|
Plant Physiol, October 1999, Vol. 121, pp. 517-524
Rapid and Systemic Accumulation of Chloroplast mRNA-Binding
Protein Transcripts after Flame Stimulus in Tomato1
Alain
Vian,2*
Chantal
Henry-Vian, and
Eric
Davies
Department of Botany, Box 7612, North Carolina State University,
Raleigh, North Carolina 27695-7612
 |
ABSTRACT |
It has been shown
that tomato (Lycopersicon esculentum) plants respond to
flame wounding and electrical stimulation by a rapid (15 min) and
systemic up-regulation of proteinase inhibitor (pin) genes. To find other genes having a similar expression pattern, we used
subtractive cDNA screening between flamed and control plants to select
clones up-regulated by flame wounding. We report the characterization
of one of them, a chloroplast mRNA-binding protein encoded by a single
gene and expressed preferentially in the leaves. Systemic gene
expression in response to flaming in the youngest terminal leaf
exhibited three distinct phases: a rapid and transient increase (5-15
min) in transcript accumulation, a decline to basal levels (15-45
min), and then a second, more prolonged increase (60-90 min). In
contrast, after a mechanical wound the rapid, transient increase (5 min) was followed by a rapid decline to basal levels but no later,
prolonged accumulation. In the petiole, the initial flame-wound-evoked
transient increase (15 min) was followed by a continuous decline for
3 h. The nature of the wound signal(s) causing such rapid changes
in transcript abundance is discussed in relation to electrical
signaling, which has recently been implicated in plant responses to wounding.
 |
INTRODUCTION |
Plants respond to local, damaging stimuli by changes in gene
expression (Braam and Davis, 1990 ; Christensen et al., 1992 ; Henry-Vian
et al., 1995 ; Schaller and Ryan, 1996 ). These changes are
observed not only at the site of the stimulus, but also in distant,
intact organs (Peña-Cortés et al., 1995 ; Bergey et al.,
1996 ; Pastuglia et al., 1997 ; Vian et al., 1997 ; Bergey et al., 1999 ).
In tomato (Lycopersicon esculentum), such stimuli have
included insect chewing or mechanical wounding (Graham et al., 1986 )
and flaming or electrical stimulation (Stankovic and Davies, 1996 ), all
of which evoke the expression of the proteinase inhibitor
(pin) genes pin-1 and pin-2. These
pin genes have been used as very convenient molecular
markers of stress perception to study the transmission of wound signals
throughout the plant. Major candidates for the wound signal(s) include
various chemicals (hormones) that can evoke pin gene
expression (Pearce et al., 1991 ; Peña-Cortés et al., 1991 ;
Ryan and Farmer, 1991 ) and may be transmitted through the xylem (Malone
et al., 1994 ; Malone, 1996 ). However, since pin mRNA accumulation can
be detected in a distant leaf within 15 min after stimulation
(Stankovic and Davies, 1996 ), it seems unlikely that these compounds
produced at or near the wounded region could be the systemic signal
evoking such rapid changes in gene expression. This premise was our
starting point to explore alternative signaling pathways such as
electrical signals as potential candidates.
Wildon et al. (1992) used a flame stimulus to provide the first
evidence suggesting a link between pin expression and
electrical signals. However, more convincing data unequivocally linking
pin gene expression and electrical signals were provided by
Stankovic and Davies (1996) . These authors considered the two major
kinds of electrical events in plants to be the variation potential (VP) and the action potential (AP). The genesis and general characteristics of these electrical waves are different: an injurious stimulus such as
flaming evokes a VP, which results from a transmitted hydraulic signal
evoking local membrane depolarization (Malone and Stankovic, 1991 ),
while a noninjurious stimulus (DC pulse) triggers an AP, which is a
genuine (i.e. self-propagating) electrical signal (Stankovic and
Davies, 1996 ). Using stimuli selectively evoking an AP (electrical
stimulus) or a VP (flame), they observed systemic pin
transcript accumulation only when the recipient tissue exhibited a
membrane depolarization exceeding 40 mV (Stankovic and Davies, 1996 ,
1997 ). To date, fully convincing links between gene expression and
electrical events have been described only for pin genes,
although a strong correlation was found for calmodulin (Vian et al.,
1996 , 1997 ).
The main goal of this research was to isolate, identify, and
characterize additional genes whose expression is rapidly up-regulated after a distant flame-wound stimulus, thus implying the transmission of
a wound signal. We used subtractive screening between intact (control)
and flame-stimulated plants to isolate clones in distant tissue
accumulating shortly after treatment to furnish potential candidates
for electric signal-responsive genes. We used a flame wound, since we
showed previously that it evokes hydraulic signals and their
accompanying variation potentials in a highly reproducible manner
(Stankovic and Davies, 1996 ). Others have also used flaming as the
wound treatment of choice (Wildon et al., 1992 ). Here we report the
cloning of a cDNA corresponding to a systemically activated, rapidly
up-regulated, tissue-specific gene for chloroplast mRNA-binding protein
(CMBP), which should be added to the category of systemic wound
response proteins (SWRPs) (Bergey et al., 1996 , 1999 ). The array of
SWRPs that we are identifying will prove invaluable for our long-term
efforts to determine which local signals (e.g. ABA, systemin,
proteinase inhibitor-inducing factor) evoke the accumulation of
different transcripts.
