|
Plant Physiol, October 1999, Vol. 121, pp. 391-398
The Enzymatic Activity of Fungal Xylanase Is Not Necessary for
Its Elicitor Activity
Jürg
Enkerli,*
Georg
Felix, and
Thomas
Boller
Friedrich Miescher Institute, P.O. Box 2543, CH-4002 Basel,
Switzerland
 |
ABSTRACT |
Fungal xylanases from
Trichoderma spp. are potent elicitors of defense
responses in various plants. To determine whether enzymatic activity is
necessary for elicitor activity, we used site-directed mutagenesis to
reduce the catalytic activity of xylanase II from Trichoderma
reesei. For this, the glutamic acid residue at position 210, which is part of the active center in this family of enzymes, was
changed to either aspartic acid (E210D) or serine (E210S). Wild-type
and mutated forms of xylanase II were expressed in yeast cells and
purified to homogeneity. Compared with the wild-type form of xylanase
II, E210D had >100-fold and E210S 1,000-fold lower enzymatic activity.
In contrast, these mutated forms showed no comparable drop in elicitor
activity. They fully stimulated medium alkalinization and ethylene
biosynthesis in suspension-cultured tomato (Lycopersicon
esculentum) cells, as well as hypersensitive necrosis in leaves
of tomato and tobacco (Nicotiana tabacum) plants. These
results provide direct evidence that enzyme activity is not necessary
for elicitor activity of fungal xylanase.
 |
INTRODUCTION |
Many microorganisms that live as plant pathogens or as plant
saprophytes dispose of an array of enzymes to degrade plant cell walls
that include enzymes hydrolyzing cellulose, pectin, and xylan. Fungal
endo- -1,4-xylanases are well-known proteinaceous elicitors of
defense response reactions in tobacco (Nicotiana tabacum)
and tomato (Lycopersicon esculentum) plants (Bailey et al.,
1990 ; Fluhr et al., 1991 ; Avni et al., 1994 ). When applied to tobacco
or tomato leaves, these xylanases induce ethylene biosynthesis, the
production of phytoalexins and pathogenesis-related proteins, and cause
necrosis and hypersensitive cell death. In suspension-cultured cells of
tobacco and tomato they induce rapid medium alkalinization, oxidative
burst, and ethylene biosynthesis (Felix et al., 1991 , 1993 ; Bailey et
al., 1992 ; Yano et al., 1998 ). Endo- -1,4-xylanases have been
isolated and characterized from a variety of different plant-pathogenic
and non-pathogenic fungi (Törrönen et al., 1992 ; Yagouchi
et al., 1992 ; Wu et al., 1995 ; Apel-Birkhold and Walton, 1996 ; Luttig
et al., 1997 ; Giesbert et al., 1998 ). Several of these
-1,4-xylanases are active elicitors, but the xylanase from
Trichoderma viride has been used most extensively to study elicitor activity of fungal xylanases (Dean et al., 1989 ; Yano et al.,
1998 ).
Due to the importance of endo- -1,4-xylanases for industrial
applications in the pulp and paper industry, this group of proteins has
been characterized in detail (Wong and Saddler, 1992 ).
Endo- -1,4-xylanases (1,4- -D-xylan xylanohydrolase; EC
3.2.1.8) belong to the class of glycosyl hydrolases, and within this
class they have been assigned to two enzyme families: family 10 contains xylanases with a molecular mass over 30 kD and an acidic pI,
and family 11 comprises xylanases with a molecular mass smaller than 30 kD and a basic pI (Henrissat and Bairoch, 1993 ; Biely et al., 1997 ).
All endo- -1,4-xylanases that have thus far been found to be
elicitors of defense reactions in plants belong to the family 11 xylanases (Dean et al., 1989 ; Yano et al., 1998 ). Several
endo- -1,4-xylanases of bacterial and fungal origin that belong to
family 11 have been crystallized and their three-dimensional structures
determined (Campbell et al., 1993 ; Törrönen and Rouvinen,
1995 ; Krengel and Dijkstra, 1996 ). The overall three-dimensional
structure of these proteins is very similar and has been described as
the shape of a "right hand" with an active center formed by the
thumb, palm, and fingers of the hand. Mutational analyses have led to
the identification of two conserved Glu residues in the active center
that are critical for enzymatic activity (Ko et al., 1992 ; Wakarchuk et
al., 1994 ).
At present it is still uncertain how the xylanase elicitor is perceived
by plant cells. Plant cells could perceive xylanase directly by a
receptor for this protein (Hanania and Avni, 1997 ) or indirectly via
plant cell wall fragments generated by its enzymatic activity (Bucheli
et al., 1990 ). So far, elicitor activity and enzyme activity have not
been clearly separated. Treatments that lead to losses in enzyme
activity, such as treatment with protease or heat denaturation, also
abolish elicitor activity. This means that the three-dimensional
structure of xylanase is essential for elicitor activity and that the
protein is not simply recognized by its primary structure (Fuchs et
al., 1989 ; Lotan and Fluhr, 1990 ).
