|
Plant Physiol, March 2000, Vol. 122, pp. 635-644
Purification of a Jojoba Embryo Fatty Acyl-Coenzyme A Reductase
and Expression of Its cDNA in High Erucic Acid Rapeseed
James G.
Metz,*
Michael R.
Pollard,1
Lana
Anderson,
Thomas R.
Hayes, and
Michael W.
Lassner2
Calgene Campus, Monsanto, 1920 Fifth Street, Davis,
California 95616
 |
ABSTRACT |
The
jojoba (Simmondsia chinensis) plant produces esters of
long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of
other plants. We purified an alcohol-forming fatty acyl-coenzyme A
reductase (FAR) from developing embryos and cloned the cDNA encoding
the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an
Arabidopsis protein of unknown function that is essential for pollen
development. When the jojoba FAR cDNA is expressed in embryos of
Brassica napus, long-chain alcohols can be detected in
transmethylated seed oils. Resynthesis of the gene to reduce its A plus
T content resulted in increased levels of alcohol production. In
addition to free alcohols, novel wax esters were detected in the
transgenic seed oils. In vitro assays revealed that B.
napus embryos have an endogenous fatty acyl-coenzyme A: fatty
alcohol acyl-transferase activity that could account for this wax
synthesis. Thus, introduction of a single cDNA into B.
napus results in a redirection of a portion of seed oil
synthesis from triglycerides to waxes.
 |
INTRODUCTION |
Long-chain primary alcohols are found throughout the biological
world. They occur both as free alcohols and, more commonly, in a
combined state. Waxes (oxygen esters of fatty alcohols and fatty acids)
can be major components of biological systems and fill a variety of
functions. They are found on the surfaces of plants and animals and
provide protection against various stresses such as desiccation,
wetting, and pathogen attack. Many microorganisms, such as
Acinetobacter sp., Euglena gracilis, and some
marine algae, store waxes as energy reserves. Bees produce and secrete
wax to form a structure in the hive in which larvae are protected and food is stored. The large spermaceti organ in the head of the sperm
whale is filled with a mixture of waxes and triglycerides. It is
thought that the whale regulates its buoyancy during deep dives by
thermally altering the physical state, and thus the density, of this
mixture. Fatty alcohols are also precursors of ether lipids, which are
found in a number of animal tissues, especially nervous system tissues,
in which they can be a major component of the lipid fraction.
The biochemistry of fatty alcohol synthesis has been examined in
diverse organisms. In several cases it has been demonstrated that the
alcohol is formed by a four-electron reduction of fatty acyl-coenzyme A
(CoA) (Kahn and Kolattukudy, 1973 ; Kolattukudy and Rogers, 1978 ; Bishop
and Hajra, 1981 ; Wu et al., 1981 ; Kolattukudy and Rogers, 1986 ).
NADH or NADPH is used as a cofactor to accomplish this reduction.
Although the alcohol-generating FAR reactions proceed through an
aldehyde intermediate, a free aldehyde is not released (Kolattukudy,
1970 ). Thus, the alcohol-forming FARs are distinct from those enzymes
that carry out two-electron reductions of fatty acyl-CoA and yield free
fatty aldehyde as a product (Wang and Kolattukudy, 1995a ; Reiser and
Somerville, 1997 ; Vioque and Kolattukudy, 1997 ). A further distinction
is that the alcohol-forming FARs are thought to be integral membrane
proteins, whereas those that carry out two-electron reductions are
either soluble enzymes or have a peripheral membrane association.
Alcohol-forming FARs have been purified from pea leaves (Vioque and
Kolattukudy, 1997 ) and from duck uropygial glands (Wang and
Kolattukudy, 1995b ). Both of these proteins have apparent masses of
approximately 58 kD. The aldehyde-generating proteins that have been
identified so far have masses of approximately 30 kD (Wang and
Kolattukudy, 1995a ; Reiser and Somerville, 1997 ; Vioque and
Kolattukudy, 1997 ).
Jojoba (Simmondsia chinensis) is a native of deserts of the
American Southwest, and is unusual among higher plants in that its seed
storage lipids are waxes rather than triglycerides. These waxes, which
can comprise up to 60% of the dry weight of the almond-sized seed, are
esters of long-chain (mostly C20, C22, and C24), monounsaturated fatty
acids and alcohols (Miwa, 1971 ). The waxes are produced in developing
embryos during seed formation (Ohlrogge et al., 1978 ; Pollard et al.,
1979 ; Wu et al., 1981 ). In jojoba, as in many other oil seed plants,
oleic acid (C18:1) is synthesized in plastids by soluble enzymes via
acyl-carrier protein (ACP)-linked intermediates. Oleic acid is exported
from the plastid and converted to a CoA ester. A membrane-associated
fatty acyl-CoA elongase (FAE) system then produces the C20:1, C22:1,
and C24:1 acyl-CoAs, which are the precursors of wax synthesis.