 |
MATERIALS AND METHODS |
Plant Culture and Treatment
Tomato (Lycopersicon esculentum cv Heinz 1439 VF) seeds
were obtained from Stokes Seeds (Buffalo, New York) and grown in a standard substrate composed of gravel and Peat-Lite (developed at
Cornell University, Ithaca, NY) under controlled conditions (16 h/8 h
light/dark; 26°C/21°C, and 300 µmol s 1
m 2 PPFD) in the phytotron of North Carolina
State University. Three-week-old plants (about 12 cm in height with the
fourth leaf not fully expanded) were flamed for 2 s about 1 cm
from the third leaf using a butane lighter (the flame was set to about
1.5 cm in height). Various tissues, including the fourth leaf, the
petiole of the third leaf, the mature second leaf, and the internode,
were then harvested at different times after treatment and immediately
frozen in liquid nitrogen.
Nucleic Acid Isolation
Total RNA was isolated using Trizol reagent (Gibco-BRL,
Cleveland), separated on a formaldehyde denaturing gel, and transferred onto a nylon membrane (Nytran Plus, Schleicher & Schuell, Keene, NH).
Poly(A+) RNA was isolated from 3 mg of total RNA
using the PolyA-Tract system (Promega, Madison, WI).
Subtractive Screening
The subtraction was performed using a cDNA subtraction kit
(PCR-Select, CLONTECH Laboratories, Palo Alto, CA) as described by the
manufacturer, with minor modifications. Two micrograms of
poly(A+) RNA was isolated from the fourth leaf of
untreated control (driver) and 60 min-flamed (tester) plants and used
to make double-stranded, blunt-ended cDNA, which was then separately
digested (2.5 h at 37°C) with the 4-bp restriction enzyme
RsaI. One-half of the digested tester cDNA was ligated with
adaptor 1 and the other half with adaptor 2, while driver cDNA was not
subjected to adaptor ligation. Denatured adaptor 1- or 2-ligated tester
cDNA was then hybridized separately with an excess of denatured driver
cDNA (10 µL final volume) for 8 h at 68°C in a hybridization
oven. Then, while maintaining the incubation temperature at 68°C, the
two hybridization reactions were mixed together, along with freshly
denatured driver cDNA, and incubated at 68°C for 24 h. During
this incubation, the flame-specific sequences formed new hybrid
molecules with different adapters (1 and 2) on each end, while common
sequences formed hybrids having only adaptor 1, adaptor 2, or no
adaptor at their ends.
The hybridization product was then diluted to 200 µL with dilution
buffer (20 mM HEPES/HCl [pH 8.3], 50 mM NaCl,
and 0.2 mM EDTA), and 1 µL was subjected to PCR
amplification in a mini-cycler (model PTC-150, MJ Research, Waltham,
MA) using a PCR mix (Advantage Klentaq, CLONTECH Laboratories). This
method ensures an automatic hot-start PCR and a low error rate during
amplification. Thus, only the flame-specific sequences were amplified
exponentially, while others were subjected to linear or no
amplification. The first PCR amplification (30 cycles) was performed
using the P1 and P2 primers complementary to adapters A1 and A2, the
PCR reaction was diluted 30-fold, and an aliquot (1 µL) of this
reaction was subjected to another amplification using nested PCR
primers. The PCR products were then purified on a PCR-cleaning column
(Qiagen, Valencia, CA) and quantified. Twenty nanograms were ligated
into the T/A vector pT-7 Blue (Novagen, Madison, WI) for 2 h at
room temperature using T4 DNA ligase (Gibco-BRL). After enzyme
denaturation (10 min at 65°C), 2 µL of the reaction was used to
transform the competent bacteria ElectroMax DH10B using a cell porator
(Gibco-BRL).
Northern and Southern Blots
Fifty nanograms of cDNA probe were labeled using a kit
(Ready-to-Go DNA, Pharmacia Biotech, Piscataway, NJ) with 50 µCi of [ -32P]dCTP (ICN, Costa Mesa, CA), purified
on a mini column (Tip-5, Qiagen), and heat denatured. Hybridization was
performed in a hybridization oven as described by Sambrook et al.
(1989) at 42°C in 12 mL of hybridization buffer (6× SSPE, 50%
[v/v] formamide, 5× Denhardt's solution, 0.5% [w/v] SDS,
and 100 µg mL 1 denatured herring-sperm DNA).
The washes (stringencies as indicated in the text) were performed with
SSPE buffer containing 0.1% (w/v) SDS.
