INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Calmodulin is highly conserved in eukaryotes and is considered to be a multifunctional protein because of its ability to interact and regulate the activity of a number of other proteins (Hepler and Wayne, 1985; Gilroy et al., 1993; Poovaiah and Reddy, 1993; Trewavas and Knight, 1994). In plant cells, calmodulin is considered to be the primary sensor for changes in cellular free Ca²⁺ levels ([Ca²⁺]_i) (Roberts and Harmon, 1992). As [Ca²⁺]_i rises transiently after signaling, the combination of Ca²⁺ with calmodulin leads to the activation of numerous target proteins initiating the physiological response.

Calmodulin has been purified and characterized from a number of plant species. Genomic and/or cDNA clones encoding calmodulin have been isolated and characterized from Arabidopsis (Ling et al., 1991; Perera and Zielinski, 1992), potato (Takezawa et al., 1995), and wheat (Yang et al., 1996). In all multicellular organisms in which it has been examined, genes encoding the different calmodulin isoforms are under the control of different promoters that exhibit distinct temporal and spatial expression (Ling et al., 1991; Gannon and McEwen, 1994; Shimoda et al., 1995; Solà et al., 1996). In plant cells, stimuli such as touch, wind, or temperature shocks induce the rapid accumulation of mRNA levels encoding calmodulin and calmodulin-related proteins (Jena et al., 1989; Braam, 1992; Perera and Zielinski, 1992; Watillon et al., 1992; Takezawa et al., 1995). Since many of these signals also elevate [Ca²⁺]_i (Knight et al., 1991, 1992, 1997), and artificial elevation of [Ca²⁺]_i in cultured cells increases calmodulin mRNA accumulation (Braam, 1992), it has been suggested that the transduction of environmental signals regulating calmodulin gene expression are in part regulated by [Ca²⁺]_i levels (Braam and Davis, 1990; Braam, 1992).

Calmodulin has been detected in several plant cell compartments (Biro et al., 1984; Collinge and Trewavas, 1989). In particular, a substantial amount of calmodulin has been found in both plant and animal nuclei and in combination with nuclear Ca²⁺ signals, gene expression is thought to be regulated via Ca²⁺/calmodulin interaction with transcription factors or via specific protein kinases (Bachs et al., 1992; Gilchrist et al., 1994; Kocsis et al., 1994; Zimprich et al., 1995; Szymanski et al., 1996).

Plants transformed with a cDNA encoding the Ca²⁺-sensitive luminescent protein aequorin provides a simple, non-invasive means of measuring [Ca²⁺]_i in whole plants. Many new signals initiating rapid changes in [Ca²⁺]_i have subsequently been detected with this technology, including the mechanical signals of touch and wind, salt/drought, heat shock, and osmotic pressure (Trewavas and Knight, 1994; Haley et al., 1995; Knight et al., 1996, 1997; Takahashi et al., 1997; Gong et al., 1998). Furthermore, aequorin targeted to chloroplasts (Johnson et al., 1995) and the vacuole membrane (Knight et al., 1996) clearly indicated that the [Ca²⁺]_i signal is strictly compartmentalized within the cell.

In a previous paper (Knight et al., 1992), wind and cold shock stimulation were investigated in tobacco (Nicotiana plumbaginifolia) seedlings. Mechanical stimulation induced by puffs of air blown over the seedling resulted in a slight movement of the seedling around the hypocotyl/root junction lasting about 0.02 to 0.3 s. Temperature shocks can be induced by irrigating the plant briefly with cold water at 0°C to 5°C. Both signals induce [Ca²⁺]_i spikes in aequorin transgenic tobacco seedlings. However, careful titration with different inhibitors suggested specific spatial organization of the Ca²⁺ signal depending on the type of stimulation. Ruthenium red at low concentrations specifically blocked the transient induced by wind or touch and did not affect the cold shock [Ca²⁺]_i transient; lanthanum and gadolinium chlorides, which are Ca²⁺-channel blockers, specifically blocked the cold shock signal without influencing the wind-induced [Ca²⁺]_i transient. It was concluded that the two signals were mobilizing separate pools of [Ca²⁺]_i.

At present, no direct evidence is available to indicate whether compartmentalization of the Ca²⁺ signal is significant for other downstream responses such as calmodulin gene expression. To address this question, we created a fusion protein between nucleoplasmin (a major oocyte nuclear protein) and aequorin, which was then used to transform tobacco seedlings. Transfection of animal cells with this construct allowed measurement of nuclear Ca²⁺ concentrations and indicated the presence of compartmentalized regulation of Ca²⁺ signaling pathways (Badminton et al., 1995, 1996, 1998). The use of the same construct in plant cells could help to clarify the Ca²⁺ signaling pathways involved in the control of calmodulin gene expression by wind stimuli and cold shock.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

All enzymes used for recombinant DNA manipulation were purchased from Promega Biotech (Southampton, UK). Plasmid DNA isolation kits were obtained from Qiagen (Dorking, UK), agar was from Difco Laboratories (Detroit), and all plant tissue culture reagents and other chemicals were from Sigma (Dorset, UK). Exceptions were 1,2-bis(o-aminophenoxy)ethane-N;N;N;N-tetraacetic acid-acetoxymethyl ester (BAPTA-AM) from Calbiochem (Nottingham, UK) and ruthenium red from LC Laboratories (Woburn, MA). Macerozyme and cellulase used for the production of protoplasts were from Yakult Honsha (Tokyo). Native coelenterazine and cp-coelenterazine were purchased from Molecular Probes (Leiden, The Netherlands). Oligonucleotide primers were prepared by Genosys (Cambridge, UK).

