|
|
||||||||
|
Plant Physiol, October 1999, Vol. 121, pp. 641-646
Histidine-41 of the Cytochrome b5
Domain of the Borage
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
Unlike most other plant microsomal
desaturases, the
6-fatty acid desaturase from borage
(Borago officinalis) contains an N-terminal extension
that shows homology to the small hemoprotein cytochrome (Cyt)
b5. To determine if this domain serves as a
functional electron donor for the
6-fatty acid
desaturase, mutagenesis and functional analysis by expression in
transgenic Arabidopsis was carried out. Although expression of the
wild-type borage
6-fatty acid desaturase resulted in the
synthesis and accumulation of
6-unsaturated fatty acids,
this was not observed in plants transformed with N-terminally deleted
forms of the desaturase. Site-directed mutagenesis was used to disrupt
one of the axial heme-binding residues (histidine-41) of the Cyt
b5 domain; expression of this mutant form of
the
6-desaturase in transgenic plants failed to produce
6-unsaturated fatty acids. These data indicate that the
Cyt b5 domain of the borage
6-fatty acid desaturase is essential for enzymatic activity.
| |
INTRODUCTION |
|---|
|
|
|---|
The synthesis of unsaturated fatty acids is catalyzed by
acyl-lipid-desaturases that introduce double bonds into preformed acyl
chains by oxygen- and electron-donor-dependent desaturation (Heinz,
1993
; Shanklin and Cahoon, 1998
). The immediate electron donor for many
microsomal desaturases is Cyt b5
(Lederer, 1994
), a small hemoprotein that functions in a number of
oxidation/reduction reactions in plants, including NADH-dependent
acyl-group desaturation (Smith et al., 1990
, 1998
). Cyt
b5 is also involved in fatty acid hydroxylation in higher plants (Kearns et al., 1991
; Smith et al.,
1992
). Apart from the "free" microsomal form of the protein, Cyt
b5 domains or folds have been found in
a number of unrelated proteins, such as nitrate reductase, sulfite
oxidase, and L-lactate dehydrogenase (Lederer,
1994
; Sperling et al., 1995
; Napier et al., 1997
). These domains
include the characteristic Cyt b5
motif His-Pro-Gly-Gly (HPGG), which forms the core of the heme-binding domain.
Recently, Cyt b5 domains have been
identified in various positions in desaturases and hydroxylases. Thus,
a fused C-terminal Cyt b5 domain has
been detected in the Saccharomyces cerevisiae OLE1
microsomal
9-desaturase (Mitchell and Martin,
1995
) and in OLE1 homologs from fungi (Meesters et al., 1997
) and red
alga (Itoh et al., 1998
). Amino-terminal Cyt
b5 domain have recently been
identified in
6-fatty acid desaturases from
plants (Sayanova et al., 1997
), the nematode worm Caenorhabditis
elegans (Napier et al., 1998
), and mammals (Cho et al., 1999
), and
in
5-fatty acid desaturases from animals and
fungi (Knutzon et al., 1998
; Michaelson et al., 1998a
, 1998b
). These
domains have also been detected in
8-sphingolipid desaturases from plants
(Sperling et al., 1995
, 1998
) and in the FAH1 sphingolipid
-hydroxylase of yeast (Mitchell and Martin, 1997
; Napier et al.,
1997
). The
6-fatty acid desaturase from the
moss Physcomitrella patents also contains an additional
N-terminal extension of 100 amino acids preceding its Cyt
b5 domain, thus resembling fusion
proteins such as nitrate reductase (Girke et al., 1998
).
Although these Cyt b5-domain sequences
have significantly diverged, this has occurred without modification of
the HPGG motif, which forms the heme-binding core of the protein
(Napier et al., 1997
, 1999
). The heme-binding nature of these domains
has been demonstrated in sunflower sphingolipid desaturase by
expression of the first 122 residues (essentially the entire Cyt
b5 domain) in Escherichia
coli (Sperling et al., 1995
). The resulting recombinant protein
exhibited redox absorbance spectra similar to those of plant microsomal
Cyt b5 (Smith et al., 1994
).