Sequencing and RACE-PCR Amplifications
The B1-20 cDNA clone was sequenced using the University of
Nebraska sequencing facilities and homology searched in GenBank using
BLASTX. The coding region (521 bp) was incomplete at both the 3' and 5'
ends. The primers B1-20S (CGGTTGGCGTAATTGGGGCTGGTCG) and B1-20AS
(CCTCCAGGAGGTTCTCCGACTACA) were designed for both 3' and 5' RACE-PCR,
and the amplifications were performed with a cDNA amplification kit
(Marathon, CLONTECH Laboratories). All of the procedures were carried
out as described by the manufacturer, except the PCR programs, which
were adapted to our PCR mini-cycler. The cDNA was made from 1 µg of
poly(A+) RNA isolated from plants flamed for 60 min. The amplified products were then cloned in pGEM-T and p-GEM-T Easy
(Promega) and sequenced. Three sets of clones were separately made and
sequenced to avoid possible sequence errors due to PCR amplifications.
 |
RESULTS |
Plant Model Description
Figure 1 shows the tomato plant
model used for these experiments. The plants were stimulated on the
third leaf (Fig. 1, leaf 3), and responses were studied in distant
tissues (Fig. 1, black arrows). To determine the array of genes
up-regulated by flame wounding, we harvested the fourth leaf (Fig. 1,
leaf 4) from plants stimulated 60 min earlier on the third leaf to
yield the tester cDNA, and this was used to generate a subtractive
library against the cDNA (driver) from the fourth leaf of control
(non-flamed) plants. We first evaluated the efficiency of the
subtraction by monitoring its enrichment in calmodulin cDNA, which is
rapidly induced to a high level by flame wound treatment in tomato
(Stankovic and Davies, 1996 ). We found this cDNA to be much more
abundant (about 6.5-fold) in the subtracted cDNA (data not shown).
Assuming that calmodulin cDNA is representative, this suggests that the subtractive library is a useful source for up-regulated clones.

View larger version (11K):
[in this window]
[in a new window]
|
Figure 1.
Schematic drawing showing the stimulation
treatment. Three-week-old plants (12 cm in height) were used for all
experiments. Stimulations were made on leaf 3 by flaming for 2 s
with a gas lighter. The effects of this treatment were analyzed in
intact, distant tissues (black arrows), including the petiole of the
third leaf, the underlying internode, the terminal leaf (leaf 4), and
the mature leaf (leaf 2).
|
|
B1-20 Cloning
We then prepared the cDNA from subtracted clones and made two sets
of identical dot-blot membranes to perform a differential screen. The
clone B1-20 was selected after this test because it displayed an
intense hybridization signal only on the membrane hybridized with the
cDNA flamed for 60 min (data not shown). Sequence analysis of the B1-20
insert showed high homology with the spinach CMBP (Yang et al., 1996 )
and also revealed that the cDNA was incomplete: sequences were missing
from both the 3' and 5' ends. To obtain the full-length clone, RACE-PCR
amplifications were performed and a single band was generated by each
PCR amplification. Sequencing confirmed that the four gene-specific
primers designed for the RACE-PCR amplified the expected fragments.
Three sets of clones were independently produced and sequenced to avoid
possible errors due to PCR amplification.
Gene Sequence Analysis
The 3'-, 5'-, and full-length RACE products were sequenced on both
strands and the corresponding cDNA was identified as a CMBP. Figure
2 shows the complete deduced amino acid
sequence for the tomato CMBP and its comparison with a previously
cloned CMBP from spinach (Yang et al., 1996 ). The complete cDNA
sequence, including a poly(A+) tail, is available
in GenBank under the accession no. AF106660. The encoded protein has a
calculated molecular mass of 36.2 kD and a pI of 5.88. The sequence
also displayed a putative chloroplast transit peptide (data not shown)
upstream of the coding region.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 2.
Sequence of clone B1-20. The predicted amino acid
sequence of tomato is compared with spinach CMBP (Yang et al., 1996 ).
The tomato CMBP shows an additional terminal amino acid (Ala). An
incomplete chloroplast transit signal showing analogies with the
spinach counterpart was also identified (data not shown). The complete
cDNA sequence is available in GenBank under the accession no.
AF106660.
|
|
The homology of the tomato CMBP to the spinach clone (Yang et al.,
1996 ) is high (84% identity), while the tomato protein has an
additional Ala residue at the end (Fig. 2). The corresponding gene was
found to be encoded by a unique gene in tomato (data not shown), as was
also found for spinach (Yang et al., 1996 ). This result is consistent
with the fact that the RACE-PCR amplifications always generated a
single band (data not shown).
Accumulation of CMBP mRNA after Flaming
RNA was isolated from various tissues of control plants or plants
flamed for 60 min (Fig. 1), blotted, and the membranes probed with the
B1-20 cDNA; results are shown in Figure
3. The initial level of the CMBP
transcript was always low in all of the control tissues, but
particularly in the petiole (Fig. 3, lane 1) and internode (Fig. 3,
lane 5), and was somewhat higher in the mature leaf (Fig. 3, lane 3).