Indirect but cumulative evidence suggests that xylanase is recognized
as a protein structure rather than via its enzymatic activity: (a)
protoplasts that are lacking most of their cell walls react to xylanase
(Sharon et al., 1993 ); (b) not all enzymes with endo- -1,4-xylanase
activity are active as elicitors (Yano et al., 1998 ); (c) efforts to
isolate elicitor-active cell wall fragments released by
endo- -1,4-xylanase activity have not been successful (Dean et al.,
1991 ); (d) a specific binding site for the endo- -1,4-xylanase
protein on tobacco protoplasts has been reported (Hanania and Avni,
1997 ). Even though these experiments suggest a direct recognition of
xylanase, they do not exclude the involvement of endo- -1,4-xylanase
activity in the elicitation process. The goal of this study was to
determine whether enzymatic activity of fungal -1,4-xylanase is
necessary for its elicitor activity. We addressed this question by
creating enzymatically inactive forms of xylanase II cloned from
Trichoderma reesei and testing them for their elicitor activity.
 |
MATERIALS AND METHODS |
Strains, Plant Material, and Growth Conditions
Saccharomyces cerevisiae strain Y294
(MAT , leu2-3, 112,
ura3-52, his3, and trp1-289) (La
Grange et al., 1996 ) was used as a host to express wild-type and
mutated forms of the xylanase II gene (XYN2) from
Trichoderma reesei QM 6a. Cultures were grown and maintained
in complex (yeast peptone dextrose) or synthetic medium at 30°C (La
Grange et al., 1996 ). Recombinant plasmids were constructed and
amplified in Escherichia coli XL1 Blue (Stratagene, La
Jolla, CA). The tomato (Lycopersicon esculentum) cell line Msk8 was maintained and subcultured as described earlier (Felix et al.,
1991 ). Cells were used for experiments 5 to 8 d after subculturing. Tomato (cv Moneymaker) and tobacco (Nicotiana
tabacum cv Havana 425) plants were grown in soil in a greenhouse.
DNA Manipulations and Plasmid Construction
Standard molecular techniques were used throughout (Sambrook et
al., 1989 ). The yeast expression clone pDLG5 harboring the XYN2 gene of T. reesei under the control of the
inducible ADH2 promoter was kindly provided by Dr. W.H. van
Zyl (Department of Microbiology, University of Stellenbosch, South Africa).
For site-directed mutagenesis by inverse PCR (Clackson et al., 1991 )
the XYN2 gene was first subcloned into pBluescript II SK
(Stratagene). For this, a BglII restriction site was
introduced into the multiple cloning site of pBluescript II SK by
inverse PCR using the two phosphorylated back-to-back primers
AGATCTATCGATACCGTCGAC and AAGCTTGATATCGAATTCCTG. The
reaction conditions were as follows: 100 ng of template DNA, 0.25 µM of each of the primers, 0.2 mM dNTPs, and 5 units of Pfu DNA polymerase
(Stratagene) in Pfu reaction buffer. After an initial denaturation step
of 1 min at 95°C, 25 cycles of denaturation, annealing, and
polymerization were carried out for 45 s at 95°C, 45 s at
50°C, and 6 min at 72°C, respectively. The amplified DNA fragment
was purified and self-ligated, resulting in plasmid pBSBlgII. pDLG5 was
digested with BglII and EcoRI, and the
XYN2 fragment was isolated. XYN2 was ligated into
pBSBglII, resulting in plasmid pXyn2. Mutations of amino acid E210 to S and D were introduced in pXyn2 using inverse PCR amplification with
back-to-back primer pairs containing a mutation in the forward primer
(E-S forward primer GCCGTGTCGGGTTACTTTAGCT; E-D forward
primer GCCGTGGACGGTTACTTTAGCT). The reverse primer for both
amplifications was GGTTGCGGGACCAGCCGTAC.
The reaction conditions were as described above except that the
elongation time was 8 min. Amplified fragments were isolated and
self-ligated, resulting in plasmids pXynES (E-S) and pXynED (E-D).
Mutations were confirmed by sequencing the inserts of pXynES and
pXynED. pXynES and pXynED were digested with BglII and
EcoRI, the mutated XYN2-containing fragments were
isolated and ligated into the expression vector pDLG1 (La Grange et
al., 1996 ). The resulting plasmids were termed pE210S and pE210D,
respectively. Plasmids were transformed into S. cerevisiae
Y294 using the lithium acetate method (Gietz et al., 1992 ) and selected
on synthetic medium minus uracil plates.
Protein Expression and Purification
Recombinant S. cerevisiae (200-mL cultures) were grown
for 4 d in yeast-peptone-Gal medium (1% [w/v] yeast
extract, 2% [w/v] peptone, and 0.8% [w/v] Gal) at
30°C on a rotary shaker at 250 rpm. Cells were removed by
centrifugation (10 min at 8,000g) and the supernatants were
dialyzed against water in tubing with a molecular cutoff of 6,000 to
8,000 (Spectra/Por, The Spectrum Companies, Gardena, CA). Dialyzed
supernatants were pre-purified by passing over cation-exchange resin
(SP Trisacryl M, Sepracor-IBF Biotechnics, Villeneuve-la-Garenne,
France) at pH 4.5, and eluted with 500 mM NaCl.
