|
Plant Physiol, October 1999, Vol. 121, pp. 579-588
Directed Mutation of the Rubisco Large Subunit of Tobacco
Influences Photorespiration and Growth1
Spencer M.
Whitney,
Susanne
von Caemmerer,
Graham S.
Hudson,2 and
T. John
Andrews*
Molecular Plant Physiology, Research School of Biological Sciences,
Australian National University, P.O. Box 475, Canberra, Australian
Capital Territory 2601, Australia
 |
ABSTRACT |
The gene for the large subunit of
Rubisco was specifically mutated by transforming the chloroplast genome
of tobacco (Nicotiana tabacum). Codon 335 was altered to
encode valine instead of leucine. The resulting mutant plants could not
grow without atmospheric CO2 enrichment. In 0.3% (v/v)
CO2, the mutant and wild-type plants produced similar
amounts of Rubisco but the extent of carbamylation was nearly twice as
great in the mutants. The mutant enzyme's substrate-saturated
CO2-fixing rate and its ability to distinguish between
CO2 and O2 as substrates were both reduced to
25% of the wild type's values. Estimates of these parameters obtained
from kinetic assays with the purified mutant enzyme were the same as those inferred from measurements of photosynthetic gas exchange with
leaves of mutant plants. The Michaelis constants for CO2, O2, and ribulose-1,5-bisphosphate were reduced and the
mutation enhanced oxygenase activity at limiting O2
concentrations. Consistent with the reduced CO2 fixation
rate at saturating CO2, the mutant plants grew slower than
the wild type but they eventually flowered and reproduced apparently
normally. The mutation and its associated phenotype were inherited
maternally. The chloroplast-transformation strategy surmounts previous
obstacles to mutagenesis of higher-plant Rubisco and allows the
consequences for leaf photosynthesis to be assessed.
 |
INTRODUCTION |
Study of Rubisco in higher plants and its dual role in
photosynthesis and photorespiration has been hampered by inability to
fold and/or assemble the higher-plant enzyme correctly in bacterial hosts. No eukaryotic Rubisco has been expressed successfully in any
foreign host, perhaps because of mismatches between the foreign Rubisco
and the host's chaperone system (for reviews, see Gutteridge and
Gatenby, 1995 ; Roy and Andrews, 1999 ). This has restricted mutagenic
analysis of the structure and function of eukaryotic Rubisco to the
green alga Chlamydomonas reinhardtii, where well-developed methods exist for mutagenesis and transformation of the chloroplast genome, which encodes Rubisco's large, catalytic subunit (for review,
see Spreitzer, 1998 ). However, some aspects of Rubisco function cannot
readily be studied in vivo in an alga. For example, Rubisco's
oxygenation reaction and its photorespiratory consequences are
suppressed in C. reinhardtii and most other algae by a
mechanism that concentrates CO2 at the site of
Rubisco (for reviews, see Husic et al., 1987 ; Spreitzer, 1993 ).
Development of a method for transforming the chloroplast genome of
tobacco (Svab and Maliga, 1993 ) provides a means for circumventing these frustrations and presents an opportunity for testing of the
wealth of information that exists about Rubisco's structure and
function (Schreuder et al., 1993 ; Hartman and Harpel, 1994 ; Andersson,
1996 ) within the context of a whole plant. This method has been used to
delete the rbcL gene for the Rubisco large subunit from the
chloroplast genome, allowing demonstration that its function could be
replaced to some extent by introduction to the nucleus of a copy fused
to a sequence encoding a chloroplast transit peptide (Kanevski and
Maliga, 1994 ). It has also been used to replace the tobacco
rbcL gene with the analogous genes from sunflower and the
cyanobacterium Synechococcus PCC6301. However, the resultant Rubiscos (hybrids composed of introduced large subunits and tobacco small subunits) were either not formed (Synechococcus) or
too disabled to support photoautotrophic growth (sunflower) (Kanevski et al., 1999 ). The precise homologous replacement inherent in the
transformation mechanism should also facilitate site-specific mutagenesis of the rbcL gene with the bonus that the
consequences of the alteration can be assessed not only in vitro, by
studying the properties of the mutant protein after isolation, but also in vivo, by measurement of photosynthetic gas exchange by leaves of the
mutant plants.
As a first attempt to demonstrate the feasibility of this approach, we
aimed to induce an alteration in Rubisco's catalytic properties that
would be readily apparent in the leaf's
CO2-exchange properties without debilitating the
enzyme to such an extent that it would be unable to support the growth
of the plant. To achieve this result, we sought a mutation that would
impair Rubisco's ability to distinguish between
CO2 and O2 (expected to
cause an increase in the leaf's CO2-compensation
point) without seriously compromising the
CO2-saturated rate of carboxylation.
CO2 enrichment would largely compensate for such
a defect, allowing the mutant plants to photosynthesize and grow.
Guided by crystallographic structural information (Schreuder et al.,
1993 ; Andersson, 1996 ) and previous mutagenesis with prokaryotic
Rubiscos (Terzaghi et al., 1986 ; Lee et al., 1993 ), we chose Leu-335
and changed it conservatively to Val (Fig.
1). The preceding residue in the
primary structure is the catalytically essential Lys-334 that
assists in stabilizing the transition state for carboxylation and in
promoting specificity for CO2 (Lorimer et al.,
1993 ). However, Leu-335 does not participate directly in catalysis. The
side chains of residues 334 and 335 move over 10 Å when a mobile loop
closes over the bound substrate (Schreuder et al., 1993 ). In the final
closed position, the side chain of Leu-335 makes van der Waals contact
with the phosphate group attached to C5 of the substrate. There are
likely to be subtle interactions between the two residues that
influence the critical positioning of the N atom of Lys-334 (Fig.
1). In the Rubisco from the cyanobacterium, Synechococcus
PCC 6301, the Leu to Val substitution at position 335 reduced the
CO2/O2 specificity and the
substrate-saturated carboxylation rate
(Vcmax) to 39% and 40%, respectively, of
wild-type values (Lee et al., 1993 ). We considered that such
impairment, if reproduced in the tobacco enzyme, would fulfill our
requirements.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 1.