Plant Materials and Growth Conditions

MAQ 2.4, the transgenic tobacco (Nicotiana plumbaginifolia) line that expresses cytosolic aequorin (Knight et al., 1991), was used to measure changes in cytosolic free Ca²⁺ concentrations ([Ca²⁺]_cyt). All seedlings used for experiments were grown on one-half-strength Murashige and Skoog medium (Murashige and Skoog, 1962) and 0.8% (w/v) agar either in luminometer cuvettes or on plates at 25°C with a 16-h photoperiod, and used when 7 to 10 d old.

Design and Expression of Nuclear-Targeted Chimeric Aequorin

To target aequorin to plant nuclei, a chimeric construct in which the nucleoplasmin coding region was placed in frame with the coding region of apoaequorin (Badminton et al., 1995; kindly provided by Dr. M. Badminton, University of Wales, UK) was cloned into pDH51 (Pietrzak et al., 1986) as a SmaI-SalI fragment. The entire construct, including the 35S promoter and terminator, was cloned into the Agrobacterium tumefaciens binary vector pBIN19. Escherichia coli JM101 and XL-1 Blue were used as hosts for all recombinant DNA manipulations (Sambrook et al., 1989). A. tumefaciens LBA4404 and N. plumbaginifolia were used for plant genetic transformation (Draper et al., 1988).

Immunolocalization of Aequorin

For immunolocalization using fluorescein isothiocyanate (FITC)-labeled secondary antibodies, protoplasts were washed and pelleted in 0.5% (w/v) MES (pH 5.8), 80 mM CaCl₂, 300 mM mannitol, and fixed for 15 min on poly-L-Lys treated slides using 4% (w/v) paraformaldehyde. Cells were permeabilized for 40 min with 0.5% (v/v) Triton X-100 in 50 mM PIPES (pH 6.9), 5 mM MgSO₄, 5 mM EGTA, and 300 mM mannitol. Samples were incubated for 5 min with 1% (w/v) BSA followed by a 1.5-h incubation at 37°C with mouse anti-aequorin (1:1,000) obtained as previously described (Knight et al., 1991), and then with FITC-labeled goat anti-mouse IgG from Sigma (Dorset, UK) (1:30) in PBS (pH 5.8), 1% (w/v) BSA, 20 mM NaN₃ for 45 min at 37°C. Cells were stained with DAPI, mounted in Citifluor (Citifluor Products, Kent, UK), and photographed with an epifluorescence microscope (Polyvar, Reichert-Jung, Vienna, Austria) using Ektachrome T film (ASA 64, Eastman-Kodak, Rochester, NJ).

For immunoelectron microscopy using gold-labeled secondary antibodies, protoplasts were prepared as described above and fixed for 15 min using PBS-buffered one-fourth-strength Karnovsky's fixative at pH 5.8 (Karnovsky, 1965). The fixed tissue was dehydrated by consecutive 10-min incubations in 30%, 50%, 70%, and 90% (v/v) ethanol, and for 20 min in three changes of dehydrated absolute ethanol followed by propylene oxide (twice for 15 min). The embedding of fixed and dehydrated tissue was carried out using resin from Agar Scientific (Essex, UK). Thin sections (80-90 nm) placed on gold grids were incubated in 1% (w/v) BSA in PBS for 5 min at room temperature. Sections were incubated with mouse anti-aequorin (1:200) obtained as previously described (Knight et al., 1991) for 2 h at room temperature or for 18 to 24 h at about 4°C in a moist chamber. The antisera or immunosorbent-purified antibodies were diluted in 1% (w/v) BSA-PBS (pH 7.4). The grids were placed on drops of a 20-fold dilution of the 1 nM gold-labeled goat anti-mouse IgG solution from British Biocell International (Cardiff, UK) for 1 h at room temperature in a moist chamber. The sections were stained with 5% (v/v) uranyl acetate (5-7 min), and washed thoroughly with distilled water and PBS and a subsequent Reynold's lead citrate solution (2-5 min). Gold particles were stained with a silver enhancement kit from Sigma prior to examination using an electron microscope (model 100S, JEOL, Hartfordshire, UK).

In Vitro and in Vivo Aequorin Reconstitution, Wind and Cold Shock Stimulation, and Ca²⁺ Measurements

For in vitro reconstitution of aequorin, seedlings were homogenized in 50 mM Tris-Cl (pH 7.4), 500 mM NaCl, 5 mM -mercaptoethanol, 10 mM EGTA, and 0.1% (w/v) BSA, incubated with 2 µM coelenterazine for at least 4 h in the dark, discharged by adding an equal volume of 100 mM CaCl₂ (Knight et al., 1991), and the total amount of luminescence produced was measured. Luminescence was measured using a digital chemiluminometer consisting of an photomultiplier (model 9829A, EMI, Middlesex, UK) with a cooling system (FACT50, EMI) (Badminton et al., 1995). For in vivo reconstitution of aequorin, seedlings were germinated as described above. Aequorin was reconstituted in vivo by placing a 3-µL droplet of 2 µM coelenterazine between the cotyledons and incubating at least 4 h in the dark.