After dialysis and lyophilization, the pre-purified xylanase
preparations were dissolved in 10 mM citrate
buffer, pH 4.5, and separated on a MonoS FPLC column (Pharmacia
Biotech, Uppsala) using a gradient of 0 to 500 mM
NaCl for elution. Fractions used for further experiments were dialyzed
as described above.
Enzyme Activity Assay
Endo- -1,4-xylanase activity was measured using the modified
dinitrosalicylic acid method (Bailey et al., 1992 ).
4-O-Methyl glucuronoxylan (product 7500, Roth,
Karlsruhe, Germany) was used as a substrate at a concentration
of 1% (w/v) and increases in reducing sugars were determined after 5 min of incubation. Samples were measured in triplicate at different
dilutions and activity was derived from linear regression analysis.
Assays for Elicitor Activity
The extracellular alkalinization response was measured in
suspension-cultured tomato cells using a small, combined pH electrode (Metrohm, Herisau, Switzerland) as described previously (Felix et al.,
1993 ). Alternatively, extracellular pH values were measured 15 min
after the addition of test substances to 1-mL aliquots of the cell
suspension. For these assays, cells were incubated in 24-well
tissue-culture plates on a rotary shaker at 200 rpm.
Induction of ethylene biosynthesis was assayed as described previously
(Felix et al., 1991 ). One-milliliter aliquots of the cell suspension
(approximately 0.2 g fresh weight) were transferred to 6-mL glass
tubes and the elicitors to be tested were added. The tubes were closed
with rubber septa and ethylene accumulating in the free air space was
measured by GC after 4 h of incubation on a rotary shaker.
For testing the induction of necrosis, preparations were injected
through the lower leaf surfaces of tomato (5 weeks old) or tobacco (7 weeks old) plants with a 1-mL plastic syringe without a needle. For
every site of injection, leaves were treated with 30 µL of the
preparation to be tested and photographed after incubation for 6 d
at 25°C (12 h of light/12 h of dark).
Reproducibility
The results shown in the figures represent single
experiments representative of at least three independent repetitions.
 |
RESULTS |
Wild-Type and Mutant Forms of Endo- - Xylanase from T. reesei
The XYN2 gene of T. reesei encodes a
223-amino acid proprotein (Saarelainen et al., 1993 ) (Fig.
1). The N-terminal sequence codes for a
33 amino acid secretion signal that is proteolytically cleaved off,
resulting in a 190-amino acid mature xylanase II protein. Like other
family 11 type endoxylanases, the enzyme of T. reesei has
two conserved Glu residues at positions 119 and 210 (Saarelainen et
al., 1993 ) (Fig. 1). For xylanases from Bacillus pumilus and
Bacillus circulans, these Glu residues have been shown to be
crucial for enzymatic activity (Ko et al., 1992 ; Wakarchuk et al.,
1994 ). We used site-directed mutagenesis to change the codon GAG coding
for the Glu residue at position 210 to either TCG, coding for Ser, or
to GAC, coding for Asp (Fig. 1). The mutated XYN2 genes were
then inserted into the expression vector pDLG1 (La Grange et al., 1996 )
to form plasmids pE210S and pE210D, respectively.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 1.
Primary structure of xylanase II proprotein. A,
Primary structure of the xylanase II proprotein from T.
reesei as deduced from cDNA sequence (database accession no.
U24191 [La Grange et al., 1996 ]). The first 33 amino acid residues
(underlined) constitute the cleavable export signal. The two Glu
residues essential for enzyme activity and conserved in all family 11 xylanases are highlighted (positions 119 and 210). B, Sequence of cDNA
coding for xylanase II in the region coding for Glu 210. Primers used
for inverse PCR to change the codon for Glu 210 to codons for Asp
(E210D) or Ser (E210S) are indicated by arrows.
|
|
Wild-type and mutated xylanase II proteins (termed E210D and E210S)
were expressed in S. cerevisiae grown in liquid culture. When analyzed by SDS-PAGE, the culture filtrates of these transformed yeast cells were found to contain proteins migrating with apparent molecular masses of 26 and 21 kD that were not present in the supernatants of untransformed yeast cultures (Fig.
2). Expression of XYN2 from
T. reesei in yeast cells has previously been shown to cause
the secretion of a glycosylated form of xylanase II migrating with an
apparent molecular mass of 26 to 27 kD (La Grange et al., 1996 ).
Deglycosylation of this protein resulted in a protein migrating at 21 kD, which corresponds to the molecular mass of the mature polypeptide
with 190 amino acids. For further experiments the major, glycosylated
forms of the xylanase II molecules were purified by cation-exchange
chromatography on a MonoS FPLC column (Fig. 2).

View larger version (64K):
[in this window]
[in a new window]
|
Figure 2.
Wild-type and mutated xylanase II expressed in
yeast cells. SDS-PAGE of proteins from culture medium of
non-transformed yeast (Y294), and yeast expressing wild-type (WT) and
mutated (E210S and E210D) forms of xylanase II. Lanes were loaded with
20 µg of total protein present in cell supernatants (S) or with 5 µg of protein after purification by cation-exchange chromatography.