A view of the active site of spinach Rubisco
complexed to carboxyarabinitol-P2 based on the coordinates
of the 1.6-Å structure (Andersson, 1996 ) showing the position of
Leu-335. The lower resolution structure of the analogous complex of
tobacco Rubisco (Schreuder et al., 1993 ) appears to be identical in
this region. The hollow arrow indicates the carbon atom deleted by the
Val substitution. Bound carboxyarabinitol-P2 and
Mg2+ are rendered as balls and sticks and amino acid
residues as sticks. C, Gray; O, white; N, P, and Mg2+,
black.
|
|
 |
MATERIALS AND METHODS |
Construction of the Transformation Plasmid
A 985-bp promoterless cassette, comprising the aadA
gene and the rps16 terminator sequence, was amplified
from pRV112A (Zoubenko et al., 1994 ) using primers AD5
(5'AAGCGCTTAGATCTAGTTGTAGGGAG3', introducing the underlined
BglII restriction site) and AD3
(5'TGTCAAAGAAGCTTGAATTAATTCAATG3', HindIII site
underlined). During amplification, the BssHII site within
aadA was eliminated for purposes unrelated to the present study by including primer ADM (5'pGCTTGGCCTCTCGCGCAGATC3',
silent base change underlined). This cassette was inserted between the 2,805-bp SacI-BamHI fragment of pTB29 and the
1,182-bp BamHI-XhoI fragment of pTB22 (Sugiura et
al., 1986 ) and assembled in pTZ18R (Mead et al., 1986 ) to produce the
transformation plasmid pLEV1 (Fig. 2).
Site-specific mutagenesis was conducted on single-stranded DNA derived
from the 348-bp KpnI-NruI fragment of pLEV1
inserted in pTZ18R using primer Val-335
(5'pGCCCAAAGTGAtATcTCTTTCACCTTTCAAcTTTACCTACTACGGTACCTGGGATCCTCT3', introduced EcoRV site and mutated codon 335 underlined, nucleotide changes in lowercase). The italicized
T in this primer destroyed a SmaI site in the
flanking vector sequence, allowing for selection of mutants (Deng and
Nickoloff, 1992 ). Substitution of the mutant KpnI-NruI fragment into pLEV1 produced pL335V
(Fig. 2).

View larger version (46K):
[in this window]
[in a new window]
|
Figure 2.
The pL335V plasmid used for transformation of the
tobacco chloroplast genome. This plasmid was based on pLEV1 with the
nucleotide substitutions (in bold) required to change codon 335 from
Leu to Val and silent substitutions to introduce an adjacent
EcoRV site for screening of transformants. The numbers
refer to the sequence of the tobacco chloroplast genome (Shinozaki et
al., 1986 ). The dashed bars joined by the dotted lines indicate the
homologous flanking regions present in pL335V and available for the
crossovers required to introduce the mutated region and the
aadA gene into the large single-copy region of the
chloroplast genome. The probe used in screening by Southern blotting
and the primers for amplifying and sequencing the mutant
rbcL are indicated. K, KpnI; N,
NruI; E, EcoRV; T, rps16
terminator sequence.
|
|
Chloroplast Transformation
The plastid genome of tobacco (Nicotiana tabacum L. cv
Petit Havana [N,N]) was transformed with pL335V using the
biolistic method (Svab and Maliga, 1993 ). Leaf tissue from
spectinomycin-resistant plantlets was carried through several rounds of
regeneration during which the presence of the introduced
EcoRV site and homoplasticity were monitored by Southern
analysis (Sambrook et al., 1989 ) of leaf DNA isolated according to the
method of Saghai-Maroof et al. (1984) and digested with
EcoRV. The probe was a 1,256-bp fragment of rbcL
(Fig. 2).
Plant Growth
Regenerating plantlets (homoplastic transformants) were
transferred to 10-L pots of soil and grown to maturity in an
artificially lit (400 µmol quanta m 2
s 1) growth chamber in an atmosphere of 0.3%
(v/v) CO2 in air. Air temperature was 24°C
during the 14-h photoperiod, 18°C during darkness, and the pots were
watered daily with a complete nutrient solution. At maturity, flowers
were allowed to self-pollinate and the progeny were grown through
another generation under the same conditions. Some of their flowers
were artificially pollinated with wild-type pollen.
Control plants were regenerated from untransformed stem segments and
grown and propagated in the same way as the transformants.
Confirmation of Mutation
A 2,144-bp fragment containing rbcL was amplified by
PCR from leaf DNA using the primers LSd (5'CACGGAATTCGTGTCGAGTAG3') and AADAr (5'GAATGTCATTGCGCTGCCATTCTCCA3') (Fig. 2). The product was ligated into pGEM-T Easy (Promega, Madison, WI) and sequenced using
BigDye terminator cycle sequencing (Applied Biosystems, Foster City,
CA) using these and several other internal primers.
Segregation of Spectinomycin Resistance and Phenotype
Segregation of spectinomycin resistance was observed by
germinating seeds obtained by self-pollinating primary transformants and wild-type regenerants on RMOP agar medium (Svab and Maliga, 1993 ;
Bock, 1998 ), lacking Suc, and containing 500 µg
mL 1 spectinomycin, in an atmosphere containing
0.3% (v/v) CO2. Ability to grow without
CO2 supplementation was similarly assessed on spectinomycin-free medium in an atmosphere containing 0.035% (v/v) CO2. To measure growth rate at 0.3% (v/v)
CO2, seeds from wild-type regenerants and seeds
derived by cross-pollinating flowers of T1 plants
with wild-type pollen were germinated in 1-L pots of soil and grown as
described above. Twenty-seven days after emergence of the cotyledons,
the height and number of leaves of the plants were recorded and the
complete shoots were harvested, dried in an oven at 80°C, and weighed.
Purification and Assay of Rubisco
Leaf discs (0.79 cm2) from young, fully
expanded leaves of mutant and control plants were frozen in liquid
N2 and then ground in ice-cold glass homogenizers
containing 0.8 mL of extraction buffer (50 mM HEPPS-NaOH,
pH 7.8, 0.5 mM EDTA, 5 mM
MgCl2, 5 mM DTT, 0.1% [w/v]
polyvinylpolypyrrolidone, 1 mM benzamidine, and 0.5 mM PMSF). Following a 30-s centrifugation at
13,000g at 4°C, aliquots were assayed for
substrate-saturated ribulose-P2 carboxylase activity (Mate et al., 1993 ) and Rubisco content and carbamylation status. Content of Rubisco catalytic sites was measured by
stoichiometric binding of
14C-carboxyarabinitol-P2
and its carbamylation status by exchanging 14C-carboxyarabinitol-P2
bound loosely at uncarbamylated sites with excess unlabeled
carboxyarabinitol-P2 (Butz and Sharkey, 1989 ; Ruuska et al., 1998 ). These methods rely on the ligand binding sufficiently tightly so that the Rubisco-ligand complex may be isolated
quantitatively. We carried out this isolation by gel filtration as
described by Ruuska et al. (1998) . We verified that the Leu-335 mutant
Rubisco bound carboxyarabinitol-P2 tightly enough
for this approach to be valid by observing that its elution profile
resembled that of the wild type, showing a peak of bound 14C-label that returned cleanly to baseline
without trailing behind the protein peak.