The essential role of the Cyt b5-like
domain in these fusion-desaturases has been demonstrated for yeast
OLE1p
9-acyl-CoA desaturase (Mitchell and
Martin, 1995
). Expression of the OLE1 gene rescued yeast double mutants
that lacked both OLE1 and microsomal Cyt
b5 genes, whereas rescue of
ole1 mutants by a rat microsomal
9-desaturase required the additional presence
of a functional Cyt b5 gene.
Truncation or disruption of the Cyt b5
domain of the OLE1 desaturase, even in cells with wild-type levels of
"free" Cyt b5, resulted in
unsaturated fatty acid auxotrophy (Mitchell and Martin, 1995
). Since
OLE1 complements ole1 mutants in a Cyt b5-deletion yeast strain (unlike the
rat
9-desaturase, which lacks the C-terminal
Cyt b5 domain), this implies that the
100-residue extension present in OLE1 functions as the electron donor
(Mitchell and Martin, 1995
). However, in that study, the disruption of
the Cyt b5 domain was achieved via an
internal 100-bp deletion, which may have resulted in a perturbation of the secondary structure of the enzyme and rendered it nonfunctional.
Although it is possible that the presence of a fused Cyt
b5 domain allows for a more efficient
reaction mechanism, it is interesting that none of the acyl-desaturases
with
12- and
15-regio-selectivities (Arondel et al., 1992
;
Okuley et al., 1994
) or the related oleate hydroxylase (van de Loo et
al., 1995
) have a Cyt b5 domain, even
though the
12- and
15-desaturases are much more prevalent in the
plant kingdom. However, all of the enzymes that contain N-terminal Cyt
b5 domains are involved in
"proximal" or "front-end" modifications of lipid substrates, and it is possible that this fusion is an obligate requirement for
correct function of this distinct class of proteins (Sperling et al.,
1998
; Napier et al., 1999
).
Recently, we isolated a cDNA clone (pBdes6) encoding the microsomal
fatty acid
6-desaturase from developing seeds of borage
(Borago officinalis). This cDNA encoded a protein with a
N-terminal Cyt b5 fusion domain and
was functionally characterized by expression in transgenic tobacco
plants, resulting in the accumulation of
-linolenic acid (GLA;
18:36,9,12) and octadecatetraenoic acid (OTA;
18:46,9,12,15) (Sayanova et al., 1997
).
As part of our continuing studies on this enzyme, we sought
to determine the functional role of the Cyt
b5 domain. We used two complementary
approaches, N-terminal deletion and site-directed mutagenesis, to
define this domain. Thus, two N-terminally truncated forms of the
borage
6-desaturase were generated, as well as
a point-mutated form in which the conserved His (His-41) of the
heme-binding HPGG motif was replaced with an Ala. These three mutant
forms of the desaturase were expressed in transgenic Arabidopsis and
functionally compared with lines expressing the full-length wild-type
borage
6-desaturase.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid Construction for Plant Expression
PCR products encoding N-terminally deleted forms of the
6-desaturase were amplified by removing 112 and 146 residues from the N terminus of the borage
6-fatty acid desaturase. Two oligonucleotides
were synthesized based on the pBdes6 coding sequence: primer M2,
5'GCGTCGACATGTTTGCAACTTTGTGC 3' (annealing to
the Met-113, indicated in boldface type) and primer M3,
5'-GCGTCGACATGGGGTTTCTTTGGATTC-3' (annealing to
the Met-147, indicated in boldface type). The SalI
restriction site is underlined. Reverse primer D,
containing a SmaI site, was as described in
Sayanova et al. (1997)
and these primers were used for PCR
amplification with pBdes6 as described previously. Reactions were run
on a DNA thermal cycler (Perkin-Elmer Cetus, Foster City, CA) using a
program of 1 min at 94°C, 1 min at 55°C, and 2 min at 72°C for 32 cycles, followed by extension for 10 min at 72°C. PCR amplification
products were gel-purified and subcloned into vector pJD330. Digestion
of the two resulting plasmids with XbaI released fragments
containing ORFs of different lengths (starting either with Met-113 or
Met-147 and designated
112 and
146, respectively), together with
the CaMV 35S promoter containing an
-translational enhancer and the
nopaline synthase (nos) termination sequence. These
XbaI-fragments were gel-purified and cloned into pBIN19 to
generate plasmids pBdesM2 and pBdesM3, which were transformed into
Agrobacterium tumefaciens strain GV 3101 + VirG+) by electroporation.
