|
Plant Physiol, November 1999, Vol. 121, pp. 743-752
Brassinosteroid-Insensitive Dwarf Mutants of Arabidopsis
Accumulate Brassinosteroids1
Takahiro
Noguchi,
Shozo
Fujioka,*
Sunghwa
Choe,
Suguru
Takatsuto,
Shigeo
Yoshida,
Heng
Yuan,
Kenneth A.
Feldmann, and
Frans E.
Tax
The Institute of Physical and Chemical Research (RIKEN), Wako-shi,
Saitama 351-0198, Japan (T.N., S.F., S.Y.); Departments of Plant
Sciences (S.C., H.Y., K.A.F.) and Molecular and Cellular Biology
(F.E.T.), University of Arizona, Tucson, Arizona 85721; Department of
Chemistry, Joetsu University of Education, Joetsu-shi, Niigata
943-8512, Japan (S.T.); and Tama Biochemical Co., Ltd., Shinjuku-ku,
Tokyo 163-0704, Japan (T.N.)
 |
ABSTRACT |
Seven dwarf mutants resembling
brassinosteroid (BR)-biosynthetic dwarfs were isolated that did
not respond significantly to the application of exogenous BRs. Genetic
and molecular analyses revealed that these were novel alleles of
BRI1 (Brassinosteroid-Insensitive 1), which encodes a
receptor kinase that may act as a receptor for BRs or be involved in
downstream signaling. The results of morphological and molecular
analyses indicated that these represent a range of alleles from weak to
null. The endogenous BRs were examined from 5-week-old plants of a null
allele (bri1-4) and two weak alleles
(bri1-5 and bri1-6). Previous analysis of
endogenous BRs in several BR-biosynthetic dwarf mutants revealed that
active BRs are deficient in these mutants. However,
bri1-4 plants accumulated very high levels of
brassinolide, castasterone, and typhasterol (57-, 128-, and 33-fold
higher, respectively, than those of wild-type plants). Weaker alleles
(bri1-5 and bri1-6) also accumulated
considerable levels of brassinolide, castasterone, and typhasterol, but
less than the null allele (bri1-4). The levels of
6-deoxoBRs in bri1 mutants were comparable to that of
wild type. The accumulation of biologically active BRs may result from
the inability to utilize these active BRs, the inability to regulate BR
biosynthesis in bri1 mutants, or both. Therefore,
BRI1 is required for the homeostasis of endogenous BR levels.
 |
INTRODUCTION |
Based on their wide distribution in the plant kingdom, their
diverse physiological effects at nanomolar levels, and the discovery of
mutants deficient in their biosynthesis, it is now widely accepted that
brassinosteroids (BRs) are important hormones that regulate growth and
development (Fujioka and Sakurai, 1997a , 1997b ; Sakurai and Fujioka,
1997 ; Yokota, 1997 ; Altmann, 1998 ; Clouse and Sasse, 1998 ). During a
relatively short time, a number of BR mutants were isolated from
Arabidopsis, pea, and tomato (for review, see Clouse and Feldmann,
1999 ). Many of the BR mutants have been well characterized by genetic,
molecular, and biochemical studies. All of the BR mutants are dwarfs in
that they exhibit a short, robust stature and dark-green, round leaves.
In addition, most of the mutants have reduced fertility, a prolonged
lifespan, and display abnormal skotomorphogenesis when grown in the
dark. These BR dwarf mutants are divided into two classes based on
their phenotypic response to exogenously supplied BRs (Clouse and
Feldmann, 1999 ).
One class of BR dwarf mutants is impaired in BR biosynthesis. The
phenotype of this class of BR mutants can be rescued by exogenous
application of BRs, but not by treatment with any other plant hormone.
At present, six BR-biosynthetic mutants in Arabidopsis have been
characterized (det2: Chory et al., 1991 ; Li et al., 1996 ,
1997 ; Fujioka et al., 1997 ; Noguchi et al., 1999 ; cpd:
Szekeres et al., 1996 ; Mathur et al., 1998 ; dwf4: Azpiroz et
al., 1998 ; Choe et al., 1998 ; dwf1: Feldmann et al., 1989 ;
Takahashi et al., 1995 ; Klahre et al., 1998 ; Choe et al., 1999a ;
dwf7/ste1: Choe et al., 1999b ; and sax1:
Ephritikhine et al., 1999 ). In addition, two BR-deficient mutants have
been isolated and characterized from pea (lkb: Nomura et
al., 1997 , 1999 ; lk: Yokota et al., 1997 ) and two from
tomato (dwarf: Bishop et al., 1996 , 1999 ; dpy:
Koka et al., 1999 ).
A second class of BR dwarf mutants resembles the biosynthetic mutants
in morphology, but cannot be rescued by BR feeding. This class of
mutants is predicted to be blocked in the perception of BRs or in
essential components of BR signaling downstream of perception.
BR-insensitive mutants have been identified for Arabidopsis (bri1: Clouse et al., 1996 ; Kauschmann et al., 1996 ; Li and
Chory, 1997 ), pea (lka: Nomura et al., 1997 , 1999 ), and
tomato (cu-3: Koka et al., 1999 ). Clouse et al. (1996) first
identified a BR-insensitive mutant in Arabidopsis. This mutant,
bri1-1 (brassinosteroid-insensitive 1-1), did not
respond to BRs in root-inhibition assays, but did retain sensitivity to
other plant hormones, including auxin and GA. Genetic analysis showed
that bri1-1 was caused by a recessive mutation in a single
gene. Kauschmann et al. (1996) also identified a BR-insensitive mutant
they called cbb2 (cabbage 2), which was allelic
to bri1-1.
Li and Chory (1997) identified 18 additional alleles of
bri1, and isolated the BRI1 gene by mapping,
isolation of DNA near BRI1, and the identification of a
mutation in one allele that resulted in a detectable RFLP. The
BRI1 gene was predicted to encode a membrane-bound Leu-rich
repeat (LRR) receptor kinase (RK), which appeared to be constitutively
expressed throughout the plant, both in the light and in the dark. The
predicted protein showed striking similarities to other plant LRR-RK
gene products, such as those of CLAVATA1 (Clark et al.,
1997 ) and Xa21 (Song et al., 1995 ), which are involved in
developmental signaling pathways and in pathogen response,
respectively. Although physiological and molecular data raise the
possibility that BRI1 is a receptor for BRs, direct biochemical
evidence has not yet been described.
The natural occurrence of BRs in Arabidopsis was first demonstrated by
Fujioka et al. (1996) . Castasterone, 6-deoxocastasterone, typhasterol,
and 6-deoxotyphasterol were identified from extracts made from
Arabidopsis shoots. A subsequent study expanded the BR profiles in
Arabidopsis. From fully expanded siliques of Arabidopsis, six BRs,
including brassinolide, castasterone, typhasterol, 6-deoxocastasterone, 6-deoxotyphasterol, and 6-deoxoteasterone, were identified (Fujioka et al., 1998 ). All BRs identified in Arabidopsis are important components of either the early or late C6-oxidation pathways. These
pathways were previously established with studies using cultured cells
of Catharanthus roseus (Fujioka and Sakurai, 1997b ; Sakurai
and Fujioka, 1997 ). The studies in Arabidopsis suggested that both the
early and late C6-oxidation pathways were functional in this species as well.
The analysis of BR levels in the BR-biosynthetic mutants have thus far
substantiated the predicted BR pathways in Arabidopsis. The
accumulation of precursor molecules in the BR biosynthetic pathway has
been observed for several of these mutants. In addition, the
BR-biosynthetic mutants of Arabidopsis have been shown to be deficient
in endogenous BRs or sterols downstream of the blocked step
(det2: Fujioka et al., 1997 ; dwf1: Klahre et al.,
1998 ; Choe et al., 1999a ; dwf7/ste1: Choe et al., 1999b ).
However, no information about endogenous BRs in BR-insensitive mutants
of Arabidopsis is available. In GA-insensitive mutants such as
Dwarf-8 in maize (Fujioka et al., 1988 ), gai in
Arabidopsis (Talon et al., 1990 ), and Rht3 in wheat
(Appleford and Lenton, 1991 ), the accumulation of bioactive
C19-GAs such as GA1 and
GA20 has been reported. Furthermore, transcription of one GA-biosynthetic gene is increased in the gai mutant (Peng et al., 1997 ). The accumulation of GAs and
the increased level of GA-biosynthetic gene transcription have led to
the conclusion that GAI, which may encode a transcription
factor, is also required for proper feedback regulation of the
GA-biosynthetic pathway (Peng et al., 1997 ; Harberd et al., 1998 ).
There is little known about how BR biosynthesis and signaling are
coordinated. BRs are synthesized using sterols as precursors, but much
less is understood about how sterols are funneled into BR biosynthesis.