Rubisco was purified from leaf extracts by precipitation with PEG
followed by ultracentrifugation through Suc density gradients. Leaves
(1.5-2.1 g) were frozen in liquid N2, ground in
a mortar and pestle, and added to 200 mL of ice-cold extraction buffer (lacking MgCl2). The extract was filtered through
two layers of Miracloth (Calbiochem, San Diego, CA) and 60% (w/v) PEG
(Mr 3,350) was added to bring the final
concentration to 8%. After 5 min, MgSO4 was
added to 20 mM and the extract centrifuged for 20 min at 17,000g at 4°C. Rubisco was precipitated from the
supernatant by adding PEG to 18% (w/v) and pelleted by centrifugation.
The precipitate was resuspended in 2 mL of gradient buffer (50 mM HEPPS-NaOH, pH 8.3, 1 mM
EDTA, and 10 mM MgCl2) and
centrifuged at 27,000 rpm for 22 h at 4°C through an exponential
density gradient (mixing volume, 24 mL; gradient volume, 35 mL) of 7%
to 23.3% (w/v) Suc in gradient buffer using an SW28Ti rotor (Beckman
Instruments, Fullerton, CA). Fractions (1.6 mL) were collected from the
bottom of the gradient and the Rubisco peak was identified by
A280. Peak fractions were frozen in liquid
N2 and stored at 80°C. The Michaelis constants (at pH 8.3) for CO2,
O2, and ribulose-P2 (Paul
et al., 1991 ) and the
CO2/O2 specificity (Kane et
al., 1994 ) were measured using these purified preparations.
Leaf Gas-Exchange Measurements
Plants were brought from the high-CO2 growth
cabinet to the laboratory and gas exchange by young, fully expanded
leaves was measured using the clamp-on chamber of the portable,
flow-through photosynthesis system LI-6400 (LI-COR, Lincoln, NE). Leaf
temperature was set at 25°C and illumination (1,000 µmol quanta
m 2 s 1) was provided
with a tungsten-halogen lamp. To obtain the desired atmospheric gas
compositions, N2 and O2
were mixed with mass flow controllers (MKS Type 1179A, MKS Instruments,
Andover, MA) and CO2 was varied using the LI-6400
CO2 injection system. Kinetic parameters of
Rubisco in vivo were inferred from gas-exchange measurements as
described previously (von Caemmerer et al., 1994 ).
 |
RESULTS |
Mutagenesis and Chloroplast Transformation
Mutagenesis of codon 335 of cloned tobacco rbcL was
directed using an oligonucleotide that also introduced an
EcoRV cleavage site 17 bp downstream (Fig. 2). The mutant
rbcL was constructed in a transformation plasmid, pLEV1,
which also contained a promoterless aadA gene (conferring
resistance to spectinomycin) inserted downstream of rbcL,
and homologously recombined into the tobacco plastid genome using
the biolistic method (see "Materials and Methods"). Leaf material
from the resulting spectinomycin-resistant plantlets was
subjected to a further round of regeneration on
spectinomycin-containing medium, after which Southern blotting (see
"Materials and Methods") was conducted to determine whether or not
the desired mutations had been introduced.
The distribution of EcoRV sites in the rbcL
region of the wild-type tobacco plastome (Fig. 2) is such that a single
7.1-kb fragment was detected by the rbcL probe in
EcoRV digests of leaf DNA (Fig.
3, lanes 2 and 6). Insertion of the
aadA gene in the targeted position 3' to rbcL
increased the size of this fragment to 8.1 kb. If the region exposed to
mutagenesis containing the new EcoRV site was also
incorporated, the enlarged fragment is divided into 5.1- and 3.0-kb
subfragments.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 3.
Southern blots of EcoRV-digested
DNA from transformant plants (lanes 1, 3, 4 and 5) probed with the
1,256-bp rbcL sequence (see "Materials and Methods"
and Fig. 2). Results for control plants are shown in lanes 2 and 6. A,
Plantlets after two rounds of regeneration. Lane 1 shows the results
for the single heteroplasmic plantlet that retained the introduced
EcoRV site. Lane 3 shows an example of the class of
plantlets where loss of the EcoRV site had occurred,
followed by sorting out to homoplasmicity. B, Lanes 4 and 5 show
results for mature T1 generation plants resulting from
cloning and three additional rounds of regeneration of the plantlet
analyzed in lane 1, followed by growth to maturity in soil,
self-pollination of T0 flowers, and growth of the resulting
seed. Progeny of both original homoplastic plantlets derived from
regeneration of the lane 1 plantlet are represented.
|
|
Three of 11 spectinomycin-resistant plantlets displayed only the
wild-type 7.1-kb band (not shown). The spectinomycin resistance of
these must have derived from spontaneous mutations elsewhere in the
plastome or perhaps from illegitimate incorporation of the
aadA gene. Of the remaining eight, only one showed the
pattern of 5.1- and 3.0-kb bands expected for the desired
transformation. However, the 7.1-kb wild-type band was also present,
indicating that this plantlet was heteroplasmic, containing both
wild-type and transformed plastomes (Fig. 3A, lane 1). Blots of the
other seven (an example is shown in Fig. 3A, lane 3) revealed a single hybridizing band of 8.1 kb. The size of this fragment is consistent with insertion of the aadA gene in the expected position but
the lack of an internal EcoRV site indicates that it did not
contain the mutated region of rbcL. Such a fragment would be
produced by crossover between wild-type and mutated plastomes in the
region between the mutation site and the aadA gene,
resulting in the combination of wild-type rbcL with
aadA.
The single heteroplasmic plantlet retaining the internal
EcoRV site was cloned and regenerated again. Of the four
resulting plantlets, two retained the EcoRV site and showed
no trace of the wild-type fragment. The others lost the
EcoRV site, again producing the single 8.1-kb hybridizing
band (not shown, similar to Fig. 3A, lane 3). The frequency with which
this crossover occurred raises suspicion that unimpaired Rubisco
function is advantageous, even during growth on a Suc-containing
medium, thus applying positive selection for the presence of the
wild-type rbcL sequence. Nevertheless, the plantlets
retaining the EcoRV site continued to retain it through two
additional rounds of cloning and regeneration and subsequent growth to
maturity in soil. No trace of the unmutated sequence could be detected
in these plants or in their progeny (Fig. 3B, lanes 4 and 5). We
concluded that they had become homoplasmic and thus immune to further
crossover. A 2,144-bp region encompassing all of the rbcL
gene was amplified from mutant plants and sequenced completely (see
"Materials and Methods"). This confirmed that the mutation in codon
335 was present and that only the intended changes had been introduced.