Plant Transformation
The Columbia ecotype of Arabidopsis was transformed by A. tumefaciens-mediated transformation according to the in planta
vacuum infiltration method (Bechtold et al., 1993
) Transformed seeds were selected on plates containing selective medium: Murashige and
Skoog basal salts (4.3 g/L), 10 g/L Suc, and 50 mg/L kanamycin. Kanamycin-resistant seedlings (the T1 generation)
were transferred to soil for production of T2 seeds.
Fatty Acid Analysis
Fatty acids from seeds, roots, siliques, and leaves were extracted
and transmethylated according to the method of Miquel and Browse
(1992)
. Analyses of fatty acid methyl esters (FAMEs) were carried out
using a GC (model 5880A, Hewlett-Packard, Wilmington, DE) equipped with
a 25- × 0.32-mm bonded capillary column (RSL-500BP, Hewlett-Packard) with a flame ionization detector. Fatty acids were identified by comparison of retention times with FAME standards (Sigma, St. Louis) separated on the same GC.
Site-Directed Mutageneses
Mutagenesis of His-41 to Ala was performed using a site-directed mutagensis kit (QuikChange, Stratagene, La Jolla, CA) according to the manufacturer's protocol. Two mutagenic oligonucleotide primers, each complementary to the opposite strands of the p35Bdes6 construct, were synthesized as shown.
Forward primer A, 5'GATTGGGTGAAAGACGCTCCAGGTGGCAGC 3', and
reverse primer B, 5'GCTGCCACCTGGAGCGTCTTTCACCCAATC 3'. The
bold letters indicate altered nucleotides. Mutation of His-41 to Ala
was performed on the plant expression construct containing the borage
6-desaturase coding sequence. The sequence of
the mutated fragment was checked for the presence of the correct
alteration and was used to ensure that other mutations had not
occurred. This plasmid was used for Arabidopsis transformation via
A. tumefaciens (see above).
Nothern-Blot Analyses
RNA from expanding Arabidopsis leaves was extracted using a kit
(RNAeasy, Qiagen, Valencia, CA). About 10 µg of total RNA was run on
1% (v/v) formaldehyde gel and transferred to a nylon membrane (Hybond
N+, Amersham, Uppsala) according to the
manufacturer's protocol. Probes were made from the truncated
146
form of the pBdes6 cDNA by random priming using a kit (Prime-it II,
Stratagene) according to the supplier's instructions.
| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
Expression of a
6 Fatty Acid Desaturase Gene in
Arabidopsis
The full-length (wild-type) borage
6-desaturase cDNA (Sayanova et al., 1997
) was
initially expressed in Arabidopsis plants and the distributions of
fatty acids in total lipid fractions prepared from leaves, roots,
siliques, and seeds compared with those in control transformants (Table
I). GLA and OTA accumulated to levels of
4.8% and 9.4% of the total fatty acids, respectively (all fatty acid
percentages are expressed as a mole percentage of the total). This bias
toward the accumulation of OTA may be have been due to the preference
of the
6-desaturase for
-linolenic acid as
a substrate or to high levels of endogenous leaf
15-desaturase activity, reducing the levels of
linoleic acid available for conversion to GLA. The endogenous levels of
both 18:2 and
-18:3 in roots were reduced by expression of the
borage
6-desaturase, with a significant
increase in GLA. In mid-stage (S2) developing seeds, the accumulation
of GLA and OTA was low (Table I) and declined to undetectable levels as
the seeds matured (data not shown). This may have been due to reduced
levels of the
6-desaturase enzyme (as a result
of reduced promoter activity) or to the exclusion of
6-desaturated fatty acids from seed lipids by
endogenous acyltransferases.