Within the BR-specific pathway, the 22 -hydroxylase supplied by
DWF4 appears to be rate limiting (Choe et al., 1998 ). However, there is currently nothing known about how DWF4
transcription is regulated or spatially controlled. Analysis of
CPD, a Cyt P450 (CYP) 90A one step downstream of
DWF4 in the current BR-biosynthetic pathway, indicated that
CPD mRNA levels are decreased by BR treatment (Mathur et
al., 1998 ). This suggests that BR biosynthesis is regulated by a
negative-feedback loop. Although the RK encoded by BRI1 is likely a key component of BR signal transduction, little is known about
the regulation of BRI1 or about the nature of additional proteins that function downstream of BRI1. In animals, for
both nuclear steroid hormone receptors and for some membrane-spanning ligands and receptors, feedback regulation occurs as a result of
receptor activation (Wilkinson et al., 1994 ; Blumberg et al., 1998 ). We
studied the BR profile of bri1 mutants to understand the
regulation of BRs in Arabidopsis.
In this study, we describe the isolation of seven bri1
alleles and present morphometric analysis of plants homozygous for one
severe allele and two weak alleles. We have also identified mutations
within the BRI1 gene for all seven alleles, and provide data
suggesting that the severe alleles represent the null phenotype of
BRI1. We also determined the levels of endogenous BRs in
three bri1 alleles with gas chromatography-selective ion
monitoring (GC-SIM) analysis using 2H-labeled
internal standards. We show here that mutations in BRI1 cause very large accumulations of 6-oxoBRs such as brassinolide, castasterone, and typhasterol, and that the level of BRs is positively correlated with allele and phenotypic severity.
 |
MATERIALS AND METHODS |
Isolation and Mapping of bri1 Alleles
bri1-3 (dwf2-32) and bri1-4
(dwf2-2074) were found in a screen for dwarf mutants from a
population of plants of the Wassilewskija-2 (Ws-2) ecotype transformed
with the T-DNA plasmid of Agrobacterium tumefaciens using
the seed transformation method (Feldmann and Marks, 1987 ; Feldmann and
Azpiroz, 1994 ). However, the dwarf phenotype did not cosegregate with
kanamycin resistance, and therefore bri1-3 and
bri1-4 represent untagged alleles (data not shown).
bri1-5(dwf2-W41), bri1-7, bri1-8, and
bri1-9 were isolated after ethyl methanesulfonate (EMS)
mutagenesis of Ws-2 seeds, and bri1-6(dwf2-399) was
identified among the dwarf mutants obtained from the Arabidopsis
Biological Resource Center (Ohio State University, Columbus)
(CS399, http://aims.cps.msu.edu/aims/). CS399 had been isolated
previously using an unknown mutagen. All seven alleles were classified
as insensitive to BRs based on their lack of a significant response in
feeding studies performed on inflorescences and seedlings (data not
shown, see Choe et al., 1998 , 1999a ). Three of these mutations were
initially designated as Ws-2 EMS (WM) mutants (see Table
I) but have been renamed as
bri1 alleles.
The original bri1 allele, bri1-1, showed tight
linkage to a marker on the bottom of chromosome IV (1/126 chromosomes
recombinant for the CAPS marker DHS1, Clouse et al., 1996 ).
DHS1 is tightly linked to SSLP marker nga1107, and
BRI1 is physically located between these two markers (Li and
Chory, 1997 ). We established mapping populations by crossing
bri1 alleles to wild-type plants of the Columbia ecotype and
selecting dwarf plants among the F2 progeny. DNA
was isolated from single leaves or flowers as described previously
(Dellaporta et al., 1983 ; Krysan et al., 1996 ). PCR reactions were
prepared as described by Bell and Ecker (1994) .
Since five of these seven BR-insensitive dwarf mutants mapped to the
same general location as bri1-1, we performed crosses between all seven of these mutants to determine if they were alleles of
the same gene. All combinations tested generated dwarf plants in the
F1, and thus these represent alleles of the same
gene (data not shown).
Morphometric Analysis
Approximately 20 seeds were planted in round pots (10 cm in
diameter) with soil (Metromix 350, Grace Sierra, Miltipas, CA) presoaked in water. Flats containing the pots were covered in plastic
wrap and cold treated for 3 to 4 d before transfer to a growth
chamber (16 h of light [240 µmol m 2
s 1] at 22°C and 8 h of dark at 21°C,
with 75%-90% humidity). The plastic wrap was removed after the
seedlings were established (5-7 d), and the seedlings were thinned so
that there were four or five well-spaced seedlings per pot. The pots
were subirrigated with water or Hoagland's nutrient solution as
necessary. When the plants were 5 weeks of age, the morphological
traits listed in Table II were measured.
Plant height was measured to the nearest millimeter, and the length of
siliques and the length and width of leaves were measured to the
nearest half-millimeter using a ruler. The length of siliques and the
distance between siliques on the main inflorescence were measured to
the nearest 10th of a millimeter using a ruler in the ocular of a
dissecting microscope.
View this table:
[in this window]
[in a new window]
|
Table II.
Morphometric analysis of Ws-2 and bri1 mutants at 5 weeks of age
Measurements of plant height were made on at least 15 plants. Each
value represents the mean ± SD.
|
|
Determination of the DNA Sequence of bri1 Alleles
The specific mutations in these seven bri1 alleles were
identified by first designing primers based on the genomic sequence (Li
and Chory, 1997 ; GenBank accession no. AF017056). Using oligonucleotides synthesized by Genosys Biotechnologies (The Woodlands, TX), a fragment of DNA corresponding to the coding region of
BRI1 was amplified using XTaq (Panvera, Madison, WI), the
F1 and R1 primers
(F1 [79] agagataggtggttgggggtaaaatgtat,
R1 [4366] aaaaatagacccaaggaaaatcggactga), and
DNA isolated from a single leaf or flower from each mutant (Krysan et
al., 1996 ). The bracketed numbers refer to the nucleotide position (Li
and Chory, GenBank accession no. AF017056). DNA fragments were purified
(Prep-A-Gene DNA purification system, Bio-Rad, Hercules, CA) and
sequenced at the Arizona Research Laboratory (University of Arizona, Tucson).
For each mutant, the entire fragment was sequenced in one strand using
the following additional oligonucleotides: F2
(431) taatcagaagaagaggtaac, F3 (896)
tgcagagacgacaaagttac, F4 (1368) tttctcgatgtttcctccaa, F5 (1836)
ccggaatctctgacgaatct, F6 (2298) agaatctcgctatcctcaag, F7 (2741)
caatttgggtcataacgata, F8 (3236) gaagctgactggtgtgaaag, F9 (3702)
catatcatccacagagacat, and F10 (4208)
aatagaggatggagggttca. Putative mutations were confirmed by sequencing
the second strand using the following primers: R2 (1437)
ttcccggagatgtcaagatg, R3 (3503) caagaagaggcacaagattt, and R4 (2862)
tccgtaagcatagtaagagc, and repeating the sequencing on fragments
isolated from independent PCR reactions.
Quantitative Analysis of Endogenous BRs
Plants were grown for 5 weeks on soil. The aerial portions
(rosette leaves, inflorescences, flowers, and siliques) were harvested and frozen. The tissue was lyophilized (Lyphlick 12, LabConco, Kansas
City, MO) and ground to a fine powder using a mortar and pestle.
Lyophilized plant material (40 g fresh weight equivalent) was extracted
with 400 mL of MeOH-CHCl3 (4:1) twice, and
[2H6]brassinolide,
[2H6]castasterone,
[2H6]typhasterol,
[2H6]teasterone,
[2H6]6-deoxocastasterone,
[2H6]6-deoxotyphasterol,
and
[2H6]6-deoxoteasterone
(100 ng each) were added to the extract as internal standards. After
evaporation of the solvent in vacuo, the extract was partitioned
between CHCl3 and water three times. The
CHCl3-soluble fraction was subjected to silica
gel chromatography (Sep-Pak Vac Silica, 35 mL, Waters, Milford, MA).
The column was subsequently eluted with 100 mL of
CHCl3, 2% (v/v) MeOH in
CHCl3, and 7% (v/v) MeOH in
CHCl3. The 2% (v/v) MeOH and 7%
(v/v) MeOH fractions were purified by Sephadex LH-20 column
chromatography (column volume of 200 mL).
The column was eluted with MeOH-CHCl3 (4:1). The
effluents of elution volume to total column volume 0.6 to 0.8 were
collected as the BR-containing fraction. After purification with an ODS cartridge (Sep-Pak Plus C18, Waters) with 20 mL
of MeOH, eluates were subjected to ODS-HPLC (Senshu Pak Pegasil ODS, 10 × 30 mm + Senshu Pak Pegasil ODS, 20 × 250 mm; Senshu Scientific,
Tokyo) at a flow rate of 8 mL min 1. Ninety
percent acetonitrile was used as a solvent for the eluate derived from
the 2% (v/v) MeOH fraction, and 70% (v/v) acetonitrile was used for the eluate derived from the 7% MeOH fraction. HPLC purification from the 7% MeOH fraction yielded a brassinolide fraction
(retention time [Rt] from 8-10 min), a castasterone fraction (Rt
from 12-14 min), a teasterone fraction (Rt from 17-20 min), a
typhasterol fraction (Rt from 26-32 min), and a 6-deoxocastasterone fraction (Rt from 38-44 min). HPLC purification from the 2%
(v/v) MeOH fraction yielded a 6-deoxoteasterone fraction (Rt
from 32-36 min) and a 6-deoxotyphasterol fraction (Rt from 48-52
min). Each fraction was analyzed by GC-SIM after derivatization.