Inheritance
When tested as described in "Materials and Methods", all of
the T1 self-progeny (98 tested), but no control
progeny (97 tested), were resistant to spectinomycin. On the other
hand, no T1 self-progeny (47 tested), but all
control progeny (49 tested), were able to grow beyond the cotyledon
stage in an atmosphere containing 0.035% (v/v)
CO2. This lack of segregation of both
spectinomycin resistance and CO2 requirement is
consistent with the expected maternal inheritance of the transformed
plastid genomes.
As a further control, tobacco was transformed with the pLEV1 construct,
which contained the aadA gene but lacked the rbcL mutation (Fig. 2). The three transformed plants that resulted grew
normally without CO2 supplementation and appeared
to be indistinguishable from the wild type.
Growth Rate at High CO2
Even in a CO2-enriched atmosphere, the
mutant plants grew slower than controls (Fig.
4). This slow-growing phenotype did not segregate in the T1 and T2
generations, even with seed derived from cross-pollinating flowers with
wild-type pollen (see "Materials and Methods"). Therefore, the
growth retardation appears to be inherited maternally, as well. The
average aboveground dry weight 27 d after cotyledon emergence of
both self-pollinated and cross-pollinated mutant plants was less than
2% that of the wild type (Fig. 5). Plant
height was reduced to one-tenth in the mutants and their number of
leaves was reduced 50%.

View larger version (88K):
[in this window]
[in a new window]
|
Figure 4.
A control plant and a T1 generation
Val-335 transformant 50 d after emergence of the cotyledons. Both
plants were grown in air enriched with CO2 to 0.3% (v/v)
as described in "Materials and Methods."
|
|

View larger version (42K):
[in this window]
[in a new window]
|
Figure 5.
Physical characteristics of plants grown in 0.3%
(v/v) CO2 in air. The height, total number of leaves, and
aboveground dry weight of the plants were measured (±SD)
27 d after emergence of the cotyledons. cntrl, Control
(n = 9); self, T1 generation
transformants derived by self-pollination of T0 flowers
(n = 8); bx, T2 generation
transformants derived by pollinating T1 flowers with
wild-type pollen (n = 10).
|
|
Characteristics of the Mutant Rubisco
The Rubisco content of the mutant plants was similar to that of
the controls but approximately twice as many of the mutant enzyme's
active sites were carbamylated under the high-CO2
growth conditions (Table I). The
Vcmax of the mutant enzyme was reduced to
24% that of the wild type and its Km
values for CO2, O2, and ribulose-P2 were reduced to 48%, 17%, and 11%,
respectively, of control values. The
CO2/O2 specificity of the
mutant Rubisco was 25% that of the wild type (Table I).
View this table:
[in this window]
[in a new window]
|
Table I.
Content, carbamylation, and kinetic parameters for
Leu-335 (wild type) and Val-335 Rubiscos measured in vivo and in vitro
n.a., Not applicable.
|
|
Photosynthetic Gas-Exchange Characteristics
CO2 assimilation by leaves of the mutant
plants was severely reduced. The CO2-compensation
point in 21% (v/v) O2 was increased 4-fold
relative to the controls and assimilation remained limited by Rubisco
activity at all CO2 concentrations, unlike
assimilation in the control, which became limited by light-dependent
ribulose-P2 regeneration above 300 µbar
CO2, as expected (Fig.
6A). CO2-response curves were measured at different O2
concentrations and the kinetic parameters of the mutant Rubisco in vivo
were calculated from these data with a model for photosynthetic
CO2 exchange (Farquhar et al., 1980 ; von
Caemmerer et al., 1994 ). The increased slope of the dependency of the
CO2-compensation point on
O2 concentration accords with the poorer
CO2/O2 specificity of the
mutant Rubisco (Fig. 6B; Table I).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 6.
A, The response of CO2 assimilation
rate to intercellular pCO2 for leaves of a
control plant ( ) and two T0 transformants ( and ).
Solid lines are CO2 assimilation rates (A)
modeled using the equation (Farquhar et al., 1980 ):
|
(1)
|
where Vcmax,
Kc, and Ko, are
the substrate-saturated carboxylase activity and the Michaelis
constants for CO2 and O2,
respectively. * is the
CO2 compensation point in the absence of
nonphotorespiratory CO2 release,
Rd. C and O are the
partial pressures of CO2 and
O2. Rubisco kinetic parameters can only be
estimated from gas-exchange measurements with plants whose Rubisco
activities are low enough to limit photosynthesis under all measurement
conditions. The transformants in this study fulfill this criterion and
the modeled line is drawn with the following fitted parameters:
Vcmax = 37 µmol
m 2 s 1,
Kc = 318 µbar,
Ko = 55.6 mbar, * = 140 µbar, and Rd = 2.5 µmol
m 2 s 1. The control
plants were not limited by Rubisco activity at the higher
CO2 partial pressures. For them, the modeled line
is drawn using kinetic parameters determined previously with
Rubisco-deficient anti-rbcS tobacco
(Vcmax = 90 µmol
m 2 s 1,
Kc = 404 µbar,
Ko = 248 mbar, * = 37 µbar, and Rd = 3 µmol
m 2 s 1 [von Caemmerer
et al., 1994 ]). Note that * = 0.5O/Sc/o. We assumed that chloroplastic
pCO2 was equal to the intercellular
pCO2. B, The CO2
compensation point as a function of
pO2 for leaves of the wild type ( and ) and transformants ( and ). Solid lines are the
compensation point modeled using the equation (Farquhar et al., 1980 ):
|
(2)
|
with the same parameter values as above.
|
|
Since photosynthesis in the control plants becomes limited by
ribulose-P2 regeneration above 300 µbar
CO2 (Fig. 6A), these plants are not suitable for
measurement of the wild-type Rubisco's kinetic properties in vivo.
However, a useful comparison can be made with previous data for tobacco
with a reduced content of wild-type Rubisco induced by a nuclear
anti-rbcS gene. Photosynthesis in these plants was also
limited by Rubisco activity rather than by
ribulose-P2 regeneration, even at high
CO2 concentrations (von Caemmerer et al., 1994 ).