Long-chain acyl-CoA is reduced to alcohol by FAR, and the wax storage
lipid is formed by a fatty acyl-CoA: fatty alcohol acyltransferase
(wax synthase, WS) activity. The fatty acid and alcohol compositions of
the waxes indicate that the jojoba FAR has a preference for
very-long-chain acyl-CoA substrates and that C18:1 acyl-CoA is a
relatively poor substrate.
In contrast to the extensive biochemical characterizations of
alcohol-forming FAR and WS, the genetic and evolutionary aspects of
these enzymes are far less clear. To our knowledge, genes associated with an alcohol-forming FAR have not previously been reported and,
except for the case of jojoba embryos (Lardizabal et al., 2000 ),
neither proteins nor genes associated with a WS have been identified.
In this report we describe the purification of a membrane-associated, NADPH-dependent alcohol-forming FAR from developing jojoba embryos, as
well as the cloning of a cDNA that encodes FAR. The identity of the
cDNA clone was confirmed by detection of FAR activity and free alcohols
in bacteria expressing the clone. In addition, we show that expression
of the jojoba cDNA in developing embryos of Brassica napus
results in not only the synthesis of long-chain alcohols in the
transformed tissues, but also in the appearance of novel wax esters.
Conversion of the fatty alcohols to waxes in the transgenic plants is
not always complete, and the overall level of alcohol and wax
production is relatively low. In an accompanying paper, we show that
efficient conversion of fatty alcohol into wax esters in transgenic
plants can be accomplished by co-expression of a cDNA encoding a jojoba
wax synthase enzyme (Lardizabal et al., 2000 ). The accession number for
the jojoba FAR reductase mRNA is AF149917; the accession number for the
altered codon mRNA is AF149918.
 |
MATERIALS AND METHODS |
Enzyme Assays
FAR activity was assayed by measuring the formation of
tetracosenol from
[1-14C]tetracos-cis-15-enoyl-CoA (C24:1-CoA)
(custom synthesis, Amersham-Pharmacia Biotech, Uppsala). Assay mixtures
contained 17 µM C24:1-CoA (10 Ci/mol), 15 mM
NADPH, 0.5 M NaCl, 25 mM
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-NaOH, pH
7.5, 1 mM dithiothreitol (DTT), 1 mM EDTA, 10%
(w/v) glycerol, and 0.3% (w/v)
3-[(3-cholamidopropyl)-dimethylammonio]-1-propane-sulfonate (CHAPS) in a final volume of 250 µL. For analysis of column
fractions, 2 mM NADPH was used and the NaCl concentration
varied from 0.3 to 0.6 M. Incubations were performed at
30°C for 30 min and were stopped by the addition of 250 µL of
isopropanol:acetic acid (4:1, v/v). Neutral lipids were extracted using
a method modified from Hara and Radin (1978) . Hexane:isopropanol (3:2,
v/v, 4 mL), which also contained cold carriers (oleyl alcohol and oleic
acid, both at 12.5 µg/mL, and "jojoba bean oil" [Sigma-Aldrich,
St. Louis] at 6.25 µg/mL) were added, followed by 2 mL of 6.7%
(w/v) sodium sulfate.
Radioactivity present in the organic phase was determined using liquid
scintillation counting, whereas a second portion was used for
thin-layer chromatography (TLC) analysis (silica gel-G, developed with
hexane:diethyl ether:acetic acid [70:30:2, v/v]). Radioactivity on
the TLC plates was localized and quantitated with a radioanalytic
scanner (Scanalytics, Billerica, MA). The jojoba embryo WS activity was
completely inhibited by 0.3% (w/v) CHAPS, thus simplifying
quantitation of FAR activity. WS assays of extracts of developing
B. napus embryos were performed as
described in Lassner et al. (1996) using the neutral lipid extraction
procedure and the TLC system described here for the FAR assays.
Enzyme Purification and Protein Sequencing
Developing seeds of jojoba were harvested from plantations in
Arizona during the period of maximal wax synthesis. Embryos were
dissected and a microsomal membrane fraction was isolated essentially
as described in Lassner et al. (1996) . The protein concentration of
membrane preparations was typically between 7 and 9 mg/mL. Solid CHAPS
was added to the suspension to a final concentration of 2% (w/v).