Flame treatment, however, led to a consistent 2-fold accumulation of
CMBP only in the mature leaf (Fig. 3, lane 4). In the other tissues
tested, flame treatment had no significant effects (Fig. 3, lanes 1 and
2 and 5 and 6).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 3.
Accumulation of CMBP mRNA in various tissues. RNA
was isolated from the petiole of the third (stimulated) leaf (lanes 1 and 2), the mature second leaf (lanes 3 and 4) or the internode (lanes
5 and 6). The plants were either non-stimulated controls (lanes 1, 3, and 5) or plants flamed on the third leaf for 60 min (lanes 2, 4, and
6), which corresponds to the time after flaming chosen for the tester
condition in the subtraction procedure. B1-20, Hybridization using
B1-20 cDNA as a probe. 18S, Control for equal loading of RNA (5 µg)
in each lane using an 18S probe. Treatment values (black bars) are
expressed relative to their respective controls (100%, white bars).
Each point is the average of five replicates ± SE.
|
|
We then analyzed changes in CMBP transcript in a young, actively
growing terminal leaf (leaf 4), the tissue used for previous work on
pin-1 and pin-2 gene expression (Stankovic and
Davies, 1996 , 1997 ). Changes in the abundance of CMBP transcripts in
the terminal leaf were complex. The initial level was extremely low (Fig. 4, lane 1), lower than that
observed in the mature leaf (Fig. 3, lane 3), but flame wounding caused
an extremely rapid accumulation of CMBP transcript. Within 5 min after
flaming the third leaf, the transcript level increased 2.8-fold (Fig.
4, lane 2) and reached a maximum of about 4-fold after 15 min (Fig. 4, lane 3). This initial period of accumulation (phase I) was followed immediately by a period of decline (phase II), such that by 30 min
(Fig. 4, lane 4) the transcript level had returned to that observed in
control plants. A second, limited accumulation (phase III) occurred
between 60 and 90 min (Fig. 4, lanes 5 and 6), while after 3 h
(Fig. 4, lane 7) the level had once more returned to that observed in
control plants.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 4.
Kinetics of accumulation of CMBP mRNA in the
fourth (terminal) leaf after flaming the third leaf. RNA was isolated
from the fourth terminal leaf of control plants (lane 1), or 5, 15, 30, 60, 90, and 180 min after flaming the third leaf (lanes 2-7). B1-20,
Hybridization using B1-20 cDNA as a probe. 18S, Control for equal
loading of RNA (5 µg) in each lane using an 18S probe. Treatment
values (black bars) are expressed relative to the control (100%, white
bar). Each point is the average of six replicates ± SE.
|
|
Since these plants were grown in a phytotron at a relatively high light
flux (300 µmol s 1 m 2)
and since CMBP is a chloroplast protein, we wanted to find out if
transcript accumulation also occurred when plants were stimulated in
darkness. Plants were transferred from the phytotron to the dark for
24 h before flame wounding of leaf 3, and the RNA in leaf 4 was
analyzed. The initial level was similar between plants grown in high
light (Fig. 5, lane 1) and those grown in
darkness for 24 h (Fig. 5, lane 2). However, in plants kept for
24 h in the dark, flame treatment did not cause any significant
change in CMBP transcript level 15, 30, or 60 min after flaming (Fig. 5, lanes 3-5).

View larger version (36K):
[in this window]
[in a new window]
|
Figure 5.
Accumulation of CMBP mRNA after flaming plants in
the dark. RNA was isolated from the fourth terminal leaf of unflamed
plants subjected to normal light culture conditions (lane 1), from
plants placed in the dark for 24 h and harvested without prior
treatment (lane 2), or 15, 30, and 60 min after flaming the third leaf
(lanes 3-5). B1-20, Hybridization using B1-20 cDNA as a probe. 18S,
Control for equal loading of RNA (5 µg) in each lane using an 18S
probe. Treatment values (black bars) and the dark control (gray bar)
are expressed relative to the light control (100%, white bar). Each
point is the average of four replicates ± SE.
|
|
Since the wound signal must pass through the petiole of the treated
leaf (leaf 3), we decided to analyze the kinetics of CMBP transcript
accumulation in this petiole (Fig. 6).
The treatment caused a slight (not significant) increase in CMBP
transcript 15 min after treatment (Fig. 6, lane 2), followed by an
immediate decline in transcript abundance at 30 and 90 min (Fig. 6,
lanes 3-5), which continued until 3 h (Fig. 6, lane 5), by which
time it was only about one-third of that observed in the control
plants.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 6.
Kinetics of accumulation of CMBP mRNA in the
petiole of the third leaf after flaming the third leaf. RNA was
isolated from the petiole of the third leaf of control plants (lane 1)
15, 30, 60, and 180 min after flaming (lanes 2-5). B1-20,
Hybridization using B1-20 cDNA as a probe. 18S, Control for equal
loading of RNA (5 µg) in each lane using an 18S probe. Treatment
values (black bars) are expressed relative to the control (100%, white
bar). Each point is the average of five replicates ± SE.
|
|
We were interested in finding out if this response was specific to
flame wounding or if a mechanical wound would evoke the same response.