The increased slope of the dependency of the apparent
Km for CO2 on
O2 concentration observed with plants with the
mutant Rubisco, compared with the previous observations, revealed the
reduction in Km for
O2 (Fig. 7A; Table
I). Vcmax, on the other hand, was little
affected by O2 concentration, as expected if
CO2 and O2 are competitive
alternate substrates (Fig. 7B).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 7.
The responses of the apparent
Km for CO2 (A) and the maximal
carboxylation rate (Vcmax) (B) of the
Val-335 Rubisco to pO2 inferred from
gas-exchange data. The data were calculated from
CO2-response curves similar to those in Figure 6A measured
at different pO2 as described by von
Caemmerer et al. (1994) . An infinite conductance for CO2
transfer between the intercellular air spaces and the sites of
carboxylation was assumed. The solid line in A is a linear fit to the
data for one transformant plant ( ). For comparison, the dashed line
shows the in vivo response of the wild-type Rubisco (Leu-335)
calculated from the data of von Caemmerer et al. (1994) for
Rubisco-deficient anti-rbcS tobacco.
|
|
 |
DISCUSSION |
Heteroplasmy Makes Directed Partial Disablement of the Rubisco
Large Subunit Difficult But Not Impossible
Following transformation of the chloroplast genome, sorting-out
between transformed and untransformed genomes occurs by a mechanism
currently not well understood (Maliga, 1993 ). Eventually, the tissue
may become homoplasmic for the transformed plastome, which encodes
resistance to the selective agent spectinomycin, but during the
sorting-out process, which may take several rounds of
regeneration in tissue culture, the two genomes co-exist. Site-directed mutagenesis of an existing chloroplast-encoded gene requires linkage between the necessary base substitution and an introduced
aadA gene, which encodes spectinomycin resistance. Some
homology between the transforming DNA construct and the wild-type
plastome in the region between the mutagenic substitution and the
aadA gene is unavoidable. Therefore, the potential exists
for recombination in this intervening region between the wild-type and
mutant plastomes while they coexist. The product of such a
recombination event will encode a wild-type copy of the target gene
together with the aadA gene. The problem is exacerbated if
the transformation results in partial disablement of an essential
chloroplast gene. Then there is active selection for such recombinants.
These proved to be the most common outcome of our transformations.
However, despite this difficulty, we ultimately succeeded in obtaining a transformant that retained the desired directed mutation in rbcL. Its stability through several generations of plants
and lack of detectable copies of the wild-type plastome lead us to conclude that it is homoplasmic.
The low frequency of recovery of the desired transformants might have
been circumvented if we had transformed a tobacco line with a deletion
in the region of rbcL targeted by our mutation, such as that
engineered by Kanevski and Maliga (1994) . However, such an approach
would have had to surmount difficulties associated with the propagation
of photosynthetically disabled plants and with the use of a selective
agent other than spectinomycin (since the aadA gene replaced
the deleted rbcL gene).
The Phenotype Is Maternally Inherited
Plastid transformation, like any procedure requiring repeated
cycles of tissue culture and regeneration, carries with it a risk of
introducing unwanted nuclear mutations. These can be removed by
repeated back-crossing with wild-type pollen and we are currently proceeding with this. However, it is unlikely that such nuclear mutations, if they occurred, can be contributing to the phenotype and
the changed Rubisco properties that our transformants display. Both
resistance to spectinomycin and inability to grow without CO2 enrichment appear to be maternally inherited.
Furthermore, the slower growth rate of transformant progeny compared
with the wild type under CO2 enrichment shows no
signs of segregating, even with progeny resulting from back-crossing
with wild-type pollen (Fig. 5). Thus, the impaired growth also appears
to be a maternally inherited characteristic, consistent with the
engineered change in the plastid rbcL gene.
Kinetic Properties of the Val-335 Mutant Rubisco Are Consistent
with a Disturbance of the Position or Orientation of the Adjacent
Residue, Lys-334
Substitution of Val for Leu at residue 335 of Rubisco's large
subunit caused changes in the catalytic properties of tobacco Rubisco
(Table I) similar to those seen previously with
Synechococcus Rubisco (Lee et al., 1993 ) but a little more
severe. For example, the mutation reduced both the maximal activity and
CO2/O2 specificity of the
cyanobacterial enzyme by approximately 60% but, for the tobacco
enzyme, the reductions were 75%. The Km
for ribulose-P2 of both enzymes
was also reduced. However, while the mutation nearly doubled the
Km for CO2 of the
cyanobacterial enzyme, it halved it for the tobacco enzyme. The
increased inhibition of the mutant tobacco enzyme by
O2 was particularly obvious in the reduction of
its Ki for O2 to
one-sixth that of the wild type (Table I).
The changes in kinetic parameters induced by the Val-335 mutation are
consistent with this side chain influencing the position and
orientation and, therefore, the reactivity of the adjacent Lys-334
residue. Contact between the terminal methyl groups of the side chain
of residue 335 and the P2 phosphate group of the substrate is likely to
regulate the depth to which the amino group of Lys-334 penetrates
into the active-site region when the flexible loop that contains both
of these residues (loop 6) closes over the bound substrate and reaction
intermediates (Fig. 1). Shortening the side chain of residue 335 by one carbon atom would allow the terminal N atom of the Lys residue
to penetrate too far into the active site, perhaps leading to
distortion or deflection of the lysyl side chain and a change in the
critically important orientation of the N atom. This possibility
is supported by a structural study with a mutant of
Synechococcus Rubisco in which Lys-334 was replaced by Met,
which showed deflection of this side chain (Newman, 1992 ).
The N atom of residue 334 makes hydrogen-bonding contact with one
of the O atoms of the nascent carboxyl group formed when CO2 attacks the enediol form of
ribulose-P2. This interaction is likely to lower
the energy of the transition state associated with this process, thus
facilitating the carboxylation reaction. This interaction is not
duplicated in the analogous attack of O2 on the
enediol (for review, see Roy and Andrews, 1999 ). Therefore, perturbation of the position and alignment of the N atom would have
more serious consequences for carboxylation than for oxygenation, which
is consistent with our observations.
If our interpretation that the effects of the Val-335 mutation are
indirect manifestations of perturbation of the critical Lys-334 side
chain is correct, our data allow a further conclusion to be drawn about
the role of Lys-334. Whereas the mutation decreases the
Vmax/Km value
for carboxylation by 50%, it doubles the analogous quotient for
oxygenation (Table I). This means that the mutant enzyme is twice as
effective as the wild type in handling limiting concentrations of its
substrate, O2, presumably because the transition state associated with O2 addition to the enediol
has a lower energy in the mutant's active site than in the wild
type's. Therefore, correct position and alignment of Lys-334 must not
only facilitate attack by CO2 on the enediol
intermediate but also actively impede attack by
O2.