Standard molecular mass markers are indicated on the left.
|
|
Enzyme Activity of Wild-Type and Mutant Forms of Xylanase II
The purified wild-type and mutant forms of the T. reesei xylanase II were assayed for their endo- -1,4-xylanase
activity by detecting the production of reducing sugars from
4-O-methyl glucuronoxylan. Mutant forms of xylanase had
drastically reduced enzymatic activities compared with the wild type
(Fig. 3). In further experiments with highly increased concentrations of purified proteins (10 µg), low but
significant residual activities could be detected in the mutated forms
of xylanase (Table I). The specific
enzyme activity of mutant E210D was 0.8% and that of E210S was 0.1%
of the wild-type activity.

View larger version (12K):
[in this window]
[in a new window]
|
Figure 3.
Enzyme activity of wild-type and mutated xylanase
II. Endo- -1,4-xylanase activity of wild-type ( ), mutant E210S
( ), and mutant E210D ( ) xylanase II purified from transgenic
yeast cultures. Symbols represent the average of three measurements and
bars represent SD.
|
|
Early Elicitor Responses Induced by Wild-Type and Mutant Forms of
Xylanase II
Medium alkalinization has been reported as a rapid response of
suspension-cultured cells to treatment with xylanase preparations from
Trichoderma viride (Bailey et al., 1992 ; Felix et al.,
1993 ). Medium alkalinization was also observed after treatment of
suspension-cultured tomato cells with preparations from yeast
transgenic for the wild-type and mutant forms of xylanase II from
T. reesei but not after treatment with corresponding protein
preparations from non-transformed yeast cultures (data not shown).
Alkalinization of the culture medium, measured as the extracellular pH
reached after 15 min of treatment, was a steady, sigmoid function of
the dose of elicitor applied (Fig. 4A).
The wild-type form of xylanase II stimulated the alkalinization response half-maximally at 0.12 µg/mL (Fig. 4A; Table
II) or, based on an estimated molecular
mass of 26 kD, at a concentration of approximately 5 nM.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 4.
Alkalinization response and induction of ethylene
biosynthesis in suspension-cultured tomato cells. A, Extracellular pH
in tomato cells treated for 15 min with different doses of wild-type
( ), mutant E210S ( ), and mutant E210D ( ) xylanase II. Symbols
represent the average of three measurements and bars represent
SD. B, Induction of ethylene biosynthesis in tomato cells
by different doses of wild-type ( ), mutant E210S ( ), and mutant
E210D ( ) xylanase II. Ethylene accumulating in the free-air phase of
the cultures was measured 4 h after of treatment. Symbols
represent the average of three measurements and bars represent
SD.
|
|
The mutants of xylanase II were potent elicitors of the alkalinization
response as well, and the concentrations required for half-maximal
induction were only approximately four times higher than for the
wild-type form (Fig. 4A; Table II). Medium alkalinization induced by
the wild-type and mutant forms of xylanase II showed the
characteristics observed for the induction of this response by xylanase
purified from T. viride (Felix et al., 1993 ). In particular, activity was completely inactivated by heat treatment (5 min at 95°C)
and, when compared at saturating doses in the same batch of cells,
alkalinization started after the same lag phase of approximately 3.5 min and resulted in the same maximal pH increase (data not shown).
Xylanase from T. viride has been observed to stimulate
ethylene biosynthesis in tobacco plants (Fuchs et al., 1989 ) and in suspension-cultured cells of tobacco and tomato (Bailey et al., 1992 ;
Felix et al., 1994 ). The purified xylanase II proteins from transgenic
yeast were assayed for the induction of ethylene biosynthesis in tomato
cell cultures (Fig. 4B). The wild-type and the two mutant forms of
xylanase II were potent elicitors of ethylene biosynthesis (Fig. 4B),
whereas no comparable induction of ethylene biosynthesis was observed
with the corresponding protein preparations from non-transformed yeast
cultures (data not shown). The dose-response relationships for the two
mutant forms of xylanase II were very similar to those observed for
induction of the alkalinization response described above, and
half-maximal induction occurred at concentrations of 0.28 µg/mL for
mutant E210S and 0.45 µg/mL for mutant E210D (Fig. 4B; Table II). In
contrast, the wild-type form of xylanase II was less efficient as an
inducer of ethylene biosynthesis, and half-maximal induction was only
observed at a concentration of 1.40 µg/mL (Table II). Nevertheless,
all three xylanase II proteins induced the same maximal level of
ethylene biosynthesis when applied at saturating doses of >10 µg/mL
(Fig. 4B).
Apparently, the enzymatic activity of xylanase negatively affected its
activity as an inducer of ethylene biosynthesis. This effect was also
apparent by comparing the ethylene-inducing activity of mutant E210D
with that of mutant E210S. Mutant E210D retained a somewhat higher
residual activity than mutant E210S, and was also slightly less
efficient in inducing ethylene biosynthesis (Table II).
In summary, the wild-type form of xylanase II as well as the two mutant
forms, E210S and E210D, were potent elicitors of rapid responses in
tomato cells, and the minor differences in efficiency as elicitors did
not reflect the major changes observed in enzyme activity.
Elicitation of Necrosis by Wild-Type and Mutant Forms of Xylanase
II
Xylanase from T. viride has been reported to induce
necrosis when injected into tobacco leaves (Bailey et al., 1990 ).