Quantitative Analysis of Endogenous Sterols
For sterol analysis, lyophilized plant material (2 g fresh weight
equivalent) from wild-type and bri1 mutant alleles was
used. Plant material was extracted with 50 mL of
MeOH-CHCl3 (4:1) twice, and
[2H7]24-methylenecholesterol
(3 µg/g fresh weight),
[2H6]campesterol (30 µg/g fresh weight), and
[2H6]campestanol (1 µg/g fresh weight) were added to the extract as internal
standards. After evaporation of the solvent in vacuo, the extract was
partitioned between CHCl3 and water three times. The CHCl3-soluble fraction was purified with a
silica gel cartridge column (Sep-Pak Vac Silica, 12 mL, Waters), which
was eluted with 20 mL of CHCl3. The eluate was
purified with an ODS cartridge (Sep-Pak Plus C18,
Waters), which was eluted with 20 mL of MeOH. The eluent was subjected
to ODS-HPLC (Senshu Pak ODS 4150-N; 10 × 150 mm, Senshu
Scientific) at a flow rate of 2 mL min 1
with MeOH. Fractions were collected every 0.5 min (Rt between 10 and 20 min). The main fractions of each sterol were as follows: 24-methylenecholesterol (Rt of 13 to 13.5 min), campesterol (Rt of 15.5 to 16 min), and campestanol (Rt of 16.5 to 17 min). Each fraction was analyzed by full-scan gas chromatography-mass
spectrometry (GC-MS) after derivatization.
2H Standards
[2H6]Campesterol was
kindly supplied by Tama Biochemical (Tokyo).
[2H6]Brassinolide,
[2H6]castasterone,
[2H6]typhasterol,
[2H6]teasterone
(Takatsuto and Ikekawa, 1986 ),
[2H6]6-deoxocastasterone
(Choi et al., 1996 ),
[2H6]6-deoxotyphasterol,
[2H6]6-deoxoteasterone
(Choi et al., 1997 ),
[2H7]24-methylenecholesterol
(Takatsuto et al., 1998 ), and
[2H6]campestanol (Noguchi
et al., 1999 ) were chemically synthesized.
GC-MS Analysis
GC-MS analysis was carried out under the following conditions: a
mass spectrometer (Automass JMS-AM150, JEOL, Tokyo) was connected to a
gas chromatograph (model 5890A-II, Hewlett-Packard, Wilmington, DE),
electron ionization (70 eV) with a source temperature of 210°C, a DB-5 column (J&W Scientific, Folsom, CA; 15-m × 0.25-mm, 0.25-µm film thickness), and an injection
temperature of 250°C. The column temperature program was: 80°C for
1 min, raised to 320°C at a rate of 30°C
min 1, and held at this temperature for 5 min.
The interface temperature was 250°C and the carrier gas was He at a
flow rate of 1 mL min 1 with splitless
injection. BR fractions were analyzed by GC-SIM after derivatization as
below. Fractions containing brassinolide, castasterone, and
6-deoxocastasterone were derivatized to bis-methaneboronate, and
fractions of teasterone, typhasterol, 6-deoxoteasterone, and 6-deoxotyphasterol were derivatized to methaneboronate-trimethylsilyl ether.
Monitored ions in the analysis of each BR were as follows:
brassinolide, m/z 534, 528, 338, 332, 161, and 155;
castasterone, m/z 518, 512, 287, 161, and 155;
typhasterol and teasterone, m/z 550, 544, 535, and 529;
6-deoxocastasterone, m/z 504, 498, 489, and 483; and
6-deoxotyphasterol and 6-deoxoteasterone, m/z 536, 530, 521, 515, and 215. The endogenous levels of BRs, except for brassinolide,
were determined as the ratio of the peak area of molecular ions for the
internal standard to that of the endogenous steroid. The endogenous
levels of brassinolide were determined as the ratio of the peak areas
of fragment ions of m/z 338 and m/z 332. Sterols
were analyzed by full-scan GC-MS after derivatization to the
trimethylsilyl ether, and the endogenous levels were determined as the
ratio of the peak areas of molecular ions for the internal standard to
that of the endogenous sterol. Molecular ions of the internal standard
and the endogenous sterol were as follows: 24-methylenecholesterol, m/z 477 and 470; campesterol, m/z 478 and 472;
and campestanol, m/z 480 and 474.
 |
RESULTS |
Identification and Morphological Characterization of Seven
bri1 Mutants
We have screened plants mutagenized by T-DNA insertional
mutagenesis and EMS for dwarf mutants displaying the typical
characteristics of BR biosynthetic mutants. These characteristics
include short stature, small, dark green leaves, and reduced fertility.
These mutants were divided into two categories based on the responses of the inflorescences to exogenous application of brassinolide. Nine
mutants with no response or a reduced response in these feeding experiments were mapped to see if they were linked to
bri1-1, a previously identified brassinolide-insensitive
mutant. For bri1-3, zero of 44 recombinants were detected
with nga1107; for bri1-5, two of 88 recombinant chromosomes
were detected with nga1107 and zero of 88 with DHS1; and for
bri1-6, two of 108 recombinants were detected with nga1107.
For bri1-7 and bri1-9, no recombinants for nga1107 were detected out of 32 chromosomes for each allele. bri1-4 and bri1-5 were also crossed to
bri1-1, and the resulting F1
generation were dwarf, indicating that these mutants were alleles of
bri1. The results of the mapping and complementation tests were supported by the finding of a unique DNA sequence alteration in
each of our seven bri1 alleles within the BRI1
coding region (Table I). The two other mutants did not map to the same
location as bri1 and will be described elsewhere (S. Choe,
F.E. Tax, and K.A. Feldmann, unpublished data).
These seven bri1 mutants can be divided into severe,
intermediate, and weak alleles based on their morphological
characteristics. bri1-3 and bri1-4 represent
severe alleles. bri1-4 plants, as shown in Figure
1 and Table II, are extremely small, with
all major above-ground organs reduced in size and dark-green in color, and rarely produce seeds. Plants of the intermediate allele
bri1-8 are slightly larger than bri1-3 and
bri1-4 plants, and are more fertile (data not shown). Four
alleles comprise the weak class of bri1 alleles;
bri1-5 and bri1-6 shown in Figure 1 are typical of this class. Plants from the four weak alleles were between 3 and 6 cm in height at 5 weeks of age, resemble the wild type in color, and
are reasonably fertile, although not as fertile as the wild type (Table
II). There are some interesting differences among these weak alleles.
For example, bri1-5 plants have very short internodes along
the inflorescence, develop leaves that are wider than those of the wild
type (data for the third and fourth leaves are shown in Table II), and
are the most fertile of these bri1 mutants. In contrast,
bri1-9 plants have the longest internode length of these
four weak alleles, yet have the smallest rosette leaves (data not
shown).

View larger version (42K):
[in this window]
[in a new window]
|
Figure 1.
Wild type and four representative alleles of
bri1 at 5 weeks of age. A, Wild type; B,
bri1-3; C, bri1-4; D,
bri1-5; and E, bri1-6.
|
|
DNA Sequence Analysis of bri1 Mutants
To determine the specific DNA sequence alterations responsible for
the phenotypes of these bri1 alleles, we amplified the coding region of BRI1 from these mutants using PCR and
performed DNA sequence analysis on each allele. For each allele, a
single alteration was identified within the sequenced region.
bri1-3 and bri1-4, the most severe alleles, both
contain small deletions that are predicted to alter the BRI1
ORF, resulting in a premature stop codon. Deletions of this size are
common in untagged mutations resulting from T-DNA mutagenesis (S. Choe
and K.A. Feldmann, unpublished results). The location of the deletions
in these two severe alleles may indicate that these represent null
alleles of bri1 (see Fig. 2).
The intermediate and weak alleles each contained a single base pair
change resulting in an amino acid substitution. These mutations were
distributed throughout the BRI1 gene: four mutations were
located in the extracellular domains of BRI1, and one
(bri1-8) altered a conserved residue in the intracellular
kinase domain. Two mutations (bri1-6 and bri1-7)
were changes of Gly in a region located between two LRR domains. This
island has been postulated to be a ligand-binding domain (Li and Chory,
1997 ), and these two mutations result in weak alleles. The remaining
two mutations include a change of a Cys near the amino terminus and a
mutation in a LRR just carboxy-terminal of the island.
Interestingly, all of the missense mutations we have identified in the
extracellular domain are weak alleles.
Quantitative Analysis of Endogenous Sterols and BRs
Quantitative analysis was performed to determine the BR and sterol
levels in several bri1 alleles.