|
We recently determined the lipid classes present in the vegetative
tissues of homozygous lines of transgenic tobacco plants expressing the
borage
6-desaturase (Sayanova et al., 1997
)
and also in seed tissue (O. Sayanova, P.R. Shewry, and J.A. Napier,
unpublished data). GLA accumulated in the leaves of the transgenic
tobacco plants at levels between 12.9% of total fatty acids in young
leaves and 20.1% in mature leaves, with OTA levels of 8.5% and
14.9%, respectively. However, there was only a low level of
accumulation of GLA (2.6%) in mature seeds with insignificant levels
of OTA. Thus, there is a difference in the proportions of the GLA and
OTA in Arabidopsis and tobacco leaves, with GLA being the predominant
6-fatty acid in tobacco and OTA being
predominant in Arabidopsis. This difference may reflect the relative
levels of desaturation occurring in the chloroplasts of the two
species, as some 50% of cellular glycerolipids are synthesized in the
plastids of 16:3 plants such as spinach and Arabidopsis, compared with
only about 20% in 18:3 plants such as tobacco. Such observations
confirm the contribution of the plastid in glycerolipid synthesis
(Somerville and Browse, 1991
), especially in 16:3 species such as Arabidopsis.
Truncation of the Cyt b5-Domain of the
Borage
6 Fatty Acid Desaturase
Comparison of the deduced amino acid sequences of the borage
6-desaturase with other microsomal desaturases
indicated that borage protein contained an N-terminal Cyt
b5 domain, with residues 1 to 112 corresponding to the hydrophilic portion of microsomal Cyt
b5 (see Fig.
1.). If this N-terminal Cyt
b5 domain was the result of a gene
fusion event, then Met-113 in the borage
6-desaturase could correspond to the
initiating Met of the ancestral desaturase domain. Alternatively, the
ancestral desaturase ORF could start at Met-147, which corresponds to
the end of plant microsomal Cyt b5
(Fig. 1). To determine whether the desaturase domain of the borage
6-enzyme could function with other
(independent) electron donors instead of its own (linked) Cyt
b5 domain, two truncations of the
N-terminal domain were generated by deleting either the first 112 or
146 residues. These deletions, designated
112 and
146, respectively, were expressed in transgenic Arabidopsis plants.
|
GC of FAMEs prepared from leaf lipids showed no evidence of GLA or OTA
in the control transformants or in plants transformed with
112 and
146, in contrast to plants transformed with the full-length Cyt
b5
6-fatty
acid desaturase fusion. Northern analysis was therefore performed to
confirm that the truncated forms of the borage
6-desaturase were expressed in the transgenic
Arabidopsis lines (Fig. 2). This analysis
showed that the full-length and truncated forms of the borage
desaturase had reduced levels of transcript accumulation, although all
constructs were driven by the same promoter (CaMV 35S). In particular,
transcripts of the more severe N-terminal deletion (
146) appeared to
be less stable, as judged by the signal from the northern blot.
|
It is possible that the failure to detect
6-fatty acids in plants expressing the deleted
forms of the desaturase could be due to alterations in mRNA processing
or translation of the synthetic transgene, rather than from any loss of
enzyme activity. Alternatively, deletion of the Cyt
b5 domain could result in aberrant
folding of the modified desaturase, rendering the enzyme nonfunctional or reducing stability. Unfortunately, the lack of a suitable antibody prevented us from comparing the levels of wild-type and N-terminally deleted forms of the
6-desaturase. The role of
the C-terminal Cyt b5 domain of the
yeast OLE1
9-desaturase was similarly studied
via internal deletion of 34 amino acid residues by restriction
digestion and re-ligation (Mitchell and Martin, 1995
). In that study,
the mutated form of OLE1 was nonfunctional. Moreover, in
gene-replacement yeast strains, steady-state transcripts for the mutant
OLE1 were at a reduced level compared with that observed for the
wild-type OLE1 gene. An equally important observation was that even in
the functional OLE1 enzyme, the protein displayed a very short
half-life (<2 mins) (Mitchell and Martin, 1995
); therefore, altered
forms of the protein may be even less stable.