After gentle stirring on ice for 1 h, the CHAPS and NaCl
concentrations were adjusted to 0.75% (w/v) and 0.4 M,
respectively, and the sample was centrifuged (200,000g for
1 h). The supernatant fraction was used immediately for
chromatography. All chromatography solutions contained 25 mM HEPES-NaOH, pH 7.5, 20% (w/v) glycerol,
0.75% (w/v) CHAPS, and 1 mM EDTA (buffer A). Additionally, NaCl was added to the buffer A solution at the following levels: 0.1 M (buffer B), 0.4 M (buffer C), 0.5 M (buffer
D), and 1.0 M (buffer E).
The 200,000g supernatant fraction was applied to a Blue A
agarose (Amicon, Beverly, MA) column that had been equilibrated with
buffer C. After washing with buffer C and then with buffer D, FAR
activity was eluted with buffer E. Pooled material from the Blue A
column was concentrated approximately 8-fold via ultrafiltration in a
pressure cell fitted with a YM30 membrane (Amicon). The concentrated sample (in 4-mL aliquots) was applied to a Sephacryl S-100 HR (Amersham-Pharmacia Biotech) column (2.5 × 90 cm) that had been equilibrated with buffer D. The S-100 column was also used to estimate
the size of the solubilized FAR compared with the elution pattern of
molecular mass standards (Bio-Rad Laboratories, Hercules, CA)
chromatographed under the same column and buffer conditions. Fractions
that contained high levels of FAR activity were pooled and
concentrated (approximately 20-fold) via ultrafiltration as before. The NaCl concentration was reduced to 0.1 M by dilution with buffer A and the
sample was loaded onto a palmitoyl-CoA-agarose (Sigma) column
(1.0 × 1.5 cm) that had been equilibrated with buffer B. The
column was then washed sequentially with: buffer B, buffer B containing
10 mM NADH, buffer B, and buffer B containing 15 mM NADPH.
Proteins present in the various samples were resolved by SDS-PAGE using
a 10% to 15% (w/v) acrylamide gradient. Silver staining was
performed according to the method of Blum et al. (1987) . Protein concentrations were determined as described by Bradford (1976) using
bovine serum albumin as a standard. The protein sequencing strategy and
methodology were essentially as described in Knutzon et al. (1995) .
cDNA Cloning
RNA isolation and cDNA library construction were previously
described (Lassner et al., 1996 ). For use as a template for PCR amplification, first-strand cDNA was synthesized using Moloney murine
leukemia virus reverse transcriptase (Life Technologies/Gibco-BRL, Cleveland) according to the manufacturer's directions
using the primer CCAAGCTTCTGCAGGAGCTCTTTTTTTTTTTTTTT.
At an early stage of protein purification, the N-terminal amino acid
sequence GATEKSIKSTMKDMGIERA was obtained from a 32-kD polypeptide that
appeared to track with FAR activity during chromatography. We performed
3' RACE (Frohman et al., 1988 ) using the primers ATGAARGAYATGGGNATHGA
(based on the amino acid sequence MKDMGIE from the 32-kD peptide
mentioned above) and CCAAGCTTCTGCAGGAGCTC to PCR amplify a 1-kb DNA
fragment from a first-strand cDNA template. The 1-kb PCR product was
purified by agarose gel electrophoresis and cloned in pCR1000 according
to the manufacturer's protocol (Invitrogen, Carlsbad, CA). This clone
was used as a probe to isolate full-length cDNAs from a library
constructed using the procedure of Alexander (1987) . DNA sequence
analysis was performed using MacVector Software (IBI/Kodak, Rochester,
NY). TopPredII software (Claros and Van Heijne, 1994 ) was
used to determine potential transmembrane domains. The deduced protein
sequence was used to search non-redundant databases using the BLAST
service provided by the National Center for Biotechnology Information
(Altschul et al., 1990 ).
Antibody Production and Immunoblot Analysis
The PCR primers TCTAGAGGATCCCAATGGTTCAAGGGTAAGTAC and
GGATCCGAATTCTTAGTTAAGAACGTGCTCTACGAC were used to
amplify a region of the FAR cDNA encoding amino acids 410 to 493, a
hydrophilic region of the protein. The PCR product was cloned as a
BamHI-EcoRI fragment into pGEX2T, and the
protein was prepared as described in Lassner et al. (1996) .
The protein was used to produce antiserum in rabbits (Berkeley Antibody
Company, Richmond, CA). Immunoblot analysis was
performed by running Novex 12% Tris-Gly gels and
electroblotting the proteins to nitrocellulose membranes. The blots
were probed using the antiserum, alkaline-phosphatase-conjugated goat
anti-rabbit IgG, and western blue staining according to the
manufacturer's protocols (Promega, Madison, WI).