For experiments with inhibitors, seedlings were submerged and incubated for 4 h. A long period is needed to allow the compounds to penetrate into the seedling. Following this treatment, the liquid was drained and a 3-µL droplet of 2 µM coelenterazine with the relevant inhibitor was placed between the cotyledons and left for at least another 4 h in the dark, after which time the liquid was removed and the luminescence measurement carried out. Wind stimulation was simulated by instantly injecting 5 mL of air into the sample housing of the luminometer. Cold shock was simulated by slowly injecting 1 mL of ice-cold water into the sample housing of the luminometer. The light emitted by the seedling is a measure of the change in the [Ca²⁺]_i and was recorded every 0.2 s using a cooled photomultiplier tube.

For measurement of changes in cytosolic Ca²⁺ native coelenterazine, we used the luminophore used in our previous experiments (Knight et al., 1991, 1992). Initial investigations showed nuclear Ca²⁺ changes to be smaller than those in the cytoplasm in response to cold shock. To reduce errors in the measurement of emitted light, the more sensitive cp-coelenterazine was used, which enabled approximate equality in light emission measurements between the cytosolic and nuclear compartments (Shimomura et al., 1993). Reconstituted cp-aequorin shows improved light emission in the lower Ca²⁺ ranges and is thus useful for detecting smaller changes in [Ca²⁺]_i (Shimomura et al., 1993). Calibration constants for cp-coelenterazine (and many other coelenterazines) in comparison with native coelenterazine have been published previously (Shimomura et al., 1993). The luminescent light was calibrated into Ca²⁺ concentrations by a method based on the calibration curve of Allen et al. (1977): L/L_max = ([1 + K_R × {Ca²⁺}]/[1 + K_TR + K_R × {Ca²⁺}])³, where L is the amount of light per second, L_max is the total amount of light present in the entire sample over the course of the experiment, [Ca²⁺] is the calculated Ca²⁺ concentration, K_R is the dissociation constant for the first Ca²⁺ ion to bind, and K_TR is the binding constant of the second Ca²⁺ ion to bind to aequorin; K_R = 26 × 10⁶ M¹ and K_TR = 57 M¹ for cp-coelenterazine (Shimomura et al., 1993) and K_R = 2 ×10⁶ M¹ and K_TR = 55 M¹ for native coelenterazine.

Total RNA Extraction, RACE (3' RACE), and Northern-Blot Analysis

Total RNA from seedlings was extracted according to the method of López-Gómez and Gómez-Lim (1992), a method designed to obtain RNA free of polysaccharide contamination. Seedlings for RNA extraction were 7 to 10 d old and grown under the same conditions as seedlings for luminometry. Inhibitors were applied for a 4-h period, after which time the solution was drained and the seedlings were allowed to recover overnight.

For 3'-RACE, total RNA was extracted from unstimulated seedlings (T₀), 1 h after wind stimulation (T₁W), and 2 h after cold shock stimulation (T₂CS). cDNA was synthesized from 5 µg of total RNA in a buffer consisting of 50 mM Tris-Cl (pH 8.3), 3 mM MgCl₂, 75 mM KCl, 10 mM DTT, and 0.5 µM of each dNTP, 10 units of RNasin (Promega Biotech), 100 ng µL¹ of dT₁₇-adapter primer, Q_T (5'- CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGC- TT₁₇VN-3', with V = G, C, A and N = G, C, T, A), 10 units of SuperScript II RNase H reverse transcriptase from Life Technologies (Paisley, UK) in a total volume of 20 µL. The mixture was incubated for 5 min at room temperature, for 1 h at 42°C, for 10 min at 50°C, and for 15 min at 70°C. The RNA was then removed with 0.2 unit of RNase H from Life Technologies and the whole reaction was diluted with 1 mL of TE buffer (10 mM Tris-Cl [pH 7.6] and 1 mM EDTA) to produce the cDNA pool for amplification.

For amplification, a PCR cocktail was prepared consisting of: 5 µL of 10× PCR buffer (670 mM Tris-Cl, pH 8.8, 67 mM MgCl₂, 17 mg mL¹ BSA, 166 mM [NH₄]₂SO₄), 5 µL of DMSO, 5 µL of 10× dNTPs (10 mM each), and 30 µL of distilled water, 1 µL of adapter primer, Q_i (ACGAGGACTCGAGCTCAAGC, 25 pmol µL¹), 1 µL of a calmodulin-specific primer, E086 (GCATCACGACTAAGGAGCTT, 25 pmol µL¹), and 1 µL of cDNA pool. The cDNA was denatured 5 min at 95°C and cooled to 72°C. Then 2.5 units of Taq polymerase and 30 µL of mineral oil were added. Primers were annealed and extended at 52°C or 56°C for 5 min and at 72°C for 40 min to ensure correct replication, respectively, followed by a 20- to 35-times cycle: 95°C for 40 s, 52°C or 56°C for 1 min, 72°C for 3 min, and ended by a 15-min incubation at 72°C to complete the reaction. NpCaM-1 (accession no. AJ005039) and NpCaM-2 (accession no. AJ005040) were cloned using the pCR-Script Amp SK(+) cloning kit from Stratagene (Cambridge, UK) and used for sequence analysis.

