATCXXXTACTAC-3' (to generate mutations at codon 86 of EIX) and
5'-ATCATTGCCGTGXXXGGCTAC-3' (to generate mutations at codon 177 of
EIX). XXX refers to: Asp change GAC; Gln change CAC; Gly change GGA.
The mutations were confirmed by sequencing.
| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
Induction of Ethylene Biosynthesis by Different Xylanases
The enzymatic activity (
-1-4-endoxylanase) of EIX was compared
with the enzymatic activity of XynI and XynII
isolated from Trichoderma reesei (Torronen et al., 1992
).
EIX and XynII had similar enzymatic activity, while
XynI was less active (Fig. 1A; Torronen et al., 1992
). XynII, but not XynI,
cross-reacted with antibodies raised against EIX (Fig. 1B). The
abilities of EIX, XynII, and XynI to induce
ethylene biosynthesis was compared. EIX and XynII but not
XynI induced ethylene biosynthesis in tobacco leaves (Fig.
1C). When EIX was mixed with XynII, ethylene biosynthesis was enhanced. However, when EIX or XynII was mixed with
XynI, ethylene biosynthesis levels were similar to those
induced by EIX or XynII alone. Moreover, doubling the amount
of XynI did not induce ethylene biosynthesis (Fig. 1C).
These data show that the addition of an enzyme (XynI) with
similar enzymatic activity as EIX or XynII does not
influence the induction of ethylene biosynthesis by EIX or
XynII. Thus, the xylanase activity of EIX appears to be
unrelated to the elicitation process. However, differences in substrate
specificity between XynI and EIX may exist. There is also
the possibility that the difference in enzyme specificity may account
for the inability of XynI to induce ethylene induction. Therefore, we chose the molecular approach to separate the two activities.
|
Isolating the Gene Coding for EIX from T. viride
The EIX protein has been isolated from T. viride and a
partial amino acid sequence determined (Dean et al., 1994
). Genes for two xylanases have been cloned from T. reesei (Torronen et
al., 1992
). We used degenerate primers in a PCR reaction to amplify a
320-bp DNA fragment representing part of the T. viride EIX
gene. The deduced amino acid sequence of part of the 320-bp fragment showed over 90% identity to the partial amino acid sequence of the
T. viride xylanase and 79% identity to XynII
from T. reesei (data not shown). A full-length cDNA clone of
EIX was isolated from a T. viride cDNA library designated
Tvx. It contained a 672-bp coding region, a 55-bp 5' UTR,
and a 190-bp 3' UTR (Fig. 2). The coding
region of EIX contains a 32-amino acid signal peptide (determined by
homology to other xylanases) responsible for the secretion of the EIX
protein from the cells into the growth medium. Additionally, the
deduced amino acid sequence of Tvx and XynII from
T. reesei are 80% identical, while there is only 50%
identity with the XynI protein (Fig.
3).
|
|
Modifying the EIX Protein
The mechanisms underlying elicitor perception at the plant cell
surface are still not well understood. Nurnberger et al. (1994)
showed that an oligopeptide of 13 amino acids from a 42-kD glycoprotein elicitor from P. megasperma binds to plant membranes and can
stimulate a complex defense response in parsley cells. To define the
epitope necessary for inducing the plant defense response, we expressed the EIX protein in a baculovirus expression system. The EIX ORF was
cloned behind the strong polyhedron promoter of the baculovirus, and
the protein was expressed in sf9 insect cells. Immunoblots were used to
identify the overexpressed EIX protein in the sf9 cells (Fig.
4). The two biological activities of the
overexpressed protein, xylanase activity (Table
I;
-1-4-endoxylanase) and the
induction of ethylene biosynthesis in tobacco (Table I). We found that
the baculovirus-expressed protein maintained the same level of activity
as the protein isolated from T. viride.
|
|
Two amino acids at the active site, Glu-86 and Glu-177 of the
XynII protein from T. reesei, were previously
found to be essential for the enzymatic activity (Torronen et al.,
1992
). Similar amino acids exist in similar positions in the mature EIX
protein isolated from T. viride. We performed
single-substitution mutations involving these two amino acids (amino
acids Glu-86 and Glu-177 are indicated in Fig. 2) by site-directed
mutagenesis and expressed the mutated proteins in the baculovirus
expression system. Glu-86 was changed to Asp-86, Gln-86, or Gly-86,
while Glu-177 was changed to Asp-177, Gln-177, or Gly-177. Similar
amounts of overexpressed mutated proteins as determined by immunoblots
(data not shown) were used to test the xylanase and elicitor activities.
We analyzed the xylanase activity of the mutant proteins. The xylanase
activity of EIX reached saturation when using 100 ng/mL EIX protein
(Fig. 5A), while the enzymatic activity
of mutants Gln-86 and Asp-177 showed no activity even at a
concentration of 1,000 ng/mL. Further analysis showed that all of the
mutated proteins lost their xylanase activity (Fig. 5B). These results strongly support the data by Torronen et al. (1994)
that Glu-86 and
Glu-177 are essential for xylanase activity. The ethylene induction
activity of mutants Gln-86 and Asp-177 was more than 50% of the EIX
(Fig. 6A), while mutants Gly-86 and
Gly-177 displayed about 20% and mutants Asp-86 and Gln-177 displayed
about 10% of the EIX activity (Fig. 6A). A dose-response assay showed
that the mutant proteins Gln-86 and Asp-177 retained their elicitation activity (Fig. 6B). The induction pattern of the two mutants was similar to that of the EIX protein (Fig. 6B).