Effect of the Val-335 Mutation on Carbamylation
At high CO2, the potential Rubisco activity
in wild-type plants substantially exceeds the rate of electron
transport and CO2 assimilation becomes limited by
electron transport. This can be seen as the progressively larger
shortfall of the measured assimilation rate, as compared with that
modeled, for the control as the CO2 concentration
increased (Fig. 6A). The shortfall would be larger and start to occur
at lower CO2 concentrations under the growth illumination (400 µmol quanta m 2
s 1) than under the higher measurement
illumination (1,000 µmol quanta m 2
s 1). When potential Rubisco activity is
excessive, actual activity is reduced by reducing Rubisco carbamylation
by a control mechanism involving the response of Rubisco activase
activity to the abundance of electron-transport products or to the size
of the transthylakoid pH gradient.
The low carbamylation status of Rubisco in the wild type under the
high-CO2 growth conditions (Table I) is therefore
the expected response to the scarcity of electron-transport products (or low pH) induced by Calvin-cycle overcapacity at high
CO2. By contrast, assimilation by plants with the
Val-335 mutant Rubisco never encounters the electron-transport
limitation, even at high CO2 concentration (Fig.
6A). As a result, electron-transport products remain abundant (and
pH remains high) at high CO2, contributing to
the observed near-complete Rubisco carbamylation (Table I).
The Physiological Phenotype Is Consistent with the Changes in
Rubisco Properties
Except for the modest reduction in
Km(CO2) seen with the
mutant enzyme in vitro, all Rubisco kinetic parameters calculated from
gas-exchange measurements agreed well with those measured in vitro with
the isolated enzyme (Table I). This consistency, in the face of the
gross perturbation of the balance between photosynthesis and
photorespiration caused by the Val-335 mutation, validates the concepts
on which the photosynthesis/photorespiration model (Farquhar et al.,
1980 ) is based. The net rate of photosynthetic/photorespiratory CO2 assimilation (per carbamylated Rubisco site)
in air calculated from the in vitro data for the plant with the mutant
Rubisco was only 5% that of the wild type (Table I). This would be
barely sufficient to compensate for nonphotorespiratory
CO2 release, leading to a
CO2-compensation point for the mutant plant near current atmospheric CO2 concentration, as
observed by gas exchange (Fig. 6). Therefore, the mutant plants would
be barely able to maintain positive carbon balance in air, explaining
their inability to grow.
Even though CO2 enrichment to 0.3% (v/v)
strongly suppresses the oxygenation activity of the mutant Rubisco, it
cannot compensate for the large reduction in
Vcmax. The mutant plant's calculated net rate
of photosynthetic/photorespiratory CO2
assimilation (per carbamylated Rubisco site) in 0.3% (v/v)
CO2 was only 21% that of the control plant under
similar conditions (Table I). Therefore, the impairment of the mutant
plants' growth, relative to that of the controls under
CO2-enriched conditions (Figs. 4 and 5) is
to be expected. Other tobacco lines with reduced Rubisco capacity induced by antisense suppression of Rubisco or Rubisco activase content
also grew more slowly than the wild type both with and without
CO2 supplementation (Fichtner et al., 1993 ; Masle
et al., 1993 ; Mate et al., 1993 ; He et al., 1997 ).
 |
CONCLUSION |
Inability to conduct site-specific mutagenesis with the higher
plant Rubisco has been a major hindrance to the study of its structure
and function. The strategy we have used surmounts this barrier and
opens the way for further detailed investigations. Provision of the
mutant Rubisco in its natural stromal environment for physiological
study is an outstanding bonus.
 |
ACKNOWLEDGMENTS |
We thank J. Jones for supplying seeds of tobacco cv Petit Havana
(N,N), M. Sugiura for supplying plasmids pTB22 and pTB29, P. Maliga for supplying plasmid pRV112A, and P. Maliga and J.-W. Liu for
advice about the biolistic technique. Some of these data were
communicated at the XIth International Congress on Photosynthesis (Budapest, August 17-22, 1998).
 |
FOOTNOTES |
Received March 12, 1999; accepted July 6, 1999.
1
This work was supported by the Australian
National University's Centre for Molecular Structure and Function.
2
Present address: 12 Jansz Crescent, Griffith,
ACT 2603, Australia.
*
Corresponding author; e-mail john.andrews{at}anu.edu.au; fax
61-2-6249-5075.
 |
LITERATURE CITED |
-
Andersson I
(1996)
Large structures at high resolution: the 1.6Å crystal structure of spinach ribulose-1,5-bisphosphate carboxylase/oxygenase complexed with 2-carboxyarabinitol bisphosphate.
J Mol Biol
259: 160-174
[CrossRef][Web of Science][Medline]
-
Bock R
(1998)
Analysis of RNA editing in plastids.
Methods
15: 75-83
[CrossRef][Web of Science][Medline]
-
Butz ND, Sharkey TD
(1989)
Activity ratios of ribulose-1,5-bisphosphate carboxylase accurately reflect carbamylation ratios.
Plant Physiol
89: 735-739
[Abstract/Free Full Text]
-
Deng WP, Nickoloff JA
(1992)
Site-directed mutagenesis of virtually any plasmid by eliminating a unique site.
Anal Biochem
200: 81-88
[CrossRef][Web of Science][Medline]
-
Farquhar GD, von Caemmerer S, Berry JA
(1980)
A biochemical model of photosynthetic CO2 assimilation in leaves of C3 species.
Planta
149: 78-90
[CrossRef][Web of Science]
-
Fichtner K, Quick WP, Schulze E-D, Mooney HA, Rodermel SR, Bogorad L, Stitt M
(1993)
Decreased ribulose-1,5-bisphosphate carboxylase-oxygenase in transgenic tobacco transformed with "antisense" rbcS. V. Relationship between photosynthetic rate, storage strategy, biomass allocation and vegetative plant growth at three different nitrogen supplies.
Planta
190: 1-9
[Web of Science]
-
Gutteridge S, Gatenby AA
(1995)
Rubisco synthesis, assembly, mechanism, and regulation.
Plant Cell
7: 809-819
[CrossRef][Web of Science][Medline]
-
Hartman FC, Harpel MR
(1994)
Structure, function, regulation, and assembly of D-ribulose-1,5-bisphosphate carboxylase/oxygenase.