Site-Directed Mutagenesis
In view of our results for the truncated
6-desaturase and the above-mentioned studies
of Michell and Martin (1995)
on the OLE1
9
desaturase, it was clear that a different approach was required to
study the role of the Cyt b5 domain.
Site-directed mutagenesis is a more precise tool for the definition of
important amino acid determinants in a protein, and such mutations
would not be expected to affect mRNA stability and translational
efficiency. We therefore mutated the highly conserved His of the HPGG
heme-binding domain in the N-terminal Cyt
b5 extension. This residue is
considered essential for the function of Cyt
b5 by acting as a heme ligand (Lederer, 1994
). His-41 was converted to Ala by a 3-bp mutation in the
desaturase coding sequence. Ala was chosen as the replacement residue
because it is uncharged and should therefore not be able to act as a
heme-binding residue. The mutated
6-desaturase
(named H41A) was introduced into Arabidopsis, and a number of
transgenic lines were regenerated. GC analysis of the leaf lipids
extracted from these transgenic plants again showed no accumulation of
GLA and OTA (data not shown; compared with approximately 15%
6 desaturate fatty acids in line AT6
expressing the wild-type
6-desaturase; compare
with Table I), although northern blots showed mRNA levels equivalent to
that in plants expressing the wild-type borage enzyme (Fig.
3). This suggests that the conserved
residue His-41 of the HPGG-binding domain is likely to be essential for enzymatic function of the
6-fatty acid
desaturase and is most likely to coordinate the axial heme-binding
center of that domain.
|
The above results also suggest that the presence of an N-terminal Cyt
b5 domain in the so-called front-end
desaturases (i.e. enzymes that desaturate between pre-existing double
bonds and the carboxyl-group) has arisen as an integral part of the
reaction mechanisms of this class of enzymes. The situation for other
desaturase-like enzymes involved in proximal lipid modification is less
clear and is summarized in Table II. The
presence of an N-terminal Cyt b5
domain has been observed in higher plant
8-sphingolipid desaturase
(Sperling et al., 1998
) and in yeast FAH1 sphingolipid
-hydroxylase
(Mitchell and Martin, 1997
). However, in FAH1, an Arabidopsis
homolog of this enzyme did not contain any domain with homology to
Cyt b5. When this plant FAH1 homolog was expressed in yeast fah1 deletion mutants, it was capable
of
-hydroxylation of substrate long-chain fatty acids. However, the
plant enzyme did not fully restore hydroxylated fatty acids to
wild-type levels even though it was overexpressed via a
GAL1 promoter on a multicopy plasmid (Mitchell and Martin, 1997
). It may be that the efficiency/activity of the (Cyt
b5 domain-lacking) plant enzyme is
reduced, though obviously other factors (such as expression in a
heterologous system) could also be influential. The authors of that
study also noted the presence of an N-terminal Cyt
b5 domain in a putative FAH1 homolog
from C. elegans, but this domain was missing in a
Schizosaccharomyces pombe FAH1 homolog. This would indicate
that, at least in the
-hydroxylation of the sphingolipid long-chain
fatty acids, the Cyt b5 domain is not an obligate requirement for enzyme function. This is in contrast to our
observations with the
6-fatty acid desaturase
and to that reported for the OLE1
9-desaturase
(Mitchell and Martin, 1995
). It will be of interest to determine if
further examples of front-end fatty acid-modifying enzymes exist as
fusions with their electron donor.
|
| |
CONCLUSIONS |
|---|
|
|
|---|
We have shown that His-41 of the Cyt
b5 domain is likely essential for the
enzymatic activity of the borage
6-fatty acid
desaturase, as determined by site-directed mutagenesis and expression
in transgenic plants. These results support the hypothesis that the
presence of a N-terminal Cyt b5 domain
in this front-end desaturase is an obligate requirement for enzymatic activity.
| |
FOOTNOTES |
|---|
Received April 28, 1999; accepted July 1, 1999.