|
|
The induction of ethylene biosynthesis correlates with the ability of
EIX to induce pathogenesis-related proteins and the HR (Bailey et al.,
1995
). Therefore, we used the induction of HR by EIX as a second assay
to analyze the function of the mutated proteins. The mutated proteins
were injected into tobacco leaves and the induction of HR was monitored
96 h after injection (Fig. 7). We
injected six different leaves on three different plants. A
representative experiment of a single leaf is shown in Figure 7. The
induction of HR by the mutated proteins paralleled the amount of
ethylene induction by the same mutated proteins. Mutated proteins that
gave induction to a high level of ethylene induced a strong HR
phenotype (Figs. 6 and 7). Thus, the protein itself is likely the
elicitor molecule that induces the plant defense response.
|
The two amino acids Glu-86 and Glu-177 were shown to be located in the
cleft region of the protein that binds xylan (Torronen et al., 1994
).
We reasoned that a conserved change from Glu to Asp or Gln should not
affect the overall structure of the EIX protein. However, it might
influence the structure of the active site. Indeed, all of the mutant
proteins lost the
-1-4-endoxylanase activity (Fig. 5), while some of
them also lost the elicitation activity (Figs. 6 and 7). We speculate
that the region of the active site might be also part of the EIX
protein that is been recognized by the plant cells, since small changes
in the active site influence the elicitation activity. Minor changes in
the part of the protein that serves as the epitope site might affect its binding capability to the plant cell, thus influencing its elicitation activity. EIX has been shown to interact with components of
the cell, e.g. the plasma membrane or other sites (Hanania and Avni,
1997
). Our results strongly support the data by Sharon et al. (1993)
showing that protoplasts, which lack wall components, respond to EIX.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dr. J.D. Anderson for the EIX protein, anti-EIX antibodies, and T. viride cDNA library, and Dr. A. Torronen for providing us with T. reesei XynI and XynII proteins. We are grateful to Drs. M. Edelman, G. Kotlizky, and A. Sharon for helpful suggestions and discussions.
| |
FOOTNOTES |
|---|
Received April 15, 1999; accepted June 23, 1999.
1 This work was supported in part by a research grant (no. 2491-95R) from The U.S.-Israel Binational Agriculture Research and Development Fund and in part by the Israel Science Foundation administrated by the Israel Academy of Science and Humanities.
* Corresponding author; e-mail lpavni{at}post.tau.ac.il; fax 972-3-640-9380.
| |
LITERATURE CITED |
|---|
|
|
|---|
-xylanases and endo-1,4-
-glucanases.
Anal Biochem
144: 142-146
[CrossRef][ISI][Medline]
-glucoside elicitor exists in soybean membranes.
Plant Cell
3: 137-147
-xylanase II from Trichoderma reesei: two conformational states in the active site.
EMBO J
13: 2493-2501
[ISI][Medline]This article has been cited by other articles:
![]() |
S. Djonovic, W. A. Vargas, M. V. Kolomiets, M. Horndeski, A. Wiest, and C. M. Kenerley A Proteinaceous Elicitor Sm1 from the Beneficial Fungus Trichoderma virens Is Required for Induced Systemic Resistance in Maize Plant Physiology, November 1, 2007; 145(3): 875 - 889. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aziz, A. Gauthier, A. Bezier, B. Poinssot, J.-M. Joubert, A. Pugin, A. Heyraud, and F. Baillieul Elicitor and resistance-inducing activities of {beta}-1,4 cellodextrins in grapevine, comparison with {beta}-1,3 glucans and {alpha}-1,4 oligogalacturonides J. Exp. Bot., April 1, 2007; 58(6): 1463 - 1472. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Matarasso, S. Schuster, and A. Avni A Novel Plant Cysteine Protease Has a Dual Function as a Regulator of 1-Aminocyclopropane-1-Carboxylic Acid Synthase Gene Expression PLANT CELL, April 1, 2005; 17(4): 1205 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ron and A. Avni The Receptor for the Fungal Elicitor Ethylene-Inducing Xylanase Is a Member of a Resistance-Like Gene Family in Tomato PLANT CELL, June 1, 2004; 16(6): 1604 - 1615. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tripathy, K. Kleppinger-Sparace, R. A. Dixon, and K. D. Chapman N-Acylethanolamine Signaling in Tobacco Is Mediated by a Membrane-Associated, High-Affinity Binding Protein Plant Physiology, April 1, 2003; 131(4): 1781 - 1791. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Boudart, M. Charpentier, C. Lafitte, Y. Martinez, A. Jauneau, E. Gaulin, M.-T. Esquerre-Tugaye, and B. Dumas Elicitor Activity of a Fungal Endopolygalacturonase in Tobacco Requires a Functional Catalytic Site and Cell Wall Localization Plant Physiology, January 1, 2003; 131(1): 93 - 101. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Martinez, F. Blanc, E. Le Claire, O. Besnard, M. Nicole, and J.-C. Baccou Salicylic Acid and Ethylene Pathways Are Differentially Activated in Melon Cotyledons by Active or Heat-Denatured Cellulase from Trichoderma longibrachiatum Plant Physiology, September 1, 2001; 127(1): 334 - 344. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY | THE PLANT CELL | |
|---|---|---|---|