Therefore, plants were crushed with metal forceps on leaf 3 and mRNA
was isolated from leaf 4. The pattern observed was quite different from
that obtained with the flame stimulus (Fig. 4). After mechanical
wounding, a sharp and extremely transient accumulation of CMBP
transcript occurred after 5 min (Fig. 7, lane 2), but thereafter (15 min-6 h: Fig. 7, lanes 2-7) dropped to
the level in control plants (Fig. 7, lane 1).

View larger version (36K):
[in this window]
[in a new window]
|
Figure 7.
Kinetics of accumulation of CMBP mRNA in the
fourth terminal leaf after mechanical wounding of the third leaf. RNA
was isolated from the fourth terminal leaf of intact, non-stimulated
plants (lane 1) or after mechanical wounding (crushing the third leaf
with metal forceps). Tissue was harvested 5, 15, 30, and 60 min and 2 and 6 h after the treatment (lanes 2-7, respectively). B1-20,
Hybridization using B1-20 cDNA as a probe. 18S, Control for equal
loading of RNA (5 µg) in each lane using an 18S probe. Treatment
values (black bars) are expressed relative to the control (100%, white
bar). Each point is the average of five replicates ± SE.
|
|
 |
DISCUSSION |
Since the pioneering work of Ryan and co-workers (Ryan, 1974 ; Lee
et al., 1986 ), the tomato plant has been a model system for studying
wound-regulated systemic gene expression. However, much of this work
has focused on a limited number of transcripts, primarily pin, which
are involved in plant responses to insect feeding (Johnson et al.,
1989 ) and calmodulin (Stankovic and Davies, 1997 ), although work has
been extended recently into SWRPs as well (Bergey et al., 1996 , 1999 ).
Several different systemic signals have been advocated, including
hormones such as proteinase inhibitor-inducing factor (Ryan, 1974 ),
systemin (Pearce et al., 1991 ), ABA (Peña-Cortés et al.,
1991 ), and oligosaccharides (Ryan and Farmer, 1991 ), the genuine
electrical signal or AP, and the hydraulic signal with its electrical
aftermath, the VP. It is therefore quite possible that different
systemic signals regulate the expression of different genes.
Accordingly, the main goal of this work was to begin characterizing the
array of genes up-regulated by wounding in order to determine which
systemic and which local signals regulate which gene(s).
To identify novel up-regulated genes, we chose to use a subtractive
cloning strategy (Bonaldo et al., 1996 ), which has become a relatively
easy technique since a commercial kit became available (CLONTECH
Laboratories). We also used this technique to avoid possible artificial
selection of particular transcripts, such as those introduced by PCR
cloning with primers designed from existing genes or the screening of a
library with a previously cloned cDNA probes. We found the new two-step
PCR-based protocol to be a major simplification over the existing
subtraction methods. We effectively selected stress-related sequences,
and additional screening steps (i.e. differential screening of
subtraction-selected clones) were unnecessary since virtually all of
the randomly selected subtractive clones displayed positive
differential expression (data not shown).
The current study focused on one of these clones, B1-20, which was
identified as a CMBP based on results from the clone recently isolated
from spinach (Yang et al., 1996 ). As a consequence of the
RsaI digestion step in the subtraction procedure, B1-20
lacks some of both the 5' and 3' ends. RACE-PCR successfully amplified these ends, and analyzed the complete sequence using a multiple set of
clones obtained from independent cloning/sequencing events (Fig. 2).
The tomato CMBP displayed a high degree of homology (Fig. 2) with its
spinach counterpart (84%). The CMBP is present in only one copy in the
tomato genome (data not shown), as was found previously in spinach
(Yang et al., 1996 ). This result is consistent with the RACE-PCR
amplifications that always gave a single band (data not shown).
CMBP transcripts were low in all non-stimulated tissues, but they
increased in all tissue after flame wounding, with a larger accumulation in the mature leaf than in the petiole or internode (Fig.
3). It seems reasonable that a chloroplast-related transcript would
accumulate more in photosynthetically active tissues such as the leaves
and less in tissues low in chloroplasts (e.g. the petiole or
internode). It was surprising that the steady-state level was so low in
an actively growing, photosynthetically active tissue such as the
terminal leaf (Fig. 4). This may be because the protein has either a
high catalytic activity or a limited substrate specificity, since its
major or sole function is in maturation of the petD pre-mRNA (Yang et
al., 1996 ), and it may only be needed at a low level.
After flaming the third leaf, the kinetics of CMBP transcript
accumulation in the terminal leaf (leaf 4) were quite complex and
occurred in three distinct phases (Fig. 4). Phase I involved extremely
rapid and major transcript accumulation. Within just 5 min, the CMBP
transcript accumulated over 2-fold above control levels and had reached
4.5-fold by 15 min. This demonstrates that the wound signal must have
been transmitted from the third leaf to the terminal leaf within 5 min.