Sequence analysis was carried out on both the DNA strands in quadruple. For each strand, sequencing reactions were performed using a dye-terminator cycle sequencing ready reaction kit (PRISM, ABI, Perkin-Elmer, Cheshire, UK) and sequenced using an automatic sequencer (Perkin-Elmer).

For northern-blot analysis, 5 to 15 µg of total RNA was size-fractionated on a 1.3% (w/v) denaturing-formaldehyde agarose gel (Sambrook et al., 1989). To ensure that an equal amount of RNA was loaded, a picture of the ethidium bromide-stained gel was taken, scanned, and quantified with Imagequant software (Molecular Dynamics, 's-Hertogenbosch, The Netherlands). The 3'-untranslated regions (UTRs) of NpCaM-1 and NpCaM-2 were used as DNA hybridization probes and were labeled with [³²P]dCTP by random-primed labeling from Amersham (Buckinghamshire, UK), and hybridized in 4× SSC, 1% (w/v) SDS, 200 mM Tris-Cl (pH 7.6), 10% (w/v) dextran sulfate, 100 µg mL¹ herring-sperm DNA, and 2× Denhardt's solution, at 65°C overnight, and washed for 20 min in 2× SSC at 65°C, followed by a brief wash in 2× SSC, 1% (w/v) SDS at room temperature. Filters were either exposed to HyperfilmMP from Amersham or a phosphor plate, and imaged with a phosphor imager from Molecular Dynamics. Intensities of hybridizing bands were quantified using Imagequant software.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Transformation of Tobacco with a Nucleoplasmin Aequorin Construct and Localization of the Expressed Fusion Protein

Wind and cold shock stimulation initiate specific Ca²⁺ signaling pathways (Knight et al., 1992). The use of different inhibitors suggested the specific organization of the Ca²⁺ signal depending on the type of stimulation. To investigate the organization of the Ca²⁺ signal in more detail, we transformed tobacco with a nucleoplasmin/aequorin construct. This construct was used previously (Badminton et al., 1995, 1996, 1998) to investigate the putative independence of the regulation of nuclear ([Ca²⁺]_nuc) and cytoplasmic ([Ca²⁺]_cyt) Ca²⁺ in transfected mammalian cell lines. Nucleoplasmin is an abundant nuclear protein in Xenopus laevis oocytes (Philpott and Leno, 1992).

After leaf disc transformation, 7-d-old F₁ seedlings of >20 individual transformants were homogenized in 50 mM Tris-Cl (pH 7.4), 500 mM NaCl, 5 mM -mercaptoethanol, 10 mM EGTA, and 0.1% (w/v) BSA, aequorin was reconstituted with added coelenterazine overnight as described previously (Knight et al., 1991, 1993, 1996), and aequorin levels were measured by light emission. Homogenates of all transformants were separated on SDS gels and the relative amounts of apoaequorin confirmed using western blotting and mouse anti-apoaequorin as described previously (Knight et al., 1991). The transformant containing the highest levels of expression was designated MAQ 7.11.

The cellular distribution of the nucleoplasmin/aequorin fusion protein was examined using immunocytochemistry with anti-apoaequorin and either FITC or gold-labeled secondary antibodies. Protoplasts were isolated from mature leaves of untransformed tobacco and from MAQ 2.4 and MAQ 7.11 containing the nucleoplasmin/aequorin construct, and stained for apoaequorin distribution. Figure 1, A to C, shows protoplasts stained first with 4',6-diamidino-2-phenylindole dihydrochloride or DAPI (to highlight DNA) and then stained with anti-apoaequorin followed by fluorescent secondary antibody (Fig. 1, D-F). The distribution of staining between the MAQ 2.4 and the MAQ 7.11 construct is clearly very different. The aequorin is distributed throughout the cytoplasm of the highly vacuolated protoplasts of MAQ 2.4 (Fig. 1, B and E), while the nucleoplasmin/aequorin construct is predominantly concentrated in the nuclear region of the protoplasts for MAQ 7.11 (Fig. 1, C and F).

View larger version (88K): [in this window] [in a new window]   Figure 1.   Targeting of aequorin to tobacco cell nuclei. Protoplasts of wild-type tobacco, MAQ 2.4, and MAQ 7.11 stained with DAPI are shown in A, B, and C, respectively. The same protoplasts treated with anti-apoaequorin and FITC-labeled secondary antibody are shown in D, E, and F. G shows a MAQ 7.11 protoplast treated with anti-apoaequorin and gold-labeled secondary antibody. Bar = 1 µm. C, Cytoplasm; N, nucleus.