Purified wild-type and mutant forms of xylanase II were injected into
tomato and tobacco leaves to test their capacity to induce necrosis. All three forms of xylanase II induced necrosis (Fig.
5, A and B). In tomato leaves necrotic
areas became visible 2 d after injection, whereas in tobacco
leaves the areas injected with xylanase II forms turned light green
within 2 d and necrotic spots started to develop 3 d after
injection. Injection of water did not result in any visible symptoms in
tomato or tobacco leaves. Also, no symptoms were observed in leaves of
either plant species injected with heat-denatured xylanase II forms (5 min at 95°C) or with corresponding protein preparations from
non-transformed yeast cultures (data not shown). Injecting wild-type
and mutant E210S xylanase II at different concentrations into tobacco
leaves revealed that the lowest concentration that induced necrosis was
1 µg/mL for the wild-type form and 5 µg/mL for the mutant E210S
(Fig. 5C). Thus, as observed for the alkalinization response, the
mutant form appears to be slightly (approximately 5-fold) less
effective than the wild-type form.

View larger version (89K):
[in this window]
[in a new window]
|
Figure 5.
Induction of necrosis in tomato and tobacco
leaves. Tomato (A) and tobacco (B) leaves injected with wild-type (WT)
and mutant forms (E210S and E210D) of xylanase II and water as a
control. Leaves were injected with xylanase preparations at a
concentration of 1 mg/mL for tomato leaves and 10 µg/mL for tobacco
leaves. C, Tobacco leaf injected with different concentrations of
wild-type and mutant E210S xylanase as indicated.
|
|
 |
DISCUSSION |
Plants have evolved systems to monitor the intactness of their
cells or tissues, and they respond to wounding or pathogen attack with
the induction of protective responses. Detection of injury can occur
via endogenous, plant-derived products such as pectic fragments
(Collmer and Keen, 1986 ), cutin monomers (Schweizer et al., 1996 ), or,
in the case of solanaceous plants, specific wound hormones such as
systemin (Ryan, 1992 ). Detection of cell injury could also occur via
detection of cell wall loosening, e.g. by sensing changes in turgor
pressure or via the activation of stretch-activated channels. Yet
another possibility to detect potential pathogenic invaders lies in the
perception of chemical cues, also termed elicitors, that are
characteristic for the invading microorganisms. Highly specific and
sensitive perception systems for a variety of elicitors have been
described (Boller, 1995 ).
The goal of this study was to determine whether enzymatic activity of
fungal endo- -1,4-xylanase is necessary for its elicitor activity. We
mutated amino acid 210 of xylanase II from T. reesei from
Glu to either Ser or Asp. While these mutations drastically reduced the
enzyme activity, they did not affect elicitor activity in a comparable
manner. The mutated forms of xylanase II were still active as elicitors
of extracellular alkalinization and ethylene biosynthesis of tomato
cell cultures, and of necrosis in tomato and tobacco leaves. Although
the mutations of Glu 210 resulted in slightly altered elicitor
activities (e.g. approximately 4-fold lower for induction of the
alkalinization response) these changes did not reflect the much bigger
reductions in enzyme activities (>100-fold). These results clearly
demonstrate that enzymatic activity of fungal endo- -1,4-xylanase is
not necessary for its elicitor activity and, together with the recent
observation of a specific binding site for endo- -1,4-xylanase on the
surface of tobacco cells (Hanania and Avni, 1997 ), they show that the elicitor activity is solely based on the specific recognition of the
xylanase protein.
The mutant forms of xylanase II were slightly less active in eliciting
extracellular alkalinization of tomato cell cultures and necrosis in
tobacco leaves. At present we have no explanation for this effect, but
mutation of the Glu residue might cause an alteration in the overall
structure of the protein, or the Glu residue might be part of the
recognition site used by the putative plant receptor for xylanase.
Structural analyses of xylanases from B. circulans and
B. pumilus mutated at the corresponding Glu residues have
demonstrated no major alterations in the overall structure of the
proteins (Ko et al., 1992 ; Wakarchuk et al., 1994 ).
Interestingly, the mutant forms of xylanase II were more effective than
the wild-type form as elicitors of ethylene biosynthesis. The
dose-response curves for the two mutant forms were very similar for
induction of both extracellular alkalinization and stimulation of
ethylene biosynthesis. In contrast, induction by the wild-type form had
a different dose dependence, and the concentration necessary for
half-maximal induction of ethylene biosynthesis was 10-fold higher than
for induction of the alkalinization response. A closer look at the
dose-response curve shows that wild-type xylanase did not follow a
simple sigmoid function for ethylene induction. Rather, the wild-type
form was as active as the mutant forms at lower concentrations and less
active at higher concentrations. Apparently, induction of ethylene
production appears to represent a combination of a positive elicitor
effect of the xylanase II protein and a negative effect of xylanase II
enzymatic activity.