2H-labeled BRs and sterols were used as internal
standards to determine the endogenous levels of BRs and sterols. Plant
materials were from 5-week-old plants of the null allele
bri1-4, the two weaker alleles bri1-5 and
bri1-6, and corresponding wild-type plants. The
bri1-4 and bri1-5 mutations are in the Ws-2
background and the bri1-6 mutation is in the Enkheim-2
(En-2) background.
First, bri1-4 and bri1-5 (Ws-2 background) were
examined, and the results are shown in Figure
3. The endogenous levels of sterols such
as 24-methylenecholesterol, campesterol, and campestanol in both
alleles were comparable to those of wild type (Ws-2). The levels of
6-deoxo-BRs such as 6-deoxotyphasterol and 6-deoxocastasterone in
bri1-4 were only slightly higher than those of the wild
type. In bri1-5, the levels of 6-deoxoBRs were comparable to
those of the wild type. However, striking differences were observed in the levels of 6-oxoBRs. The levels of brassinolide, castasterone, and
typhasterol in bri1-4 were 57-, 128-, and 33-fold higher, respectively, than those of wild-type (Ws-2) plants (Fig. 3). The level
of teasterone in bri1-4 was significantly higher than that
of wild type. In addition, the weaker allele, bri1-5,
accumulated considerable levels of brassinolide, castasterone, and
typhasterol (22-, 51-, and 17-fold, respectively).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3.
The proposed brassinolide biosynthetic pathway and
the quantification of endogenous sterols and BRs from
bri1-4 (a null allele), bri1-5 (a weaker
allele), and wild type (Ws-2). Values in top, middle, and bottom
represent endogenous levels (per gram fresh weight) in
bri1-4, bri1-5, and the wild type,
respectively. Most of the data for the wild type have been already
published (Choe et al., 1999b ). Data quantifying teasterone were not
available in our previous study because of low
recovery. In this study, we repeated the analysis using the same plant
materials. Endogenous teasterone was not detected, while recovery of
the internal standard ([2H6]teasterone) was
very good.
|
|
To further confirm our findings, endogenous sterols and BRs were
examined from 5-week-old plants of another weak allele,
bri1-6, which is in a different background from
bri1-5. Both bri1-5 and bri1-6 show
similar phenotypes, although they are in different backgrounds (see
Fig. 1). There was no significant difference in sterol and BR levels in
Ws-2 and En-2 (see Fig. 3; Table III). bri1-6 contained the same pattern of sterols and BRs as
bri1-5. bri1-6 also accumulated brassinolide, castasterone,
and typhasterol (26-, 70-, and 10-fold higher than those of wild-type
[En-2] plants, respectively). The accumulation of brassinolide
and castasterone appears to be related to BRI1 gene
dosage. However, the levels of 6-deoxoBRs such as
6-deoxocastasterone, 6-deoxotyphasterol, and 6-deoxoteasterone in
bri1-6 were comparable to wild type. Our findings in
bri1-4, bri1-5, and Ws-2 were confirmed in an allele isolated from a different ecotypic background.
 |
DISCUSSION |
Theoretically, hormone-insensitive mutants can be predicted to
show the same phenotype as hormone-deficient mutants. In fact, bri1 mutants are dwarfed and the phenotypes are similar to
BR-deficient mutants such as cpd, det2,
dwf1, and dwf7/ste1. The one major difference is
that the dwarfism and other growth characteristics of bri1
mutants are not rescued by BRs. The bri1-1 phenotype is the
result of a recessive mutation in a gene located on chromosome IV
(Clouse et al., 1996 ). The gene affected in BR-insensitive mutants was
isolated and shown to encode a putative membrane-bound LRR-RK (Li and
Chory, 1997 ). From these molecular and genetic studies, BRI1
has been suggested to encode a BR receptor or an essential component
involved in BR signaling. We have described the isolation of seven
additional bri1 alleles ranging from nulls to weak alleles,
and report that BRI1 plays a role in the homeostasis of BRs.
Isolation and Characterization of a Broad Spectrum of
bri1 Alleles
The bri1 alleles described in this study possess
phenotypes that range from severe dwarf mutants resembling the original
bri1-1 dwarf mutant (Clouse et al., 1996 ) to semi-dwarfs.
Molecular analysis indicated that the two severe alleles,
bri1-3 and bri1-4, contain small deletions
predicted to cause a frame shift, and introduce a premature stop codon
into BRI1. The positions of these deletions, in the fourth
LRR and in the second of 11 conserved kinase subdomains, predict that
these two severe alleles should produce truncated forms of
BRI1. The two severe bri1 alleles are similar to
cpd mutants in their overall size and morphology.
cpd and bri1 mutants are the smallest dwarfs of
the eight BR dwarf loci isolated thus far (Clouse and Feldmann, 1999 ).
Based on the description of the 18 mutants isolated by Li and Chory
(1997) and the observation that the infertility of bri1
mutants is positively correlated with their severely reduced stature
(see Table II), 17 of these are likely also severe mutants, but little
morphological description of these mutants has been presented.
The intermediate and weak bri1 alleles we have isolated have
at least a 7-fold reduction in plant height compared with their respective wild type, and thus are still classified as dwarf mutants. These resemble loss-of-function alleles of dwf1 or
dwf7/ste1 in their overall morphology (Feldmann et al.,
1989 ; Choe et al., 1999). Most morphological parameters of the plant
are altered proportionally in these mutants (see Fig. 1; Table II), but
there are some exceptions. Leaves from bri1-5 mutants are
wider than the wild type, and the internode distance in
bri1-5 mutants is short compared with other bri1
weak alleles such as bri1-7 (see Fig. 1; Table II), even
though bri1-5 plants are taller than bri1-7 plants. bri1-9 mutants, which have small, rosette leaves,
have longer inflorescences and longer internodes than would be
predicted from the size of the leaves (data not shown).
The five intermediate and weak mutants generated by EMS mutagenesis
each had a single base change leading to an amino acid substitution
within the BRI1 coding region. These mutations are dispersed
throughout the BRI1 protein, both within the kinase domain
and in different domains of the extracellular domain. The intermediate
allele, bri1-8, is caused by a change of a conserved Arg in
subdomain VIa that is present in many RKs identified to date (Walker
1993 ; Li and Chory, 1997 ). However, the phenotype of bri1-8
is not as strong as would be expected for a change in such a conserved residue.
The extracellular region of BRI1 is composed of several different
domains, including a putative leucine zipper, two sets of paired Cys
residues, 25 LRRs, and a domain nestled within the LRRs called
the island domain. Two weak alleles (bri1-6 and
bri1-7) contain mutations that change different Gly residues
within this island domain. A mutant with a change of a different Gly
within this island domain was reported by Li and Chory (1997) ; however, their mutant was not fertile and therefore was probably a severe allele. Two other mutations were identified in the extracellular domain: a change in a Cys to a Tyr in the paired Cys domains located in
the amino terminus of the extracellular domain (bri1-5; see Fig. 2), and a change in a Ser to a Phe in the first LRR after the
island domain (bri1-9). These two weak alleles are the first mutations reported in the extracellular regions of BRI1 not in the
island domain.
Quantitative Analysis of BRs in bri1 Mutants
At the biochemical level, several dwarf mutants of Arabidopsis
have been shown to be blocked in specific steps of the BR-biosynthetic pathway. In addition, the endogenous BRs present in each mutant have
been shown to be dependent on the positions of the genetic blocks in
the pathway (det2: Fujioka et al., 1997 ; Noguchi et al.,
1999 ; dwf1: Klahre et al., 1998 ; Choe et al., 1999a ;
dwf7/ste1: Choe et al., 1999b ). bri1 mutants have
phenotypes that mimic those of BR biosynthetic mutants, but
bri1 mutants do not respond significantly to BRs. This
raises the possibility that bri1 is either a BR-receptor mutant or a mutant acting in a downstream step. If so, bri1
mutants should contain the same endogenous BRs found in wild type, but they may accumulate BRs, especially castasterone and brassinolide. Our
data show that both of the above predictions are correct. All BRs found
in the wild type are present in bri1. Brassinolide, the
presumptive terminal biologically active BR for the growth of
Arabidopsis, accumulates in bri1 mutants. The ratio of
brassinolide for a null allele (bri1-4), a weaker allele
(bri1-5), and wild type (Ws-2) was 57:22:1. Thus, the
accumulation of brassinolide is related to the amount of functional
BRI1. A similar trend was observed for typhasterol and castasterone,
the biosynthetic precursors of brassinolide. The ratios were 33:17:1
and 128:51:1, respectively. The pattern and accumulation of BRs
suggests that the BRI1 gene controls either a step
associated with the binding of brassinolide to a receptor or a
subsequent downstream step.
The presence of abnormally high levels of brassinolide and castasterone
in BR-insensitive dwarf mutants indicates a link between BR
biosynthesis and BR action. In mutants with impaired response to BR, BR
biosynthesis might be normal or activated. Our preliminary study
suggested that the abundance of transcripts of biosynthesis enzymes
might be increased in bri1 mutants (S. Choe and K.A.