Confirmation of this distribution was obtained using gold-labeled secondary antibody. Figure 1G shows a nucleus and two associated areas of chloroplast/cytoplasm of a MAQ 7.11 protoplast. The intact nucleolus and nuclear envelope are clearly visible. Staining with gold-labeled secondary antibody revealed a gold particle distribution that was much more highly concentrated over the nuclear regions than the neighboring cytoplasm and strongly localized in dense chromatin. We quantified the gold particle distribution on a large number of sections and observed that 86% was localized in nuclei. Of the remainder, 9% was found in the chloroplasts and 5% in the cytoplasm. The distribution of nucleoplasmin/aequorin between the nucleus and other cytoplasmic compartments was similar to that reported for the distribution of nucleoplasmin in HeLa cells, 90% to 92% nuclear localization (Greber and Gerace, 1995), with a slightly higher proportion outside the nucleus.

Isolation of Wind- and Cold-Shock-Induced and Non-Induced Tobacco Calmodulin Genes

In all plants examined so far, calmodulin is represented by multigene families, and the individual calmodulin members exhibit both tissue-specific and developmental-stage-specific expression (Ling et al., 1991; Takezawa et al., 1995). As the length and the sequence of 3'-UTRs of calmodulin isoforms were reported to be different (Takezawa et al., 1995), 3'-RACE was carried out in tobacco to identify differentially expressed calmodulin genes. Using this technique, several potential calmodulin transcripts were identified. One of these putative calmodulin transcripts, designated NpCaM-1, appeared to be induced by wind and cold shock, while another, NpCaM-2, was not (data not shown). These two cDNAs were cloned and sequenced. In Figure 2, the partial sequence of two calmodulin isoforms is shown starting from the first Ca²⁺-binding site of calmodulin. The partial sequences of NpCaM-1 and NpCaM-2 are different in nucleotide sequence; however, they encode polypeptides with the same amino acid sequence. The 3'-UTRs were subcloned and used as DNA hybridization probes to study the expression kinetics of NpCaM-1 and NpCaM-2 using northern-blot analysis. As shown in Figure 3, this type of analysis indicated that NpCaM-1 mRNA accumulates after wind and cold shock signaling, whereas NpCaM-2 does not.

View larger version (46K): [in this window] [in a new window]   Figure 2.   Partial cDNA sequence of NpCaM-1 and NpCaM-2 showing nucleotide and predicted amino acid identities. A, Nucleotide sequence; B, amino acid sequence. Primers used for 3'-RACE and subsequent PCR are indicated in lowercase; stop codons are underlined. Homology is indicated with bars.

View larger version (26K): [in this window] [in a new window]   Figure 3.   Expression kinetics of NpCaM-1 and NpCaM-2 determined by northern-blot analysis after stimulation by a single wind signal or a single cold shock. The 3'-UTRs of NpCaM-1 and NpCaM-2 were used as DNA hybridization probes to study the expression kinetics of NpCaM-1 and NpCaM-2. Water of room temperature was used as a control.

Wind- and Cold-Shock-Induced Ca²⁺ Changes in MAQ 2.4 and MAQ 7.11 and NpCaM-1 mRNA Accumulation

Changes in [Ca²⁺]_cyt in tobacco seedlings in response to wind and cold shock have been previously reported (Knight et al., 1991, 1992). By constructing plants in which the distribution of aequorin is clearly different from cytoplasmic aequorin, we were able to examine the spatial organization of the Ca²⁺ signal in response to wind and cold shock. Prior to [Ca²⁺]_i measurements, coelenterazine was placed between the cotyledons to allow the reconstitution of aequorin. Wind and cold shock stimulation were achieved respectively by injecting air instantly or ice-cold water gently from above into the sampling housing of the luminometer. Conversions of emitted luminescence at each time point to free Ca²⁺ levels were performed as described in "Materials and Methods."

Figure 4 shows the effects of wind and cold shock signaling in MAQ 2.4 and MAQ 7.11. Because individual seedlings varied slightly in their absolute response, we have indicated only the SEs of the peak values. For wind response the mean peak Ca²⁺ increase in the MAQ 2.4 and MAQ 7.11 were, respectively, 1.08 µM (n = 7) and 0.79 µM (n = 8) (Fig. 4A) and 1.25 µM (n = 7) and 0.55 µM (n = 8) for the cold shock response (Fig. 4B).

View larger version (31K): [in this window] [in a new window]   Figure 4.   Wind- and cold-shock-induced changes in the cytosolic and nuclear free Ca2+ concentrations and the expression levels of NpCaM-1 and NpCaM-2. A, Ca2+ changes in cytoplasm (cyt) and nucleoplasm (nuc) after stimulation with 5 mL of air at t = 10 s. B, Ca2+ changes in cytoplasm (cyt) and nucleoplasm (nuc) after stimulation with 1 mL of ice-cold water at t = 10 s. C, Wind- ( and ) and cold-shock ( and )-induced changes in mRNA levels of NpCaM-1 and NpCaM-2 are indicated and are averages of three experiments. Data are shown as hybridization relative to non-induced mRNA levels (given a value of 1) and is plotted against time in minutes. , NpCaM-1; , NpCaM-2; , NpCaM-1; , NpCaM-2.