There are two mechanisms that could explain a negative effect of
enzymatic activity. First, xylanase activity might release harmful or
inhibitory fragments from the cell wall. Indeed, the release of toxic
cell wall fragments has been reported in maize cells treated with a
xylanase isolated from Magnaporthe grisea (Bucheli et al.,
1990 ). Second, the enzyme might harm or inhibit the cells by changing
the integrity of certain components in the cell wall or at the
plasma membrane interface without actually releasing active
fragments. However, the enzymatically active wild-type form of xylanase
did induce full induction of ethylene biosynthesis when added at higher
doses, a finding that argues against a generally inhibitory or toxic
effect of the xylanase activity. Alternatively, one could speculate
that putative xylanase substrates in the plant cell walls could act as
binding sites for the enzymatically active xylanase and adsorb part of
the xylanase molecules. However, since the wild-type form of xylanase
is actually more efficient in the induction of the alkalinization
response, this does not seem to provide a straightforward explanation
of the experimental data. Differences in the kinetics of induction or
in the stability of the different forms of xylanase could provide explanations for differences in the rapid alkalinization assay measured
after 15 min and the slower induction of ethylene biosynthesis measured
after 4 h. Further investigations are necessary to determine whether there is really a negative effect of xylanase activity on plant
cells in culture and whether such an effect also occurs in planta.
Xylanase II proteins described in this report and xylanase purified
from T. viride induce elicitor responses such as medium alkalinization and ethylene biosynthesis with similar kinetics and
maximal responses. However, on a per-weight basis, xylanase from
T. viride appeared to be approximately five to 10 times more efficient than the xylanase II of T. reesei expressed in
yeast. Xylanase from T. viride and xylanase II from T. reesei are structurally very similar, and the amino acid sequences
differ at eight positions only (database accession nos. A44595 and
S67387). At present, we cannot distinguish whether the differences in
elicitor activity are due to differences in the amino acid sequences or
whether they originate from differences in protein modification, such as glycosylation in T. viride and yeast. Although
preliminary results with xylanase II from T. reesei
expressed in E. coli indicate that glycosylation is not
essential for elicitor activity (J. Enkerli, unpublished results),
glycosylation might have a modifying effect on the elicitor activity of
xylanase. Detailed studies (e.g. replacing single amino acids in
xylanase II from T. reesei) will be necessary to investigate
the basis for the differences in elicitor activity between the various
xylanase proteins.
Xylan is part of the complex hemicellulose fraction of plant cell
walls. The actual composition of hemicellulose varies from species to
species, and so far it is unclear whether tomato or tobacco cells grown
in suspension cultures contain xylan in their cell walls that could
serve as a substrate for endo- -1,4-xylanase. Efforts to release
water-soluble reducing sugars from tobacco plants (Dean and Anderson,
1991 ) or suspension-cultured tomato cells (M. Bürgin, personal
communication) by the action of endo- -1,4-xylanase have not been
successful. The inhibitory activity of enzymatically active xylanase on
ethylene biosynthesis observed in this report could provide the first
evidence for a possible substrate present in the cell walls of tomato cells.
Several microbial cell wall-degrading enzymes have been recognized as
elicitors of plant defense reactions (Walton, 1994 ). Among these,
fungal xylanase is the only example known so far that exhibits its
elicitor activity not through its enzymatic activity but rather by
being recognized directly. Identification of the epitope of xylanase II
protein of T. reesei responsible for its elicitor activity
will provide the basis for an understanding of the interaction of
proteinaceous elicitors with their respective binding proteins in plant cells.
 |
ACKNOWLEDGMENTS |
We thank Dr. W.H. van Zyl for providing plasmid pDLG5 and
S. cerevisiae strain Y294. We also thank Dr. Margaret A. Collinge for critical reading of the manuscript.
 |
FOOTNOTES |
Received February 11, 1999; accepted June 22, 1999.
*
Corresponding author; e-mail jenkerli{at}fmi.ch; fax
41-61-697-39-76.
 |
LITERATURE CITED |
-
Apel-Birkhold PC, Walton JD
(1996)
Cloning, disruption, and expression of two endo-
1,4-xylanase genes, XYL2 and XYL3, from Cochliobolus carbonum.
Appl Environ Microbiol
62: 4129-4135
[Abstract] -
Avni A, Avidan N, Eshed Y, Zamir D, Bailey BA, Stommel JR, Anderson JD
(1994)
The response of Lycopersicon esculentum to fungal xylanase is controlled by a single dominant gene (abstract no. 872).
Plant Physiol
105: S-158
-
Bailey BA, Dean JFD, Anderson JD
(1990)
An ethylene biosynthesis-inducing endoxylanase elicits electrolyte leakage and necrosis in Nicotiana tabacum cv Xanthi leaves.
Plant Physiol
94: 1849-1854
[Abstract/Free Full Text]
-
Bailey BA, Korcak RF, Anderson JD
(1992)
Alterations in Nicotiana tabacum L. cv Xanthi cell membrane function following treatment with an ethylene biosynthesis-inducing endoxylanase.
Plant Physiol
100: 749-755
[Abstract/Free Full Text]
-
Bailey MJ, Biely P, Poutanen K
(1992)
Interlaboratory testing of methods for assay of xylanase activity.
J Biotechnol
23: 257-270
-
Biely P, Vrsanska M, Tenkanen M, Kluepfel D
(1997)
Endo-
-1,4-xylanase families: differences in catalytic properties.
J Biotechnol
57: 151-166
[CrossRef][Web of Science][Medline] -
Boller T
(1995)
Chemoperception of microbial signals in plant cells.