Annu Rev Biochem
63: 197-234
[CrossRef][Web of Science][Medline]
-
He Z, von Caemmerer S, Hudson GS, Price GD, Badger MR, Andrews TJ
(1997)
Ribulose-1,5-bisphosphate carboxylase/oxygenase activase deficiency delays senescence of ribulose-1,5-bisphosphate carboxylase/oxygenase but progressively impairs its catalysis during tobacco leaf development.
Plant Physiol
115: 1569-1580
[Abstract]
-
Husic DW, Husic HD, Tolbert NE
(1987)
The oxidative photosynthetic carbon cycle or C2 cycle.
CRC Crit Rev Plant Sci
5: 45-100
-
Kane HJ, Viil J, Entsch B, Paul K, Morell MK, Andrews TJ
(1994)
An improved method for measuring the CO2/O2 specificity of ribulosebisphosphate carboxylase-oxygenase.
Aust J Plant Physiol
21: 449-461
[Web of Science]
-
Kanevski I, Maliga P
(1994)
Relocation of the plastid rbcL gene to the nucleus yields functional ribulose-1,5-bisphosphate carboxylase in tobacco chloroplasts.
Proc Natl Acad Sci USA
91: 1969-1973
[Abstract/Free Full Text]
-
Kanevski I, Maliga P, Rhoades DF, Gutteridge S
(1999)
Plastome engineering of ribulose-1,5-bisphosphate carboxylase/oxygenase in tobacco to form a sunflower large subunit and tobacco small subunit hybrid.
Plant Physiol
119: 133-141
[Abstract/Free Full Text]
-
Lee GJ, McDonald KA, McFadden BA
(1993)
Leucine 332 influences the CO2/O2 specificity factor of ribulose-1,5-bisphosphate carboxylase/oxygenase from Anacystis nidulans.
Protein Sci
2: 1147-1154
[Web of Science][Medline]
-
Lorimer GH, Chen Y-R, Hartman FC
(1993)
A role for the
-amino group of lysine-334 of ribulose-1,5-bisphosphate carboxylase in the addition of carbon dioxide to the 2,3-enediol(ate) of ribulose 1,5-bisphosphate.
Biochemistry
32: 9018-9024
[CrossRef][Medline] -
Maliga P
(1993)
Towards plastid transformation in flowering plants.
Trends Biotechnol
11: 101-107
-
Masle J, Hudson GS, Badger MR
(1993)
Effects of ambient CO2 concentration on growth and nitrogen use in tobacco (Nicotiana tabacum) plants transformed with an antisense gene to the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase.
Plant Physiol
103: 1075-1088
[Abstract]
-
Mate CJ, Hudson GS, von Caemmerer S, Evans JR, Andrews TJ
(1993)
Reduction of ribulose bisphosphate carboxylase activase levels in tobacco (Nicotiana tabacum) by antisense RNA reduces ribulose bisphosphate carboxylase carbamylation and impairs photosynthesis.
Plant Physiol
102: 1119-1128
[Abstract]
-
Mead DA, Szczesna-Skorupa E, Kemper B
(1986)
Single-stranded DNA "blue" T7 promoter plasmids: a versatile tandem promoter system for cloning and protein engineering.
Protein Eng
1: 67-74
[Abstract/Free Full Text]
-
Newman J
(1992)
Structural studies of ribulose-1,5-bisphosphate carboxylase/oxygenase from the cyanobacterium Synechococcus PCC 6301. PhD Thesis Swedish University of Agricultural Sciences, Uppsala
-
Paul K, Morell MK, Andrews TJ
(1991)
Mutations in the small subunit of ribulosebisphosphate carboxylase affect subunit binding and catalysis.
Biochemistry
30: 10019-10026
[CrossRef][Medline]
-
Roy H, Andrews TJ
(1999)
Rubisco: assembly and mechanism.
In
RC Leegood, TD Sharkey, S von Caemmerer, eds, Photosynthesis: Physiology and Metabolism. Kluwer Academic Publishers, Dordrecht, the Netherlands, in press
-
Ruuska SA, Andrews TJ, Badger MR, Hudson GS, Laisk A, Price GD, von Caemmerer S
(1998)
The interplay between limiting processes in C3 photosynthesis studied by rapid-response gas exchange using transgenic tobacco impaired in photosynthesis.
Aust J Plant Physiol
25: 859-870
[Web of Science]
-
Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW
(1984)
Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics.
Proc Natl Acad Sci USA
81: 8014-8018
[Abstract/Free Full Text]
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Schreuder HA, Knight S, Curmi PMG, Andersson I, Cascio D, Brändén C-I, Eisenberg D
(1993)
Formation of the active site of ribulose-1,5-bisphosphate carboxylase/oxygenase by a disorder-order transition from the unactivated to the activated form.
Proc Natl Acad Sci USA
90: 9968-9972
[Abstract/Free Full Text]
-
Shinozaki K, Ohme M, Tanaka M, Wakasugi T, Hayashida N, Matsubayashi T, Zoutu N, Sugiura M
(1986)
The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expression.
EMBO J
5: 2043-2049
[Web of Science][Medline]
-
Spreitzer RJ
(1993)
Genetic dissection of Rubisco structure and function.
Annu Rev Plant Physiol Plant Mol Biol
44: 411-434
[CrossRef][Web of Science]
-
Spreitzer RJ
(1998)
Genetic engineering of Rubisco.
In
J-D Rochaix, M Goldschmidt-Clermont, S. Merchant, eds, The Molecular Biology of Chloroplasts and Mitochondria in Chlamydomonas. Kluwer Academic Publishers, Dordrecht, The Netherlands
-
Sugiura M, Shinozaki K, Zoutu N, Kusuda M, Kumano M
(1986)
Clone bank of the tobacco (Nicotiana tabacum) chloroplast genome as a set of overlapping restriction endonuclease fragments: mapping of eleven ribosomal protein genes.
Plant Sci
44: 211-216
[CrossRef]
-
Svab Z, Maliga P
(1993)
High-frequency plastid transformation in tobacco by selection for a chimeric aadA gene.
Proc Natl Acad Sci USA
90: 913-917
[Abstract/Free Full Text]
-
Terzaghi BE, Laing WA, Christeller JT, Petersen GB, Hill DF
(1986)
Ribulose 1,5-bisphosphate carboxylase: effect on the catalytic properties of changing methionine-330 to leucine in the Rhodospirillum rubrum enzyme.
Biochem J
235: 839-846
[Web of Science][Medline]
-
von Caemmerer S, Evans JR, Hudson GS, Andrews TJ
(1994)
The kinetics of ribulose-1,5-bisphosphate carboxylase/oxygenase in vivo inferred from measurements of photosynthesis in leaves of transgenic tobacco.