Feldmann, unpublished data). Detailed northern analyses and metabolic
studies will answer the question of whether BR biosynthesis in
bri1 mutants is activated or not.
Models for the Regulation of BR Synthesis and Signaling
End-product feedback regulation of biosynthetic genes is common
among plant hormones. For example, treatment of plants by exogenous
ethylene inhibits further ethylene production (Yang and Hoffman, 1984 ).
For GA and BRs, there is also evidence for negative regulation after
application of hormone, and a mechanism involving regulation at the
transcriptional level has also been demonstrated (Phillips et
al., 1995 ; Mathur et al., 1998 ). For example, treatment with specific
BR intermediates or end products such as brassinolide and castasterone
caused a reduction in the mRNA levels of the CPD gene, a
gene required for necessary structural modification of brassinolide.
Interestingly, this repression is inhibited by cycloheximide,
indicating that at least one factor needs to be newly synthesized for
this repression to occur (Mathur et al., 1998 ).
A second theme in these hormone biosynthetic and signaling pathways is
that mutants deficient in receptors or other downstream components fail
to regulate hormone levels. For example, the etr1-1 mutant
in Arabidopsis lacks the ability to suppress ethylene synthesis after
treatment with exogenous ethylene, although normal amounts of ethylene
are made in untreated plants (Bleecker et al., 1988 ). This suggests
that feedback regulation operates through a functional signaling
pathway. Accumulation of bioactive GAs has also been observed in
several mutants that are insensitive to GA treatment (Fujioka et al.,
1988 ; Talon et al., 1990 ; Appleford and Lenton, 1991 ). Of these three
GA insensitive genes in various plant species, only the molecular
nature of the GAI gene is known, and it encodes a product
related to transcription factors (Peng et al., 1997 ). In the
gai mutant, there is also an increase in the transcription of GA5, a key GA-biosynthetic gene, indicating, as with BRs, that there
is feedback regulation at the transcriptional level.
The results presented here indicate that the BRI1 gene is
required for feedback regulation of BR biosynthesis. There is
substantial accumulation of brassinolide and other intermediates in
both a null allele and two weak alleles of bri1. One
possibility is that BRI1, which encodes a predicted
transmembrane RK, phosphorylates cellular proteins that directly or
indirectly regulate the activity or transcription of BR-biosynthetic
proteins such as CPD. Alternatively, BRI1 phosphorylation could result
in the transcription and/or translation of a repressor of BR
biosynthesis, as has been proposed for the regulation of CPD (Mathur et
al., 1998 ). Interestingly, the lka mutant from pea, which is
BR insensitive, also accumulates bioactive BRs (Nomura et al., 1997 ,
1999 ). However, the degree of the accumulation is not so high in the
lka mutant. Presumably, the role of LKA in BR signaling
pathway could be different from that of BRI1, or lka may be
a weak allele of a pea BRI1 homolog. Molecular characterization of the
LKA gene will provide important information about its role
in the BR signaling pathway.
 |
ACKNOWLEDGMENTS |
We thank Steve Clouse for sending seeds of bri1-1 and
the Arabidopsis Biological Resource Center at Ohio State University for
supplying CS399 (bri1-6) seeds. We thank Alice Traut, Amanda Ross, and Brian Gregory for technical assistance with the mutant isolation and mapping.
 |
FOOTNOTES |
Received June 1, 1999; accepted July 23, 1999.
1
This work was supported by a Grant-in-Aid for
Scientific Research (B) from the Ministry of Education, Science,
Sports and Culture of Japan (grant no. 10460050 to S.F.), by the
National Science Foundation (grant no. 9604439 to K.A.F.), and by the
U.S. Department of Agriculture (grant no. 97-353044708 to F.E.T.).
*
Corresponding author; e-mail sfujioka{at}postman.riken.go.jp; fax
81-48-462-4674.
 |
LITERATURE CITED |
-
Altmann T
(1998)
Recent advances in brassinosteroid molecular genetics.
Curr Opin Plant Biol
1: 378-383
[CrossRef][Web of Science][Medline]
-
Appleford NEJ, Lenton JR
(1991)
Gibberellins and leaf expansion in near-isogenic wheat lines containing Rht1 and Rht3 dwarfing alleles.
Planta
183: 229-236
[Web of Science]
-
Azpiroz R, Wu Y, LoCascio JC, Feldmann KA
(1998)
An Arabidopsis brassinosteorid-dependent mutant is blocked in cell elongation.
Plant Cell
10: 219-230
[Abstract/Free Full Text]
-
Bell CJ, Ecker JR
(1994)
Assignment of thirty microsatellite loci to the linkage map of Arabidopsis.
Genomics
19: 137-144
[CrossRef][Web of Science][Medline]
-
Bishop GJ, Harrison K, Jones JDG
(1996)
The tomato DWARF gene isolated by heterologous transposon tagging encodes the first member of a new cytochrome P450 family.
Plant Cell
8: 959-969
[Abstract]
-
Bishop GJ, Nomura T, Yokota T, Harrison K, Noguchi T, Fujioka S, Takatsuto S, Jones JDG, Kamiya Y
(1999)
The tomato DWARF enzyme catalyzes C-6 oxidation in brassinosteroid biosynthesis.
Proc Natl Acad Sci USA
96: 1761-1766
[Abstract/Free Full Text]
-
Bleecker AB, Estelle MA, Somerville C, Kende H
(1988)
Insensitivity of ethylene conferred by a dominant mutation in Arabidopsis thaliana.
Science
241: 1086-1089
[Abstract/Free Full Text]
-
Blumerg B, Sabbagh W, Juguilon H, Bolado J, van Meter CM, Ong ES, Evans RM
(1998)
SXR, a novel steroid and xenobiotic-sensing nuclear receptor.
Genes Dev
12: 3195-3205
[Abstract/Free Full Text]
-
Choe S, Dilkes BP, Fujioka S, Takatsuto S, Sakurai A, Feldmann KA
(1998)
The DWF4 gene of Arabidopsis encodes a cytochrome P450 that mediates multiple 22
-hydroxylation steps in brassinosteroid biosynthesis.
Plant Cell
10: 231-243
[Abstract/Free Full Text] -
Choe S, Dilkes BP, Gregory BD, Ross AS, Yuan H, Noguchi T, Fujioka S, Takatsuto S, Tanaka A, Yoshida S, Tax FE, Feldmann KA
(1999a)
Arabidopsis dwarf1 is defective in the conversion of 24-methylenecholestrol to campesterol in brassinosteroid biosynthesis.
Plant Physiol
119: 897-907
[Abstract/Free Full Text]
-
Choe S, Noguchi T, Fujioka S, Takatsuto S, Tissier CP, Gregory BD, Ross AS, Tanaka A, Yoshida S, Tax FE, Feldmann KA
(1999b)
Arabidopsis dwf7/ste1 is defective in the
7 sterol C-5 desaturation step leading to brassinosteroid biosynthesis.
Plant Cell
11: 207-221
[Abstract/Free Full Text] -
Choi YH, Fujioka S, Harada A, Yokota T, Takatsuto S, Sakurai A
(1996)
A brassinolide biosynthetic pathway of 6-deoxocastasterone.
Phytochemistry
43: 593-596
[CrossRef]
-
Choi YH, Fujioka S, Nomura T, Harada A, Yokota T, Takatsuto S, Sakurai A
(1997)
An alternative brassinolide biosynthetic pathway via late C-6 oxidation.
Phytochemistry
44: 609-613
[CrossRef]
-
Chory J, Nagpal P, Peto CA
(1991)
Phenotypic and genetic analysis of det2, a new mutant that affects light-regulated seedling development in Arabidopsis.
Plant Cell
3: 445-459
[Abstract/Free Full Text]
-
Clark SE, Williams RW, Meyerowitz EM
(1997)
The CLAVATA1 gene encodes a putative receptor kinase that controls shoot and floral meristem size in Arabidopsis.
Cell
89: 575-585
[CrossRef][Web of Science][Medline]
-
Clouse SD, Feldmann KA
(1999)
Molecular genetics of brassinosteroid action.
In
A Sakurai, T Yokota, SD Clouse, eds, Brassinosteroids: Steroidal Plant Hormones. Springer-Verlag, Tokyo, pp 163-190
-
Clouse SD, Langford M, McMorris TC
(1996)
A brassinosteroid-insensitive mutant in Arabidopsis thaliana exhibits multiple defects in growth and development.
Plant Physiol
111: 671-678
[Abstract]
-
Clouse SD, Sasse JM
(1998)
Brassinosteroids: essential regulators of plant growth and development.
Annu Rev Plant Physiol Plant Mol Biol
49: 427-451
[CrossRef][Web of Science]
-
Dellaporta SL, Wood J, Hicks JB
(1983)
A plant DNA minipreparation: version II.
Plant Mol Biol Rep
1: 19-21
-
Ephritikhine G, Pagant S, Fujioka S, Takatsuto S, Lapous D, Caboche M, Kendrick RE, Barbier-Brygoo H
(1999)
The sax1 mutation defines a new locus involved in the brassinosteroid biosynthesis pathway in Arabidopsis thaliana.