Annu Rev Plant Physiol Plant Mol Biol
46: 189-214
[CrossRef][Web of Science]
-
Bucheli P, Doares SH, Albersheim P, Darvill A
(1990)
Host-pathogen interactions. XXXVI. Partial purification and characterization of heat-labile molecules secreted by the rice blast pathogen that solubilize plant cell wall fragments that kill plant cells.
Physiol Mol Plant Pathol
36: 159-173
-
Campbell RL, Rose DR, Wakarchuk WW, To R, Sung W, Yagouchi M
(1993)
A comparison of the structures of the 20 kd xylanases from Trichoderma harzianum and Bacillus circulans.
In
P Suominen, T Reinikainen, eds, Proceedings of the Second TRICEL Symposium on Trichoderma reesei Cellulases and Other Hydrolases, Espoo, Finland, 1993. Foundation for Biotechnical and Industrial Fermentation Research, Helsinki, pp 63-72
-
Clackson T, Güssow D, Jones PT
(1991)
General applications of PCR to gene cloning and manipulation.
In
MJ Mcpherson, P Quirke, GR Taylor, eds, PCR, a Practical Approach. Oxford University Press, Oxford, pp 187-214
-
Collmer A, Keen NT
(1986)
The role of pectic enzymes in plant pathogenesis.
Annu Rev Phytopathol
24: 383-409
[CrossRef][Web of Science]
-
Dean JFD, Anderson JD
(1991)
Ethylene biosynthesis-inducing xylanase. II. Purification and physical characterization of the enzyme produced by Trichoderma viride.
Plant Physiol
95: 316-323
[Abstract/Free Full Text]
-
Dean JFD, Gamble HR, Anderson JD
(1989)
The ethylene biosynthesis-inducing xylanase: its induction in Trichoderma viride and certain plant pathogens.
Phytopathology
79: 1071-1078
-
Dean JFD, Gross KC, Anderson JD
(1991)
Ethylene biosynthesis-inducing xylanase. III. Product characterization.
Plant Physiol
96: 571-576
[Abstract/Free Full Text]
-
Felix G, Grosskopf DG, Regenass M, Basse CW, Boller T
(1991)
Elicitor-induced ethylene biosynthesis in tomato cells: characterization and use as a bioassay for elicitor action.
Plant Physiol
97: 19-25
[Abstract/Free Full Text]
-
Felix G, Regenass M, Boller T
(1993)
Specific perception of subnanomolar concentrations of chitin fragments by tomato cells: induction of extracellular alkalinization, changes in protein phosphorylation, and establishment of a refractory state.
Plant J
4: 307-316
[CrossRef][Web of Science]
-
Felix G, Regenass M, Spanu P, Boller T
(1994)
The protein phosphatase inhibitor calyculin A mimics elicitor action in plant cells and induces rapid hyperphosphorylation of specific proteins as revealed by pulse-labeling with [33P]phosphate.
Proc Natl Acad Sci USA
91: 952-956
[Abstract/Free Full Text]
-
Fluhr R, Sessa G, Sharon A, Ori N, Lotan T
(1991)
Pathogenesis-related proteins exhibit both pathogen-induced and developmental regulation.
In
H Henneke, DSP Verma, eds, Advances in Molecular Genetics of Plant-Microbe Interactions. Kluwer, Dordrecht, The Netherlands, pp 387-394
-
Fuchs Y, Saxena A, Gamble HR, Anderson JD
(1989)
Ethylene biosynthesis-inducing protein from cellulysin is an endoxylanase.
Plant Physiol
89: 138-143
[Abstract/Free Full Text]
-
Giesbert S, Lepping HB, Tenberge KB, Tudzynski P
(1998)
The xylanolytic system of Claviceps purpurea: cytological evidence for secretion of xylanases in infected rey tissue and molecular characterization of two xylanase genes.
Phytopathology
88: 1020-1030
[Medline]
-
Gietz D, Jean AS, Woods RA, Schiestl RH
(1992)
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res
20: 1425
[Free Full Text]
-
Hanania U, Avni A
(1997)
High-affinity binding site for ethylene-inducing xylanase elicitor on Nicotiana tabacum membranes.
Plant J
12: 113-120
-
Henrissat B, Bairoch A
(1993)
New families in the classification of glycosyl hydrolases based on amino acid sequence similarities.
Biochem J
293: 781-788
-
Ko EP, Akatsuka H, Moriyama H, Shinmyo A, Hata Y, Katsube Y, Urabe I, Okada H
(1992)
Site-directed mutagenesis at aspartate and glutamate residues of xylanase from Bacillus pumilus.
Biochem J
288: 117-121
-
Krengel U, Dijkstra BW
(1996)
Three-dimensional structure of endo-1,4-
-xylanase I from Aspergillus niger: molecular basis for its low pH optimum.
J Mol Biol
263: 70-78
[CrossRef][Web of Science][Medline] -
La Grange DC, Pretorius IS, Van Zyl WH
(1996)
Expression of a Trichoderma reesei
-xylanase gene (XYN2) in Saccharomyces cerevisiae.