The kinetics of the signals in the nucleus and cytoplasm differ in response to both stimuli. For wind stimulation, the average rise time (the time required to reach the peak) for MAQ 2.4 (cytoplasm) was 0.31 ± 0.04 and 0.60 ± 0.04 s for MAQ 7.11. For cold shock the average rise times for MAQ 2.4 and MAQ 7.11 were, respectively, 4.8 ± 0.3 and 9.0 ± 1.1 s. The MAQ 7.11 signals always peaked later than those in the cytoplasm, and the peak value was always lower. In more recent unpublished studies of ours using heat shock, signal-induced elevations of MAQ 2.4 and MAQ 7.11 were separated by minutes (M. Gong, A.H. van der Luit, and A.J. Trewavas, unpublished observations). This response, a much later and lower peak value found in MAQ 7.11 (compared with cytoplasmic MAQ 2.4), was similar to that recorded for [Ca²⁺]_nuc in mammalian cells. The average length of the Ca²⁺ transient was similar in both compartments for wind stimulation, but was about 6 s longer in cold-shocked MAQ 7.11 compared with the cytoplasm.

In separate experiments, tobacco seedlings were given wind signals (one treatment of 5 mL of air) or cold shock signals (one treatment of 1 mL of ice-cold water) similar to those used for Figure 4, A and B. RNA was extracted and the levels of NpCaM-1 and NpCaM-2 mRNAs estimated from northern blots. These data (n = 3) are shown in Figure 4C. The total increase of NpCaM-1 mRNA after wind stimulation was about 5-fold after 60 to 90 min, whereas after cold shock it was about 10-fold after 90 to 120 min. NpCaM-2 exhibited only a slight increase throughout the experimental period.

Use of Inhibitors on MAQ 2.4 and MAQ 7.11 Emphasize That Spatially Separate Ca²⁺ Pathways Can Regulate Calmodulin Gene Expression

To try to deduce which Ca²⁺ compartment is used to regulate NpCaM-1 RNA concentrations, we treated seedlings with several inhibitors that modify [Ca²⁺]_i kinetics. To establish suitable concentrations for use, we titrated the concentrations of these inhibitors to obtain an inhibition of about 50% or less in the Ca²⁺ signal. We then quantified the inhibitor-induced alterations in the [Ca²⁺]_i kinetics and the alterations, if any, in NpCaM-1 and NpCaM-2 accumulation.

MAQ 2.4 and MAQ 7.11 seedlings treated with thapsigargin, ruthenium red, or BAPTA-acetoxymethyl ester (AM) were subjected to wind signals (Fig. 5). There was a clear correlation between the behavior of the [Ca²⁺]_i signals in the MAQ 7.11 compartment and NpCaM-1 RNA accumulation. Thapsigargin increased the MAQ 7.11 Ca²⁺ signal and subsequent calmodulin RNA accumulation, ruthenium red had no effect on the Ca²⁺ signal in MAQ 7.11 or the subsequent accumulation of calmodulin RNA, whereas BAPTA-AM decreased both. Ruthenium red did decrease the MAQ 2.4 signal but with no effect on NpCaM-1 accumulation. BAPTA-AM led to a slight decrease in the mean Ca²⁺ peak height in the MAQ 2.4 seedlings, but the difference was not significant, falling within the SE of the experiment. Treatment with the inhibitors alone had no detectable effect on either mRNA levels or cytosolic or nuclear Ca²⁺ (data not shown).

View larger version (22K): [in this window] [in a new window]   Figure 5.   The effect of Ca2+ modulators on wind-induced changes in cytosolic and nuclear Ca2+ and NpCaM-1 and NpCaM-2 mRNA accumulation. Wind stimulation was applied by 5 mL of air at t = 10 s. The SE for the peak values from eight experiments is indicated for the mean peak. CON, Control; THAP, thapsigargin; RR, ruthenium red; BA, BAPTA-AM. A, The effect of 200 µM thapsigargin. , CON NpCaM-1; , CON NpCaM-2; , THAP NpCaM-1; , THAP NpCaM-2. B, 50 µM Ruthenium red. , CON NpCaM-1; , CON NpCaM-2; , RR NpCaM-1; , RR NpCaM-2.; C, 1 mM BAPTA-AM; solvents were used as control. , CON NpCaM-1; , CON NpCaM-2; , BA NpCaM-1; , BA NpCaM-2.

MAQ 2.4 and MAQ 7.11 seedlings were treated with lanthanum and gadolinium chlorides and subjected to cold shock (Fig. 6). With both inhibitors there was a substantial decrease in the MAQ 2.4 signal, which was associated with a severe inhibition of subsequent NpCaM-1 accumulation. The different behavior of the MAQ 7.11 seedlings, in which a slight increase in Ca²⁺ response was observed when the lanthanides were present, emphasizes a correlation between cold-shock-induced [Ca²⁺]_i kinetics in MAQ 2.4 and NpCaM-1 expression. Treatment with the inhibitors alone had no detectable effect on mRNA levels or on cytosolic or nuclear Ca²⁺ (data not shown).