Plant J
18: 315-320
[CrossRef][Web of Science][Medline]
-
Feldmann KA, Azpiroz R
(1994)
Primary dwarfs.
In
J Bowman, ed, Arabidopsis: An Atlas of Morphology and Development. Springer-Verlag, New York, pp 82-85
-
Feldmann KA, Marks MD
(1987)
Agrobacterium-mediated transformation of germinating seeds of Arabidopsis thaliana: a non-tissue culture approach.
Mol Gen Genet
208: 1-9
[CrossRef][Web of Science]
-
Feldmann KA, Marks MD, Christianson ML, Quatrano RS
(1989)
A dwarf mutant of Arabidopsis generated by T-DNA insertion mutagenesis.
Science
243: 1351-1354
[Abstract/Free Full Text]
-
Fujioka S, Choi YH, Takatsuto S, Yokota T, Li J, Chory J, Sakurai A
(1996)
Identification of castasterone, 6-deoxocastasterone, typhasterol and 6-deoxotyphasterol from the shoots of Arabidopsis thaliana.
Plant Cell Physiol
37: 1201-1203
[Abstract/Free Full Text]
-
Fujioka S, Li J, Choi YH, Seto H, Takatsuto S, Noguchi T, Watanabe T, Kuriyama H, Yokota T, Chory J, Sakurai A
(1997)
The Arabidopsis deetiolated2 mutant is blocked early in brassinosteroid biosynthesis.
Plant Cell
9: 1951-1962
[Abstract]
-
Fujioka S, Noguchi T, Yokota T, Takatsuto S, Yoshida S
(1998)
Brassinosteroids in Arabidopsis thaliana.
Phytochemistry
48: 595-599
[Medline]
-
Fujioka S, Sakurai A
(1997a)
Brassinosteroids.
Nat Prod Rep
14: 1-10
[CrossRef][Web of Science][Medline]
-
Fujioka S, Sakurai A
(1997b)
Biosynthesis and metabolism of brassinosteroids.
Physiol Plant
100: 710-715
[CrossRef]
-
Fujioka S, Yamane H, Spray CR, Katsumi M, Phinney BO, Gaskin P, MacMillan J, Takahashi N
(1988)
The dominant non-gibberellin-responding dwarf mutant (D8) of maize accumulates native gibberellins.
Proc Natl Acad Sci USA
85: 9031-9035
[Abstract/Free Full Text]
-
Harberd NP, King KE, Carol P, Cowling RJ, Peng J, Richards DE
(1998)
Gibberellin: inhibitor of an inhibitor of... ?
BioEssays
20: 1001-1008
[CrossRef][Web of Science][Medline]
-
Kauschmann A, Jessop A, Koncz C, Szekeres M, Willmitzer L, Altmann T
(1996)
Genetic evidence for an essential role of brassinosteroids in plant development.
Plant J
9: 701-713
[CrossRef]
-
Klahre U, Noguchi T, Fujioka S, Takatsuto S, Yokota T, Nomura T, Yoshida S, Chua NH
(1998)
The Arabidopsis DIMINUTO/DWARF1 gene encodes a protein involved in steroid synthesis.
Plant Cell
10: 1677-1690
[Abstract/Free Full Text]
-
Koka CV, Cerny RE, Gardner RG, Naguchi T, Fujioka S, Takatsuto S,
Yoshida S, Clouse SD (1999) A putative role for the tomato genes
DUMPY and CURL-3 in brassinosteroid biosynthesis and response. Plant
Physiol (in press)
-
Krysan PJ, Young JC, Tax F, Sussman MR
(1996)
Identification of transferred DNA insertions within Arabidopsis genes involved in signal transduction and ion transport.
Proc Natl Acad Sci USA
93: 8145-8150
[Abstract/Free Full Text]
-
Li J, Biswas M, Chao A, Russel D, Chory J
(1997)
Conservation of function between mammalian and plant steroid 5
-reductase.
Proc Natl Acad Sci USA
94: 3554-3559
[Abstract/Free Full Text] -
Li J, Chory J
(1997)
A putative leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction.
Cell
90: 929-938
[CrossRef][Web of Science][Medline]
-
Li J, Nagpal P, Vitart V, McMorris TC, Chory J
(1996)
A role for brassinosteroids in light-dependent development of Arabidopsis.
Science
272: 398-401
[Abstract]
-
Mathur J, Molnar G, Fujioka S, Takatsuto S, Sakurai A, Yokota T, Adam G, Voigt B, Nagy F, Maas C, Schell J, Koncz C, Szekeres M
(1998)
Transcription of the Arabidopsis CPD gene, encoding a steroidogenic cytochrome P450, is negatively controlled by brassinosteroid.
Plant J
14: 593-602
[CrossRef][Web of Science][Medline]
-
Noguchi T, Fujioka S, Takatsuto S, Sakurai A, Yoshida S, Li J, Chory J
(1999)
Arabidopsis det2 is defective in the conversion of (24R)-24-methylcholest-4-en-3-one to (24R)-24-methyl-5
-cholestan-3-one in brassinosteroid biosynthesis.
Plant Physiol
120: 833-839
[Abstract/Free Full Text] -
Nomura T, Kitasaka Y, Takatsuto S, Reid JB, Fukami M, Yokota T
(1999)
Brassinosteroid/sterol synthesis and plant growth as affected by lka and lkb mutations of pea.
Plant Physiol
119: 1517-1526
[Abstract/Free Full Text]
-
Nomura T, Nakayama M, Reid JB, Takeuchi Y, Yokota T
(1997)
Blockage of brassinosteroid biosynthesis and sensitivity cause dwarfism in garden pea.
Plant Physiol
113: 31-37
[Abstract]
-
Peng J, Carol P, Richards DE, King KE, Cowling RJ, Murphey GP, Harberd NP
(1997)
The Arabidopsis GAI gene defines a signaling pathway that negatively regulates gibberellin responses.
Genes Dev
11: 3194-3205
[Abstract/Free Full Text]
-
Phillips AL, Ward DA, Uknes S, Appleford NEJ, Lange T, Huttly AK, Gaskin P, Graebe JE, Hedden P
(1995)
Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.
Plant Physiol
108: 1049-1057
[Abstract]
-
Sakurai A, Fujioka S
(1997)
Studies on biosynthesis of brassinosteroids.
Biosci Biotechnol Biochem
61: 757-762
[Medline]
-
Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu LH, Fauquet C, Ronald P
(1995)
A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21.
Science
270: 1804-1806
[Abstract/Free Full Text]
-
Szekeres M, Nemeth K, Koncz-Kalman Z, Mathur J, Kauschmann A, Altmann T, Redei GP, Nagy F, Schell J, Koncz C
(1996)
Brassinosteroids rescue the deficiency of CYP90, a cytochrome P450, controlling cell elongation and de-etiolation in Arabidopsis.
Cell
85: 171-182
[CrossRef][Web of Science][Medline]
-
Takahashi T, Gasch A, Nishizawa N, Chua NH
(1995)
The DIMINUTO gene of Arabidopsis is involved in regulating cell elongation.
Genes Dev
9: 97-107
[Abstract/Free Full Text]
-
Takatsuto S, Gotoh C, Noguchi T, Nomura T, Fujioka S, Yokota T
(1998) Synthesis of deuterio-labelled 24-methylenecholesterol and
related steroids. J Chem Research (S) 206-207
-
Takatsuto S, Ikekawa N
(1986)
Synthesis of deuterio-labelled brassinosteroids, [26,28-2H6]brassinolide, and [26,28-2H6]castasterone, [26,28-2H6]typhasterol, and [26,28-2H6]teasterone.
Chem Pharm Bull
34: 4045-4049
-
Talon M, Koornneef M, Zeevaart JAD
(1990)
Accumulation of C19-gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis thaliana (L.) Heynh.
Planta
182: 501-505
[CrossRef]
-
Walker JC
(1993)
Receptor-like protein kinase genes of Arabidopsis thaliana.
Plant J
3: 451-456
[CrossRef][Web of Science][Medline]
-
Wilkinson HA, Fitzgerald K, Greenwald I
(1994)
Reciprocal changes in expression of the receptor lin-12 and its ligand lag-2 prior to commitment in a C. elegans cell fate decision.
Cell
79: 1187-1198
[CrossRef][Web of Science][Medline]
-
Yang SF, Hoffman NE
(1984)
Ethylene biosynthesis and its regulation in higher plants.
Annu Rev Plant Physiol
35: 155-189
[CrossRef][Web of Science]
-
Yokota T
(1997)
The structure, biosynthesis and function of brassinosteroids.
Trends Plant Sci
2: 137-143
[CrossRef][Web of Science]
-
Yokota T, Nomura T, Kitasaka Y, Takatsuto S, Reid JB
(1997)
Biosynthetic lesions in brassinosteroid-deficient pea mutants.