It also suggests (but does not prove) that enhanced transcription,
rather than lessened degradation, was responsible for this rapid
accumulation. Phase II involved a decline of CMBP transcript levels
back to control levels between 15 and 30 min. Considering that almost
all of the newly accumulated transcript disappeared as quickly as it
had been made, an active degradation process is likely to be involved.
Phase III involved another period of transcript accumulation between 60 and 90 min after flaming, but this was much smaller than the initial
accumulation. This triphasic pattern has already been observed (with
much slower kinetics) for the mRNA-binding protein rbpA3 in the
cyanobacterium Anabaena variabilis (Sato and Maruyama,
1997 ). These authors showed that after a temperature shift from 38°C
to 22°C, the amount of rbpA3 transcript peaked after 30 min, returned
to control levels after 2 h, and then exhibited a second and
weaker peak after 5 h. Despite the lack of sequence homology
between the tomato CMBP and rbpA3, the similarity between these
patterns is quite striking, although the response was far more rapid in
tomato. The faster response may have been due to the treatment, which
was much more drastic in tomato (flame) than the temperature shift of
A. variabilis.
Since xylem tension is lost after plants are kept for a long time in
the dark, and plants therefore lose their ability to generate hydraulic
signals and the accompanying variation potentials (Stankovic and
Davies, 1997 ), we wondered whether transcript accumulation would occur
in plants that had been placed in the dark 24 h before the flame
treatment. Accumulation of CMBP transcript did not take place (Fig. 5),
implying (but not proving) that the hydraulic signal is involved.
However, since expression of some wound-regulated genes such as
pin is dependent on Suc (Johnson and Ryan, 1990 ), the signal
may be generated/transmitted, but no response can ensue in the absence
of sugar, which is likely to be low after 24 h in the dark.
Since transcript accumulation begins within 5 min in tissue 4 to 5 cm
away from the wounded region, the wound signal must be generated and
transmitted extremely rapidly. Although we have not totally ruled out
this possibility, it seems unlikely that a chemical (hormone) could
move from the damaged tissues to the terminal leaf in the phloem
sufficiently rapidly to turn on the gene. It is possible, however, that
hormones could be transported in the xylem and somehow liberated into
the adjacent living cells (Malone et al., 1994 ; Malone, 1996 ).
Alternative signaling pathways involving electrical signals have
recently been proposed (Wildon et al., 1992 ; Stankovic and Davies,
1996 , 1997 , 1998a , 1998b ; Vian et al., 1996 ). Stankovic and Davies
(1996 , 1997 ) demonstrated that the systemic signal evoking a rapid (30 min) and massive (7- to 10-fold) accumulation of pin mRNA is an
electrical wave of depolarization, an AP induced by electrical
stimulation, or a VP induced by flame stimulus.
These signals would be good candidates for rapid transmission of the
wound information from damaged tissues to intact, distant tissues,
since their velocity ranges from about 0.8 to 4 cm
s 1 for the AP (Sibaoka, 1950 ) and 0.6 to 1 mm
s 1 for the VP (Van Sambeeck and Pickard, 1976 ;
Julien et al., 1991 ; Zawadzki et al., 1991 ). These velocities
are far higher than those generally proposed for the diffusion of a
chemical (i.e. hormonal) signal. We do not yet have data unequivocally
linking membrane depolarization with evocation of CMBP mRNA
accumulation. However, since such correlations have been demonstrated
for ethylene production (Inaba et al., 1995 ) and for other genes such
as pin (Wildon et al., 1992 ; Stankovic and Davies, 1996 ,
1997 ) and calmodulin (Vian et al., 1996 ), such a signaling system may
in reality play an important role in the expression of several genes.
Mechanical wounding (crushing with forceps) leads to a different
response from that induced by flame wounding. As with flame wounding
(Fig. 4), both the rapid increase (phase I) and the rapid return to
control levels (phase II) are seen after crushing (Fig. 7), but no
subsequent accumulation (phase III) occurs. This suggests that the two
periods of accumulation are under the control of different signals and
we suspect that the later increase is more likely controlled by
hormones than the initial, rapid increase.
We have shown that the subtractive screen furnishes at least one novel
clone rapidly up-regulated in distant, intact tissues after flaming or
mechanical wounding. Since there are major questions concerning the
nature of the systemic wound signal(s), we are in the process of
isolating additional wound-up-regulated clones. We intend to use these
to find out whether the same systemic signal is involved in their
regulation, or if different signals regulate different genes. In this
context, experiments are in progress to determine if CMBP gene
expression can be coupled to membrane potential, thus demonstrating
that a large array of wound-related genes are evoked by a signal in
which changes in membrane potential constitute a major role.
 |
ACKNOWLEDGMENTS |
The authors wish to thank Drs. Ronald Sederoff and Ross Whetten
(Department of Forestry, North Carolina State University) for providing
laboratory space for 6 months and discussing the subtraction strategy,
and Dr. Bratislav Stankovic for critically reading the manuscript. The
18S cDNA probe was a generous gift of Dr. J. Osterman (University of
Nebraska, Lincoln). Sequencing was performed at the University of
Nebraska sequencing facility, and plants were grown in the North
Carolina State Univeristy phytotron. The authors respectfully dedicate
this work to the memory of Dr. Marie-Odile Desbiez (1941-1995).
 |
FOOTNOTES |
Received March 12, 1999; accepted June 28, 1999.