View larger version (26K): [in this window] [in a new window]   Figure 6.   The effect of Ca2+ modulators on cold shock-induced changes in cytosolic and nuclear Ca2+ and NpCaM-1 and NpCaM-2 mRNA accumulation. Cold shock stimulation was applied by a 1-mL injection of ice-cold water at t = 10 s. The SE for the peak values from eight experiments is indicated for the mean peak. A, The effect of 10 mM LaCl3 (LA). , CON NpCaM-1; , CON NpCaM-2; , LA NpCaM-1; , LA NpCaM-2; B, 20 mM GdCl3 (GD); MgCl2 concentrations of identical ionic strength were used as a control (CON). , CON NpCaM-1; , CON NpCaM-2; , GD NpCaM-1; , GD NpCaM-2.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

MAQ 7.11 Reports Changes in Nuclear Ca²⁺

We transformed tobacco seedlings with a nucleoplasmin aequorin construct to investigate further the apparent compartmentalization of wind and cold shock Ca²⁺ signals. For a variety of reasons, we believe that MAQ 7.11 seedlings report [Ca²⁺]_nuc in response to wind and cold shock stimulation.

Immunolocalization techniques indicated that 86% of the nucleoplasmin/aequorin fusion protein was found located in the nucleus of MAQ 7.11 cells. To be nuclear targeted, this oocyte polypeptide must be recognized by the nuclear import machinery of plants. Increasing evidence suggests that the mechanism of nuclear protein translocation is highly conserved among higher eukaryotes. About 9% of the aequorin in MAQ 7.11 was associated with chloroplasts. We have previously targeted aequorin to chloroplasts in tobacco (designated MAQ 6.3, Johnson et al., 1995). No changes in the chloroplastic Ca²⁺ levels were detected during mechanical and cold shock treatment of these seedlings (A.H. van der Luit, A. Haley, and A.J. Trewavas, unpublished observation). The low level of aequorin in the chloroplast therefore did not contribute to the measurements described here. Another 5% of the nucleoplasmin aequorin was found in the cytoplasm. The nucleoplasmin/aequorin construct is synthesized in the cytoplasm and then partitions to the nucleus. However, this residual cytoplasmic aequorin does not contribute significantly to the luminescence signal of MAQ 7.11. The Ca²⁺ kinetics of the MAQ 7.11 are different from those of MAQ 2.4. Furthermore, there was no evidence of MAQ 7.11 kinetics of two components or two peaks, or even a broadening of the MAQ 7.11 peak, which might have resulted from a contaminating cytoplasmic signal.

There was a clear difference in the kinetics of the Ca²⁺ response to cold shock between MAQ 2.4 and MAQ 7.11. This difference in kinetics was not due to fusion to nucleoplasmin, as aequorin in the cytoplasm and nucleoplasm reported identical Ca²⁺ values (Badminton et al., 1998). Wind signals induced [Ca²⁺]_cyt (MAQ 2.4) to peak at 0.3 s, while the MAQ 7.11 peaked later at 0.6 s. The quick response of the nuclear and cytoplasmic signals to wind stimulation probably resulted in part from the speed with which the mechanical signal is perceived. Wind induced a slight movement of the seedling around the hypocotyl/root junction that lasted 0.02 to 0.3 s. In animal cells [Ca²⁺]_nuc usually peaks later than [Ca²⁺]_cyt, and the peak height is lower (Badminton et al., 1995, 1996, 1998). With cold shock stimulation, in which seedlings were irrigated with ice-cold water, MAQ 2.4 peaked at 4 to 5 s but MAQ 7.11 peaked at 9 s. Furthermore, MAQ 7.11 Ca²⁺ transients peaked at a substantially lower [Ca²⁺] than MAQ 2.4 (Fig. 4) in both cases.

Unpublished evidence using MAQ 2.4 and MAQ 7.11 supports the apparent independence of the Ca²⁺ response in the different compartments. Heat shock treatments induce [Ca²⁺]_cyt and [Ca²⁺]_nuc transients, which are separated by minutes (M. Gong, A.H. van der Luit, and A.J. Trewavas, unpublished observations). While we could detect circadian variations in [Ca²⁺]_cyt in MAQ 2.4, we could not detect them in MAQ 7.11 (N.T. Wood, A. Haley, M. Moussaid, A.H. van der Luit, and A.J. Trewavas, unpublished data). There is therefore some autonomy in nuclear Ca²⁺ signaling in plant cells, much as there seems to be in animal cells.

There is an ongoing debate as to the extent to which the nucleus regulates [Ca²⁺]_nuc (Carafoli et al., 1997; Malviya and Rogue, 1998). A common view is that alterations in [Ca²⁺]_cyt are the basic element in Ca²⁺ signaling and that they pass through the nuclear membrane, albeit in an attenuated and later form; in this case the nucleus is not thought to independently regulate [Ca²⁺]_nuc. The alternative view regards the nuclear envelope and associated endoplasmic reticulum as an intracellular store of Ca²⁺ able to respond to signals independently of cytoplasmic changes. This latter view does not preclude parallel changes in [Ca²⁺]_nuc and [Ca²⁺]_cyt. Meyer et al. (1995) suggested that if Ca²⁺ signals in the cytoplasm and nucleus differ from each other in kinetics by at least 1 s, then the nuclear membrane is a substantial barrier to Ca²⁺ movement from the cytoplasm, greatly increasing the likelihood of separate regulation of nuclear Ca²⁺. In the case of cold shock at least, the nuclear membrane may act as a significant barrier to Ca²⁺ movement, because there is a 4-s difference between the peak values of MAQ 2.4 and MAQ 7.11.