Planta
195: 88-97
[Web of Science]
-
Zoubenko OV, Allison LA, Svab Z, Maliga P
(1994)
Efficient targeting of foreign genes into the tobacco plastid genome.
Nucleic Acids Res
22: 3819-3824
[Abstract/Free Full Text]
© 1999 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
S. M. Whitney and R. E. Sharwood
Construction of a tobacco master line to improve Rubisco engineering in chloroplasts
J. Exp. Bot.,
May 1, 2008;
59(7):
1909 - 1921.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yabuta, M. Tamoi, K. Yamamoto, K.-i. Tomizawa, A. Yokota, and S. Shigeoka
Molecular Design of Photosynthesis-Elevated Chloroplasts for Mass Accumulation of a Foreign Protein
Plant Cell Physiol.,
March 1, 2008;
49(3):
375 - 385.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. E. Sharwood, S. von Caemmerer, P. Maliga, and S. M. Whitney
The Catalytic Properties of Hybrid Rubisco Comprising Tobacco Small and Sunflower Large Subunits Mirror the Kinetically Equivalent Source Rubiscos and Can Support Tobacco Growth
Plant Physiology,
January 1, 2008;
146(1):
83 - 96.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. McNevin, M. R. Badger, S. M. Whitney, S. von Caemmerer, G. G. B. Tcherkez, and G. D. Farquhar
Differences in Carbon Isotope Discrimination of Three Variants of D-Ribulose-1,5-bisphosphate Carboxylase/Oxygenase Reflect Differences in Their Catalytic Mechanisms
J. Biol. Chem.,
December 7, 2007;
282(49):
36068 - 36076.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Whitney and R. E. Sharwood
Linked Rubisco Subunits Can Assemble into Functional Oligomers without Impeding Catalytic Performance
J. Biol. Chem.,
February 9, 2007;
282(6):
3809 - 3818.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gutteridge and J. Pierce
A unified theory for the basis of the limitations of the primary reaction of photosynthetic CO2 fixation: Was Dr. Pangloss right?
PNAS,
May 9, 2006;
103(19):
7203 - 7204.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Ghannoum, J. R. Evans, W. S. Chow, T. J. Andrews, J. P. Conroy, and S. von Caemmerer
Faster Rubisco Is the Key to Superior Nitrogen-Use Efficiency in NADP-Malic Enzyme Relative to NAD-Malic Enzyme C4 Grasses
Plant Physiology,
February 1, 2005;
137(2):
638 - 650.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Dhingra, A. R. Portis Jr., and H. Daniell
Enhanced translation of a chloroplast-expressed RbcS gene restores small subunit levels and photosynthesis in nuclear RbcS antisense plants
PNAS,
April 20, 2004;
101(16):
6315 - 6320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Whitney and T. J. Andrews
Photosynthesis and Growth of Tobacco with a Substituted Bacterial Rubisco Mirror the Properties of the Introduced Enzyme
Plant Physiology,
September 1, 2003;
133(1):
287 - 294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. G. Pearce and T. J. Andrews
The Relationship between Side Reactions and Slow Inhibition of Ribulose-bisphosphate Carboxylase Revealed by a Loop 6 Mutant of the Tobacco Enzyme
J. Biol. Chem.,
August 29, 2003;
278(35):
32526 - 32536.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. McC. Lilley, X. Wang, E. Krausz, and T. J. Andrews
Complete Spectra of the Far-red Chemiluminescence of the Oxygenase Reaction of Mn2+-activated Ribulose-bisphosphate Carboxylase/Oxygenase Establish Excited Mn2+ as the Source
J. Biol. Chem.,
May 2, 2003;
278(19):
16488 - 16493.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. J. Parry, P. J. Andralojc, R. A. C. Mitchell, P. J. Madgwick, and A. J. Keys
Manipulation of Rubisco: the amount, activity, function and regulation
J. Exp. Bot.,
May 1, 2003;
54(386):
1321 - 1333.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-H. Zhang, R. G. Ewy, J. M. Widholm, and A. R. Portis Jr.
Complementation of the Nuclear Antisense rbcS-Induced Photosynthesis Deficiency by Introducing an rbcS Gene into the Tobacco Plastid Genome
Plant Cell Physiol.,
November 15, 2002;
43(11):
1302 - 1313.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Falk, B. M. Chassy, S. K. Harlander, T. J. Hoban IV, M. N. McGloughlin, and A. R. Akhlaghi
Food Biotechnology: Benefits and Concerns
J. Nutr.,
June 1, 2002;
132(6):
1384 - 1390.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Whitney and T. J. Andrews
Plastome-encoded bacterial ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) supports photosynthesis and growth in tobacco
PNAS,
November 20, 2001;
(2001)
261417298.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Whitney and T. J. Andrews
The Gene for the Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase (Rubisco) Small Subunit Relocated to the Plastid Genome of Tobacco Directs the Synthesis of Small Subunits That Assemble into Rubisco
PLANT CELL,
January 1, 2001;
13(1):
193 - 205.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y.-C. Du, S. Hong, and R. J. Spreitzer
RbcS suppressor mutations improve the thermal stability and CO2/O2 specificity of rbcL- mutant ribulose-1,5-bisphosphate carboxylase/oxygenase
PNAS,
December 8, 2000;
(2000)
260503997.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y.-C. Du and R. J. Spreitzer
Suppressor Mutations in the Chloroplast-encoded Large Subunit Improve the Thermal Stability of Wild-type Ribulose-1,5-bisphosphate Carboxylase/Oxygenase
J. Biol. Chem.,
June 23, 2000;
275(26):
19844 - 19847.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Ott, B. D. Smith, A. R. Portis Jr., and R. J. Spreitzer
Activase Region on Chloroplast Ribulose-1,5-bisphosphate Carboxylase/Oxygenase. NONCONSERVATIVE SUBSTITUTION IN THE LARGE SUBUNIT ALTERS SPECIES SPECIFICITY OF PROTEIN INTERACTION
J. Biol. Chem.,
August 18, 2000;
275(34):
26241 - 26244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-C. Du, S. Hong, and R. J. Spreitzer
RbcS suppressor mutations improve the thermal stability and CO2/O2 specificity of rbcL- mutant ribulose-1,5-bisphosphate carboxylase/oxygenase
PNAS,
December 19, 2000;
97(26):
14206 - 14211.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Whitney and T. J. Andrews
Plastome-encoded bacterial ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) supports photosynthesis and growth in tobacco
PNAS,
December 4, 2001;
98(25):
14738 - 14743.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|