1
This work was supported by the North Carolina
Agricultural Research Service (project no. 06446) and by the National
Aeronautic and Space Agency (grant no. 547-574).
2
Present address: Unité Associée
Université Blaise Pascal-Institut National de la Recherche
Agronomique, Organisation et Variabilité des Génomes
Végétaux, Campus Universitaire des Cézaux, 24 Avenue
des Landais, 63177 Aubiere cedex, France.
*
Corresponding author; e-mail vian{at}cicsun.univ-bpclermont.fr;
fax 33-473-407-914.
 |
LITERATURE CITED |
-
Bergey DR, Howe GA, Ryan CA
(1996)
Polypeptide signaling for plant defensive genes exhibits analogies to defense signaling in animals.
Proc Natl Acad Sci USA
93: 12053-12058
[Abstract/Free Full Text]
-
Bergey DR, Orozco-Cardenas M, Ryan CA
(1999)
A wound- and systemin-inducible polygalacturonase in tomato leaves.
Proc Natl Acad Sci USA
96: 1756-1760
[Abstract/Free Full Text]
-
Bonaldo M de F, Lennon G, Soares MB
(1996)
Normalization and subtraction: two approaches to facilitate gene discovery.
Genome Res
6: 791-806
[Abstract/Free Full Text]
-
Braam J, Davis R W
(1990)
Rain-, wind-, and touch-induced expression of calmodulin and calmodulin related genes in Arabidopsis.
Cell
60: 357-364
[CrossRef][Web of Science][Medline]
-
Christensen AH, Sharrok RA, Quail PH
(1992)
Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation.
Plant Mol Biol
18: 675-689
[CrossRef][Web of Science][Medline]
-
Graham JS, Hall G, Pearce G, Ryan CA
(1986)
Regulation of synthesis of proteinase inhibitor I and II mRNAs in leaves of wounded tomato plants.
Planta
169: 399-405
[CrossRef][Web of Science]
-
Henry-Vian C, Vian A, Davies E, Ledoigt G, Desbiez MO
(1995)
Wounding regulates polysomal incorporation of hsp70 and tch1 transcripts during signal storage and retrieval.
Physiol Plant
95: 387-392
[CrossRef]
-
Inaba A, Manabe T, Tsuji H, Iwamoto T
(1995)
Electrical impedance analysis of tissues properties associated with ethylene production by electric current in cucumber (Cucumis sativus L.) fruit.
Plant Physiol
107: 199-205
[Abstract]
-
Johnson R, Narvaez J, An G, Ryan C
(1989)
Expression of proteinase inhibitor I and II in transgenic tobacco plants: effects on natural defense against Manduca sexta larvae.
Proc Natl Acad Sci USA
86: 9871-9875
[Abstract/Free Full Text]
-
Johnson R, Ryan CA
(1990)
Wound-inducible potato inhibitor II genes: enhancement of expression by sucrose.
Plant Mol Biol
14: 527-536
[CrossRef][Web of Science][Medline]
-
Julien JL, Desbiez MO, De Jaegher G, Frachisse JM
(1991)
Characteristics of the wave of depolarization induced by wounding in Bidens pilosa L.
J Exp Bot
42: 131-137
[Abstract/Free Full Text]
-
Lee JS, Brown WE, Graham JS, Pearce G, Fox EA, Dreher TW, Ahern KG, Pearson GD, Ryan CA
(1986)
Molecular characterization and phylogenetic studies of a wound-inducible proteinase inhibitor I gene in Lycopersicon species.
Proc Natl Acad Sci USA
83: 7277-7281
[Abstract/Free Full Text]
-
Malone M
(1996)
Rapid, long-distance signal transmission in higher plants.
Adv Bot Res
22: 163-228
-
Malone M, Alarcon JJ, Palumbo L
(1994)
An hydraulic interpretation of rapid, long-distance wound signaling in tomato.
Planta
193: 181-185
-
Malone M, Stankovic B
(1991)
Surface potential and hydraulic signals in wheat leaves following localized wounding by heat.
Plant Cell Environ
14: 431-436
[CrossRef]
-
Pastuglia M, Roby D, Dumas C, Cock M
(1997)
Rapid induction by wounding and bacterial infection of an S gene family receptor-like kinase gene in Brassica oleracea.
Plant Cell
9: 49-60
[Abstract]
-
Pearce G, Strydom D, Johnson S, Ryan CA
(1991)
A polypeptide from tomato leaves induces wound-inducible proteinase inhibitor proteins.
Science
253: 895-898
[Abstract/Free Full Text]
-
Peña-Cortés H, Fisahn J, Wilmitzer L
(1995)
Signals involved in wound-induced proteinase inhibitor II gene expression in tomato and potato plants.