In
JG Latimer, ed, The 24th Proceedings of Plant Growth Regulation Society of America, Atlanta, Georgia, August, 1997. The Plant Growth Regulation Society of America, LaGrange, GA, p 94
© 1999 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
B. Kang, H. Wang, K. H. Nam, J. Li, and J. Li
Activation-Tagged Suppressors of a Weak Brassinosteroid Receptor Mutant
Mol Plant,
January 1, 2010;
3(1):
260 - 268.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-Y. Zhang, M.-Y. Bai, J. Wu, J.-Y. Zhu, H. Wang, Z. Zhang, W. Wang, Y. Sun, J. Zhao, X. Sun, et al.
Antagonistic HLH/bHLH Transcription Factors Mediate Brassinosteroid Regulation of Cell Elongation and Plant Development in Rice and Arabidopsis
PLANT CELL,
December 1, 2009;
21(12):
3767 - 3780.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Wang, Y. Zhu, S. Fujioka, T. Asami, J. Li, and J. Li
Regulation of Arabidopsis Brassinosteroid Signaling by Atypical Basic Helix-Loop-Helix Proteins
PLANT CELL,
December 1, 2009;
21(12):
3781 - 3791.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Yan, J. Zhao, P. Peng, R. K. Chihara, and J. Li
BIN2 Functions Redundantly with Other Arabidopsis GSK3-Like Kinases to Regulate Brassinosteroid Signaling
Plant Physiology,
June 1, 2009;
150(2):
710 - 721.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Guo, L. Li, H. Ye, X. Yu, A. Algreen, and Y. Yin
Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana
PNAS,
May 5, 2009;
106(18):
7648 - 7653.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Pereira-Netto, U. Roessner, S. Fujioka, A. Bacic, T. Asami, S. Yoshida, and S. D. Clouse
Shooting control by brassinosteroids: metabolomic analysis and effect of brassinazole on Malus prunifolia, the Marubakaido apple rootstock
Tree Physiol,
April 1, 2009;
29(4):
607 - 620.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. de Lorenzo, F. Merchan, P. Laporte, R. Thompson, J. Clarke, C. Sousa, and M. Crespi
A Novel Plant Leucine-Rich Repeat Receptor Kinase Regulates the Response of Medicago truncatula Roots to Salt Stress
PLANT CELL,
February 1, 2009;
21(2):
668 - 680.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-H. Oh, X. Wang, U. Kota, M. B. Goshe, S. D. Clouse, and S. C. Huber
Tyrosine phosphorylation of the BRI1 receptor kinase emerges as a component of brassinosteroid signaling in Arabidopsis
PNAS,
January 13, 2009;
106(2):
658 - 663.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Hong, H. Jin, T. Tzfira, and J. Li
Multiple Mechanism-Mediated Retention of a Defective Brassinosteroid Receptor in the Endoplasmic Reticulum of Arabidopsis
PLANT CELL,
December 1, 2008;
20(12):
3418 - 3429.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-y. Wu, A. Trieu, P. Radhakrishnan, S. F. Kwok, S. Harris, K. Zhang, J. Wang, J. Wan, H. Zhai, S. Takatsuto, et al.
Brassinosteroids Regulate Grain Filling in Rice
PLANT CELL,
August 1, 2008;
20(8):
2130 - 2145.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Gao, S. Wang, T. Asami, and J.-G. Chen
Loss-of-Function Mutations in the Arabidopsis Heterotrimeric G-protein {alpha} Subunit Enhance the Developmental Defects of Brassinosteroid Signaling and Biosynthesis Mutants
Plant Cell Physiol.,
July 1, 2008;
49(7):
1013 - 1024.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Deng, X. Zhang, W. Tang, J. A. Oses-Prieto, N. Suzuki, J. M. Gendron, H. Chen, S. Guan, R. J. Chalkley, T. K. Peterman, et al.
A Proteomics Study of Brassinosteroid Response in Arabidopsis
Mol. Cell. Proteomics,
December 1, 2007;
6(12):
2058 - 2071.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ryu, K. Kim, H. Cho, J. Park, S. Choe, and I. Hwang
Nucleocytoplasmic Shuttling of BZR1 Mediated by Phosphorylation Is Essential in Arabidopsis Brassinosteroid Signaling
PLANT CELL,
September 1, 2007;
19(9):
2749 - 2762.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Li, T. Asami, X. Wu, E. W.T. Tsang, and A. J. Cutler
A Putative Hydroxysteroid Dehydrogenase Involved in Regulating Plant Growth and Development
Plant Physiology,
September 1, 2007;
145(1):
87 - 97.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Domagalska, F. M. Schomburg, R. M. Amasino, R. D. Vierstra, F. Nagy, and S. J. Davis
Attenuation of brassinosteroid signaling enhances FLC expression and delays flowering
Development,
August 1, 2007;
134(15):
2841 - 2850.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Chow and P. McCourt
Plant hormone receptors: perception is everything
Genes & Dev.,
August 1, 2006;
20(15):
1998 - 2008.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Nakamoto, A. Ikeura, T. Asami, and K. T. Yamamoto
Inhibition of Brassinosteroid Biosynthesis by Either a dwarf4 Mutation or a Brassinosteroid Biosynthesis Inhibitor Rescues Defects in Tropic Responses of Hypocotyls in the Arabidopsis Mutant nonphototropic hypocotyl 4
Plant Physiology,
June 1, 2006;
141(2):
456 - 464.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Karlova, S. Boeren, E. Russinova, J. Aker, J. Vervoort, and S. de Vries
The Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE1 Protein Complex Includes BRASSINOSTEROID-INSENSITIVE1
PLANT CELL,
March 1, 2006;
18(3):
626 - 638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. B. Kim, M. Kwon, H. Ryu, S. Fujioka, S. Takatsuto, S. Yoshida, C. S. An, I. Lee, I. Hwang, and S. Choe
The Regulation of DWARF4 Expression Is Likely a Critical Mechanism in Maintaining the Homeostasis of Bioactive Brassinosteroids in Arabidopsis
Plant Physiology,
February 1, 2006;
140(2):
548 - 557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. FUKUTA, K. FUKUZONO, H. KAWAIDE, H. ABE, and M. NAKAYAMA
Physical Restriction of Pods Causes Seed Size Reduction of a Brassinosteroid-deficient Faba Bean (Vicia faba)
Ann. Bot.,
January 1, 2006;
97(1):
65 - 69.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Poppenberger, S. Fujioka, K. Soeno, G. L. George, F. E. Vaistij, S. Hiranuma, H. Seto, S. Takatsuto, G. Adam, S. Yoshida, et al.
From the Cover: The UGT73C5 of Arabidopsis thaliana glucosylates brassinosteroids
PNAS,
October 18, 2005;
102(42):
15253 - 15258.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Li, J. Xu, Z.-H. Xu, and H.-W. Xue
Brassinosteroids Stimulate Plant Tropisms through Modulation of Polar Auxin Transport in Brassica and Arabidopsis
PLANT CELL,
October 1, 2005;
17(10):
2738 - 2753.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T.-W. Kim, J.-Y. Hwang, Y.-S. Kim, S.-H. Joo, S. C. Chang, J. S. Lee, S. Takatsuto, and S.-K. Kim
Arabidopsis CYP85A2, a Cytochrome P450, Mediates the Baeyer-Villiger Oxidation of Castasterone to Brassinolide in Brassinosteroid Biosynthesis
PLANT CELL,
August 1, 2005;
17(8):
2397 - 2412.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chevalier, M. Batoux, L. Fulton, K. Pfister, R. K. Yadav, M. Schellenberg, and K. Schneitz
STRUBBELIG defines a receptor kinase-mediated signaling pathway regulating organ development in Arabidopsis
PNAS,
June 21, 2005;
102(25):
9074 - 9079.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Wang, M. B. Goshe, E. J. Soderblom, B. S. Phinney, J. A. Kuchar, J. Li, T. Asami, S. Yoshida, S. C. Huber, and S. D. Clouse
Identification and Functional Analysis of in Vivo Phosphorylation Sites of the Arabidopsis BRASSINOSTEROID-INSENSITIVE1 Receptor Kinase
PLANT CELL,
June 1, 2005;
17(6):
1685 - 1703.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Tanaka, T. Asami, S. Yoshida, Y. Nakamura, T. Matsuo, and S. Okamoto
Brassinosteroid Homeostasis in Arabidopsis Is Ensured by Feedback Expressions of Multiple Genes Involved in Its Metabolism
Plant Physiology,
June 1, 2005;
138(2):
1117 - 1125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Cano-Delgado, Y. Yin, C. Yu, D. Vafeados, S. Mora-Garcia, J.-C. Cheng, K. H. Nam, J. Li, and J. Chory
BRL1 and BRL3 are novel brassinosteroid receptors that function in vascular differentiation in Arabidopsis
Development,
November 1, 2004;
131(21):
5341 - 5351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. H. Nam and J. Li
The Arabidopsis Transthyretin-Like Protein Is a Potential Substrate of BRASSINOSTEROID-INSENSITIVE 1
PLANT CELL,
September 1, 2004;
16(9):
2406 - 2417.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nomura, C. E. Jager, Y. Kitasaka, K. Takeuchi, M. Fukami, K. Yoneyama, Y. Matsushita, H. Nyunoya, S. Takatsuto, S. Fujioka, et al.