Distinct Ca²⁺ Signaling Pathways Regulate Calmodulin Gene Expression in Tobacco

There is definite evidence that the flow of Ca²⁺ resulting from activation of different receptors regulates different pathways of gene expression (Bading et al., 1993; Finkbeiner and Greenberg, 1997), presumably through spatial separation of the pathways themselves. Hardingham et al. (1997) microinjected dextran-linked BAPTA into nuclei and concluded that some signals require a pathway through [Ca²⁺]_cyt, while others involve [Ca²⁺]_nuc. This technology is not yet currently feasible with cells in tobacco seedlings. In the experiments described in this paper for wind signals, some component of the signaling pathways controlling NpCaM-1 expression could clearly be through [Ca²⁺]_nuc. Prior treatment with BAPTA-AM inhibited the nuclear Ca²⁺ signal, leaving the cytosolic Ca²⁺ signal unaffected, ruthenium red greatly reduced the cytoplasmic signal without influencing that in the nucleus, while treatment with thapsigargin increased the subsequent nuclear signal without influencing the subsequent cytoplasmic signal. Variations in the accumulation of NpCaM-1 mRNA as a result of inhibitor treatments were correlated with [Ca²⁺]_nuc but not with [Ca²⁺]_cyt. Selective inhibition of the cold-shock-induced cytosolic Ca²⁺ signal by lanthanum and gadolinium chlorides, indicative of a cytosolic pathway for regulation of NpCaM-1 calmodulin gene expression, helps confirm the spatial separation of signaling pathways between wind and cold shock stimuli.

This apparent spatial distribution of signaling pathways may be further complicated by clear evidence that different downstream events are switched on at different stages of the Ca²⁺ transient (Dolmetsch et al., 1997) and by a requirement that cytoplasmic signaling must take place near the plasma membrane. This latter observation of Finkbeiner and Greenberg (1997) might explain why reductions of about 40% in the cold-shock-dependent cytoplasmic Ca²⁺ signal nevertheless completely blocks NpCaM-1 mRNA accumulation. Based on previously reported effects of neomycin, we suspect that only part of the cold-shock-induced cytosolic signal originates with increased Ca²⁺ flux through the plasma membrane, with the remainder being released from internal stores by InsP₃ (Knight et al., 1996). The reduction of 40% might then disguise a quantitatively greater inhibition of Ca²⁺ flux through the plasma membrane by the lanthanides, the cellular region critical perhaps to switching on the cytosolic pathway leading to NpCaM-1 transcription.

By generating artificial Ca²⁺ transients, Dolmetsch et al. (1997) implicated early events in the rise time, peak value, and duration of the decay back to resting levels as controlling different transduction processes, including changes in gene expression. It is for this reason that we included measurements of rise time, peak Ca²⁺ values, decay times, and resting values where relevant for the data in Figures 4 to 6. However, in tobacco seedlings the kinetics of the Ca²⁺ transient seemed to be directly determined by the nature of the original signal. A wind signal induced a transient lasting some 20 s but reaching a peak within less than 0.5 s. Cold shock induced a transient lasting some 40 s and reaching a peak within 5 to 9 s. Both signals induced NpCaM-1 mRNA accumulation, although cold shock accumulations were higher than those of wind induction. Even when inhibitors are used, there is little alteration to the overall kinetics except in the peak height. There is a slight lengthening of about 5 s of the transient with thapsigargin; only more detailed studies directly modifying Ca²⁺ transients will determine whether this is a significant change. Certainly at present for the NpCaM-1 gene, peak height seems to be the more critical factor determining final mRNA accumulation.

At present, two possible ways can be proposed in which [Ca²⁺]_nuc exerts transcriptional regulation. The first may operate through Ca²⁺ or Ca²⁺-sensitive protein kinases located in the nucleus. As reported many years ago (Trewavas, 1979; Melanson and Trewavas, 1981), plant nuclei contain protein kinase activity and changes in specific phosphorylation of discrete nuclear proteins during cell development or cell division could be detected using two-dimensional electrophoretic separations. Clearly, plant nuclei have the potential for the regulation of transcription through phosphorylation, although whether there are Ca²⁺ or Ca²⁺/calmodulin-sensitive protein kinases in the plant nucleus remains to be established.

The second possibility is that there is direct interaction of Ca²⁺/calmodulin with promoters or particular transcription factors. This mechanism is supported by recent work by Corneliussen et al. (1994), who reported binding of calmodulin to the basic helix-loop-helix domains of several mice basic helix-loop-helix transcription factors that inhibit their DNA binding in vitro, and with those of Szymanski et al. (1996), who reported that calmodulin isoforms enhance the binding of TGA3 to the Arabidopsis CaM-3 promoter.

The mechanism whereby wind signals can apparently selectively modify nuclear Ca²⁺ requires further investigation. Nuclei are surrounded by a basket of microfilaments. Distortion of these microfilamentous structures is thought to be one of the major means by which plant cells sense mechanical signals (Trewavas and Knight, 1994). In addition, Ca²⁺ channels localized to nuclei of amphibian epithelial cells (Prat and Cantiello, 1996) have been shown to be associated with actin filaments. Equivalent channels in tobacco cells might regulate nuclear Ca²⁺ levels in plant cells after wind stimulation.