Proc Natl Acad Sci USA
92: 4106-4113
[Abstract/Free Full Text]
-
Peña-Cortés H, Wilmitzer L, Sanchez-Serrano J
(1991)
Abscisic acid mediates wound induction but not developmental-specific expression of the proteinase inhibitor II gene family.
Plant Cell
3: 963-972
[Abstract/Free Full Text]
-
Ryan CA
(1974)
Assay and biochemical properties of the proteinase inhibitor inducing factor, a wound hormone.
Plant Physiol
54: 328-332
[Abstract/Free Full Text]
-
Ryan CA, Farmer EE
(1991)
Oligosaccharide signals in plants: a current assessment.
Annu Rev Plant Physiol Plant Mol Biol
42: 651-674
[CrossRef][Web of Science]
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Sato N, Maruyama K
(1997)
Differential regulation by low temperature of the gene for an RNA-binding protein, rbpA3, in the cyanobacterium Anabaena variabilis strain M3.
Plant Cell Physiol
38: 81-86
[Abstract/Free Full Text]
-
Schaller A, Ryan CA
(1996)
Molecular cloning of a tomato leaf cDNA encoding an aspartic protease, a systemic wound response protein.
Plant Mol Biol
31: 1073-1077
[CrossRef][Web of Science][Medline]
-
Sibaoka T
(1950)
Nature of the conduction in the petiole of Mimosa pudica.
Sci Rep Tohoku Univ Fourth Ser
18: 370-376
-
Stankovic B, Davies E
(1996)
Both action potentials and variation potentials induce proteinase inhibitor gene expression in tomato.
FEBS Lett
390: 275-279
[CrossRef][Web of Science][Medline]
-
Stankovic B, Davies E
(1997)
Intracellular communication in plants: electrical stimulation of proteinase inhibitor gene expression in tomato.
Planta
202: 402-406
[CrossRef][Web of Science]
-
Stankovic B, Davies E
(1998a)
The wound response in tomato leaves involves rapid growth and electrical responses, systemically up-regulated transcription of proteinase inhibitor and calmodulin and down-regulated transcription.
Plant Cell Physiol
39: 268-274
[Abstract/Free Full Text]
-
Stankovic B, Davies E
(1998b)
Characterization of the variation potential in sunflower.
Plant Physiol
115: 1083-1088
[Abstract]
-
Van Sambeeck JW, Pickard BG
(1976)
Mediation of rapid electrical, metabolic, transpirational and photosynthetic changes by factors released from wounds. I. Variation potentials and putative action potentials in intact plants.
Can J Bot
54: 2642-2650
-
Vian A, Henry-Vian C, Schantz R, Ledoigt G, Frachisse JM, Desbiez MO, Julien JL
(1996)
Is membrane potential involved in calmodulin gene expression after external stimulation in plants?
FEBS Lett
380: 93-96
[CrossRef][Web of Science][Medline]
-
Vian A, Henry-Vian C, Schantz R, Schantz ML, Davies E, Ledoigt G, Desbiez MO
(1997)
Effect of calcium and calcium counteracting drugs on the response of Bidens pilosa L. to wounding.
Plant Cell Physiol
38: 751-753
[Abstract/Free Full Text]
-
Wildon DC, Thain JF, Minchin PEH, Gubb IR, Reilly AJ, Skipper YD, Doherty HM, O'Donnell PJ, Bowles DJ
(1992)
Electrical signaling and systemic proteinase inhibitor induction in the wounded plant.
Nature
360: 62-65
[CrossRef]
-
Yang S, Schuster G, Stern DB
(1996)
CSP-41, a sequence specific chloroplast mRNA binding protein, is an endoribonuclease.
Plant Cell
8: 1409-1420
[Abstract]
-
Zawadzki T, Davies E, Dziubinska H, Trebacz K
(1991)
Characteristics of action potentials in Helianthus annuus.
Physiol Plant
83: 601-604
[CrossRef]
© 1999 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
S. Lautner, T. E. E. Grams, R. Matyssek, and J. Fromm
Characteristics of Electrical Signals in Poplar and Responses in Photosynthesis
Plant Physiology,
August 1, 2005;
138(4):
2200 - 2209.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Yamaguchi, M. V. Beligni, S. Prieto, P. A. Haynes, W. H. McDonald, J. R. Yates III, and S. P. Mayfield
Proteomic Characterization of the Chlamydomonas reinhardtii Chloroplast Ribosome: IDENTIFICATION OF PROTEINS UNIQUE TO THE 70 S RIBOSOME
J. Biol. Chem.,
September 5, 2003;
278(36):
33774 - 33785.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Coker and E. Davies
Correspondence re: A. H. Ree et al., Expression of a Novel Factor in Human Breast Cancer Cells with Metastatic Potential. Cancer Res., 59: 4675-4680, 1999
Cancer Res.,
July 15, 2002;
62(14):
4164 - 4165.
[Full Text]
[PDF]
|
 |
|
|
|