Appl Environ Microbiol
62: 1036-1044
[Abstract] -
Lotan T, Fluhr R
(1990)
Xylanase, a novel elicitor of pathogenesis-related proteins in tobacco, uses a non-ethylene pathway for induction.
Plant Physiol
93: 811-817
[Abstract/Free Full Text]
-
Luttig M, Pretorius IS, Van Zyl WH
(1997)
Cloning of two
-xylanase-encoding genes from Aspergillus niger and their expression in Saccharomyces cerevisiae.
Biotechnol Lett
19: 411-415
[CrossRef] -
Ryan CA
(1992)
The search for the proteinase-inhibitor inducing factor, PIIF.
Plant Mol Biol
19: 123-133
[CrossRef][Web of Science][Medline]
-
Saarelainen R, Paloheimo M, Fagerström R, Suominen PL, Navalainen KMH
(1993)
Cloning, sequencing and enhanced expression of the Trichoderma reesei endoxylanase II (pI 9) gene xln2.
Mol Gen Genet
241: 497-503
[CrossRef][Web of Science][Medline]
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Schweizer P, Felix G, Buchala A, Muller C, Métraux JP
(1996)
Perception of free cutin monomers by plant cells.
Plant J
10: 331-341
-
Sharon A, Fuchs Y, Anderson JD
(1993)
The elicitation of ethylene biosynthesis by a Trichoderma xylanase is not related to the cell wall degradation activity of the enzyme.
Plant Physiol
102: 1325-1329
[Abstract]
-
Törrönen A, Mach RL, Messner R, Gonzalez R, Kalkkinen N, Harkki A, Kubicek CP
(1992)
The two major xylanases from Trichoderma reesei: characterization of both enzymes and genes.
Bio-Technology
10: 1461-1465
[CrossRef][Medline]
-
Törrönen A, Rouvinen J
(1995)
Structural comparison of two major endo-1,4-xylanases from Trichoderma reesei.
Biochemistry
34: 847-856
[CrossRef][Medline]
-
Wakarchuk WW, Campbell RL, Sung WL, Da Voodi J, Yaguchi M
(1994)
Mutational and crystallographic analyses of the active site residues of the Bacillus circulans xylanase.
Protein Sci
3: 467-475
[Web of Science][Medline]
-
Walton JD
(1994)
Deconstructing the cell wall.
Plant Physiol
104: 1113-1118
[Web of Science][Medline]
-
Wong KKY, Saddler YN
(1992)
Trichoderma xylanases, their properties and application.
Crit Rev Biotechnol
12: 413-435
-
Wu SC, Kauffmann S, Darvill AG, Albersheim P
(1995)
Purification, cloning and characterization of two xylanases from Magnaporthe grisea, the rice blast fungus.
Mol Plant-Microbe Interact
8: 506-514
[Medline]
-
Yagouchi M, Roy C, Ujiie M, Watson DC, Wakarchuk W
(1992)
Amino acid sequence of the low-molecular-weight xylanase from Trichoderma viride.
In
J Visser, G Beldman, MA Kusters-van Someren, AGJ Voragen, eds, Xylans and Xylanases. Elsevier Science Publishers, Amsterdam, pp 149-154
-
Yano A, Suzuki K, Uchimiya H, Shinshi H
(1998)
Induction of hypersensitive cell death by a fungal protein in cultures of tobacco cells.
Mol Plant-Microbe Interact
11: 115-123
© 1999 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
N. Matarasso, S. Schuster, and A. Avni
A Novel Plant Cysteine Protease Has a Dual Function as a Regulator of 1-Aminocyclopropane-1-Carboxylic Acid Synthase Gene Expression
PLANT CELL,
April 1, 2005;
17(4):
1205 - 1216.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ron and A. Avni
The Receptor for the Fungal Elicitor Ethylene-Inducing Xylanase Is a Member of a Resistance-Like Gene Family in Tomato
PLANT CELL,
June 1, 2004;
16(6):
1604 - 1615.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tripathy, K. Kleppinger-Sparace, R. A. Dixon, and K. D. Chapman
N-Acylethanolamine Signaling in Tobacco Is Mediated by a Membrane-Associated, High-Affinity Binding Protein
Plant Physiology,
April 1, 2003;
131(4):
1781 - 1791.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Haruta and C. P. Constabel
Rapid Alkalinization Factors in Poplar Cell Cultures. Peptide Isolation, cDNA Cloning, and Differential Expression in Leaves and Methyl Jasmonate-Treated Cells
Plant Physiology,
February 1, 2003;
131(2):
814 - 823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Boudart, M. Charpentier, C. Lafitte, Y. Martinez, A. Jauneau, E. Gaulin, M.-T. Esquerre-Tugaye, and B. Dumas
Elicitor Activity of a Fungal Endopolygalacturonase in Tobacco Requires a Functional Catalytic Site and Cell Wall Localization
Plant Physiology,
January 1, 2003;
131(1):
93 - 101.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Martinez, F. Blanc, E. Le Claire, O. Besnard, M. Nicole, and J.-C. Baccou
Salicylic Acid and Ethylene Pathways Are Differentially Activated in Melon Cotyledons by Active or Heat-Denatured Cellulase from Trichoderma longibrachiatum
Plant Physiology,
September 1, 2001;
127(1):
334 - 344.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|