Brassinosteroid Deficiency Due to Truncated Steroid 5{alpha}-Reductase Causes Dwarfism in the lk Mutant of Pea
Plant Physiology,
August 1, 2004;
135(4):
2220 - 2229.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mora-Garcia, G. Vert, Y. Yin, A. Cano-Delgado, H. Cheong, and J. Chory
Nuclear protein phosphatases with Kelch-repeat domains modulate the response to brassinosteroids in Arabidopsis
Genes & Dev.,
February 15, 2004;
18(4):
448 - 460.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Nakamura, K. Higuchi, H. Goda, M. T. Fujiwara, S. Sawa, T. Koshiba, Y. Shimada, and S. Yoshida
Brassinolide Induces IAA5, IAA19, and DR5, a Synthetic Auxin Response Element in Arabidopsis, Implying a Cross Talk Point of Brassinosteroid and Auxin Signaling
Plant Physiology,
December 1, 2003;
133(4):
1843 - 1853.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Chono, I. Honda, H. Zeniya, K. Yoneyama, D. Saisho, K. Takeda, S. Takatsuto, T. Hoshino, and Y. Watanabe
A Semidwarf Phenotype of Barley uzu Results from a Nucleotide Substitution in the Gene Encoding a Putative Brassinosteroid Receptor
Plant Physiology,
November 1, 2003;
133(3):
1209 - 1219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-X. He, S. Fujioka, T.-C. Li, S. G. Kang, H. Seto, S. Takatsuto, S. Yoshida, and J.-C. Jang
Sterols Regulate Development and Gene Expression in Arabidopsis
Plant Physiology,
March 1, 2003;
131(3):
1258 - 1269.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Shimada, H. Goda, A. Nakamura, S. Takatsuto, S. Fujioka, and S. Yoshida
Organ-Specific Expression of Brassinosteroid-Biosynthetic Genes and Distribution of Endogenous Brassinosteroids in Arabidopsis
Plant Physiology,
January 1, 2003;
131(1):
287 - 297.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Thummel and J. Chory
Steroid signaling in plants and insects---common themes, different pathways
Genes & Dev.,
December 15, 2002;
16(24):
3113 - 3129.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Montoya, T. Nomura, K. Farrar, T. Kaneta, T. Yokota, and G. J. Bishop
Cloning the Tomato Curl3 Gene Highlights the Putative Dual Role of the Leucine-Rich Repeat Receptor Kinase tBRI1/SR160 in Plant Steroid Hormone and Peptide Hormone Signaling
PLANT CELL,
December 1, 2002;
14(12):
3163 - 3176.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Friedrichsen, J. Nemhauser, T. Muramitsu, J. N. Maloof, J. Alonso, J. R. Ecker, M. Furuya, and J. Chory
Three Redundant Brassinosteroid Early Response Genes Encode Putative bHLH Transcription Factors Required for Normal Growth
Genetics,
November 1, 2002;
162(3):
1445 - 1456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Choe, R. J. Schmitz, S. Fujioka, S. Takatsuto, M.-O. Lee, S. Yoshida, K. A. Feldmann, and F. E. Tax
Arabidopsis Brassinosteroid-Insensitive dwarf12 Mutants Are Semidominant and Defective in a Glycogen Synthase Kinase 3beta -Like Kinase
Plant Physiology,
November 1, 2002;
130(3):
1506 - 1515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhao, P. Peng, R. J. Schmitz, A. D. Decker, F. E. Tax, and J. Li
Two Putative BIN2 Substrates Are Nuclear Components of Brassinosteroid Signaling
Plant Physiology,
November 1, 2002;
130(3):
1221 - 1229.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Goda, Y. Shimada, T. Asami, S. Fujioka, and S. Yoshida
Microarray Analysis of Brassinosteroid-Regulated Genes in Arabidopsis
Plant Physiology,
November 1, 2002;
130(3):
1319 - 1334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bancos, T. Nomura, T. Sato, G. Molnar, G. J. Bishop, C. Koncz, T. Yokota, F. Nagy, and M. Szekeres
Regulation of Transcript Levels of the Arabidopsis Cytochrome P450 Genes Involved in Brassinosteroid Biosynthesis
Plant Physiology,
September 1, 2002;
130(1):
504 - 513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ullah, J.-G. Chen, S. Wang, and A. M. Jones
Role of a Heterotrimeric G Protein in Regulation of Arabidopsis Seed Germination
Plant Physiology,
June 1, 2002;
129(2):
897 - 907.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Bishop and C. Koncz
Brassinosteroids and Plant Steroid Hormone Signaling
PLANT CELL,
May 1, 2002;
14(90001):
S97 - 110.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Bouquin, C. Meier, R. Foster, M. E. Nielsen, and J. Mundy
Control of Specific Gene Expression by Gibberellin and Brassinosteroid
Plant Physiology,
October 1, 2001;
127(2):
450 - 458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Li, K. H. Nam, D. Vafeados, and J. Chory
BIN2, a New Brassinosteroid-Insensitive Locus in Arabidopsis
Plant Physiology,
September 1, 2001;
127(1):
14 - 22.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. E. Tax and D. M. Vernon
T-DNA-Associated Duplication/Translocations in Arabidopsis. Implications for Mutant Analysis and Functional Genomics
Plant Physiology,
August 1, 2001;
126(4):
1527 - 1538.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Shimada, S. Fujioka, N. Miyauchi, M. Kushiro, S. Takatsuto, T. Nomura, T. Yokota, Y. Kamiya, G. J. Bishop, and S. Yoshida
Brassinosteroid-6-Oxidases from Arabidopsis and Tomato Catalyze Multiple C-6 Oxidations in Brassinosteroid Biosynthesis
Plant Physiology,
June 1, 2001;
126(2):
770 - 779.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Li, K. A. Lease, F. E. Tax, and J. C. Walker
BRS1, a serine carboxypeptidase, regulates BRI1 signaling in Arabidopsis thaliana
PNAS,
April 18, 2001;
(2001)
91065998.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. J. Bishop and T. Yokota
Plants Steroid Hormones, Brassinosteroids: Current Highlights of Molecular Aspects on their Synthesis/Metabolism, Transport, Perception and Response
Plant Cell Physiol.,
February 1, 2001;
42(2):
114 - 120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-H. Oh, W. K. Ray, S. C. Huber, J. M. Asara, D. A. Gage, and S. D. Clouse
Recombinant Brassinosteroid Insensitive 1 Receptor-Like Kinase Autophosphorylates on Serine and Threonine Residues and Phosphorylates a Conserved Peptide Motif in Vitro
Plant Physiology,
October 1, 2000;
124(2):
751 - 766.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Yamamuro, Y. Ihara, X. Wu, T. Noguchi, S. Fujioka, S. Takatsuto, M. Ashikari, H. Kitano, and M. Matsuoka
Loss of Function of a Rice brassinosteroid insensitive1 Homolog Prevents Internode Elongation and Bending of the Lamina Joint
PLANT CELL,
September 1, 2000;
12(9):
1591 - 1606.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. Noguchi, S. Fujioka, S. Choe, S. Takatsuto, F. E. Tax, S. Yoshida, and K. A. Feldmann
Biosynthetic Pathways of Brassinolide in Arabidopsis
Plant Physiology,
September 1, 2000;
124(1):
201 - 210.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. M. Friedrichsen, C. A.P. Joazeiro, J. Li, T. Hunter, and J. Chory
Brassinosteroid-Insensitive-1 Is a Ubiquitously Expressed Leucine-Rich Repeat Receptor Serine/Threonine Kinase
Plant Physiology,
August 1, 2000;
123(4):
1247 - 1256.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J.-C. Jang, S. Fujioka, M. Tasaka, H. Seto, S. Takatsuto, A. Ishii, M. Aida, S. Yoshida, and J. Sheen
A critical role of sterols in embryonic patterning and meristem programming revealed by the fackel mutants of Arabidopsis thaliana
Genes & Dev.,
June 15, 2000;
14(12):
1485 - 1497.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. Asami, M. Mizutani, S. Fujioka, H. Goda, Y. K. Min, Y. Shimada, T. Nakano, S. Takatsuto, T. Matsuyama, N. Nagata, et al.
Selective Interaction of Triazole Derivatives with DWF4, a Cytochrome P450 Monooxygenase of the Brassinosteroid Biosynthetic Pathway, Correlates with Brassinosteroid Deficiency in Planta
J. Biol. Chem.,
July 6, 2001;
276(28):
25687 - 25691.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Li, K. A. Lease, F. E. Tax, and J. C. Walker
BRS1, a serine carboxypeptidase, regulates BRI1 signaling in Arabidopsis thaliana
PNAS,
May 8, 2001;
98(10):
5916 - 5921.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|