1 IACR-Long Ashton Research Station receives granted-aided support from the Biotechnology and Biological Sciences Research Council, UK. This work was partially funded by Scotia Pharmaceuticals (Stirling, UK).
* Corresponding author; e-mail jon.napier{at}bbsrc.ac.uk; fax 44-1275-549225.
| |
LITERATURE CITED |
|---|
|
|
|---|
6 desaturase.
J Biol Chem
274: 4711-4717
6-acyl-group desaturase by targeted gene disruption in Physcomitrella patens.
Plant J
15: 39-48
[CrossRef][Web of Science][Medline]
12 desaturation of oleic acid by microsomes of safflower (Carthamus tinctorius L.).
Arch Biochem Biophys
284: 431-436
[CrossRef][Web of Science][Medline]
5-desaturase from Mortierella alpina by heterologous expression in Baker's yeast and canola.
J Biol Chem
273: 29360-29366
9 fatty acid desaturase gene from Cryptococcus curvatus ATCC 20509 containing histidine boxes and cytochrome b5 domain.
Appl Microbiol Biotechnol
47: 663-667
[CrossRef][Medline]
5-fatty acid desaturase gene from Mortierella alpina.
J Biol Chem
273: 19055-19059
5-desaturase gene from Caenorhabditis elegans.
FEBS Lett
439: 215-218
[CrossRef][Web of Science][Medline]
9 fatty acid desaturase.
J Biol Chem
270: 29766-29772
-hydroxylation of sphingolipid-associated very long chain fatty acids.
J Biol Chem
272: 28281-28288
6-fatty-acid-desaturase by heterologous expression in Saccharomyces cerevisiae.
Biochem J
330: 611-614
6-desaturated fatty acids in transgenic tobacco.
Proc Natl Acad Sci USA
94: 4211-4216
12-desaturase (
12-desaturase) in microsomal preparations from developing safflower (Carthamus tinctorius L.) cotyledons.
Biochem J
272: 23-29
[Web of Science][Medline]This article has been cited by other articles:
![]() |
S. Kaewsuwan, E. B. Cahoon, P.-F. Perroud, C. Wiwat, N. Panvisavas, R. S. Quatrano, D. J. Cove, and N. Bunyapraphatsara Identification and Functional Characterization of the Moss Physcomitrella patens {Delta}5-Desaturase Gene Involved in Arachidonic and Eicosapentaenoic Acid Biosynthesis J. Biol. Chem., August 4, 2006; 281(31): 21988 - 21997. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Guillou, S. D'Andrea, V. Rioux, R. Barnouin, S. Dalaine, F. Pedrono, S. Jan, and P. Legrand Distinct roles of endoplasmic reticulum cytochrome b5 and fused cytochrome b5-like domain for rat {Delta}6-desaturase activity J. Lipid Res., January 1, 2004; 45(1): 32 - 40. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Lesa, M. Palfreyman, D. H. Hall, M. T. Clandinin, C. Rudolph, E. M. Jorgensen, and G. Schiavo Long chain polyunsaturated fatty acids are required for efficient neurotransmission in C. elegans J. Cell Sci., December 15, 2003; 116(24): 4965 - 4975. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hong, N. Datla, D. W. Reed, P. S. Covello, S. L. MacKenzie, and X. Qiu High-Level Production of gamma -Linolenic Acid in Brassica juncea Using a Delta 6 Desaturase from Pythium irregulare Plant Physiology, May 1, 2002; 129(1): 354 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Sayanova, F. Beaudoin, B. Libisch, A. Castel, P. R. Shewry, and J. A. Napier Mutagenesis and heterologous expression in yeast of a plant {Delta}6-fatty acid desaturase J. Exp. Bot., July 1, 2001; 52(360): 1581 - 1585. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|