Expression of FAR in Escherichia coli
In vitro mutagenesis (Kunkel et al., 1987 ) was used to introduce
an NdeI site at the ATG of the reductase open reading frame, and the resulting reductase DNA fragment was cloned into pET3A (Rosenberg et al., 1987 ). The derivative plasmid, pCGN7800, was transformed into E. coli BL21(DE3). Neutral lipids were
extracted from the recombinant E. coli using the solvents
described in the enzyme assay procedures, separated by TLC, and stained
with iodine. Lipids that co-migrated with the fatty alcohol standards
were eluted from the silica and further analyzed by reverse phase TLC and gas chromatography (GC). The sample was injected onto a Supelcowax 10 column (30 m × 0.32 mm, Supelco, Bellefonte, PA)
mounted on a GC (model 5890, Hewlett-Packard, Palo Alto, CA).
Helium was used a carrier gas with an on-column flow of 5.5 mL/min, and
a split flow of 15 mL/min. The injector temperature was 260°C and the
flame ionization detector was at 270°C. The sample was analyzed using
the following temperature program: 190°C for 15 min, followed by a
temperature increase of 5°C/min to a temperature of 250°C and held
at 250°C for 3 min. Cells of the recombinant E. coli were
harvested by centrifugation, and FAR enzyme assays were performed as
described above after lysing the cells in assay buffer using lysozyme
and CHAPS.
Plant Expression
The primers GGCGCGCCGGTACCTCTAGACCTGGCGATTCAACGTGGTC and
CTGCAGGGATCCGTCGACTTGCTTCTTGTGAATTGAGA were used to amplify
approximately 1 kb of DNA flanking the 5' end of a B. napus
oleosin gene, and the primers CTGCAGTAAATTACGCCATGACTATTTTCA and
GCGCGCCGGTACCTCTAGAGGTTCTGCCATGTCTCAACGTTCA were used to amplify
approximately 700 nucleotides of DNA flanking the 3' end of the gene
(Lee and Huang, 1991 ). The 5' and 3' flanking regions were assembled to
form an oleosin expression cassette in BssHII-digested pBC-
(Stratagene, La Jolla, CA). The primers GTCGACAAAATGGAGGAAATGGGAAGCATT
and GTCGACTTAGTTAAGAACGTGCTCTACGAC were used to PCR amplify the coding
region of the FAR cDNA and to introduce SalI cloning sites
flanking the start and stop codons. The FAR coding region was inserted
into the SalI site of the oleosin expression cassette, and
the resulting plasmid was cloned into an Agrobacterium
tumefaciens binary vector (McBride and Summerfelt, 1990 ) to
yield pCGN7643. Plasmid pCGN7643 was used to tranform B. napus cv Reston as described by Radke et al. (1987) The FAR gene
was resynthesized to reduce the A + T content of the gene, while
retaining the correct protein sequence using the method of Bambot and
Russell (1993) . The resynthesized gene was cloned into the oleosin
expression cassette and binary vector to yield plant transformation
vector pCGN7677.
Oil Analysis
GC analysis to determine the alcohol content of seed oils was
performed on transmethylated oil using the conditions described in the
E. coli expression procedures. The identity of the fatty acid methyl ester and alcohol peaks were verified using GC-mass spectrometry (MS) (analysis performed by Alpha Chemical and Biomedical Laboratories, Santa Rosa, CA). Lipids were extracted from seeds by
grinding in hexane. High-temperature GC analysis to examine the wax and
alcohol content was performed using a triglyceride column (Chrompack,
Raritan, NJ) using the following temperature program: 190°C for 3 min, followed by a temperature increase of 15°C/min to a temperature
of 300°C for 2 min, followed by a temperature increase of 2°C/min
to a temperature of 360°C for 3 min. The column flow rate was 2.1 mL/min helium, the split flow rate was 6 mL/min, the injector
temperature was 360°C, and the flame-ionization detector temperature
was 370°C. The identity of the waxes were verified using GC-MS
(analysis performed by Alpha Chemical and Biomedical Laboratories). The
oil was analyzed by silver-phase HPLC, and the C40:2 wax was purified
using preparative silver-phase HPLC. The identity of the purified C40:2
wax was confirmed by comparing the infrared spectrum and the proton NMR
spectrum to the spectra of an authentic standard (analysis performed by
Alpha Chemical and Biomedical Laboratories). The molecular mass of the
(M + H)+ ion of C40:2 wax isolated from the plant
oil and an authentic standard were determined to be 588.59154 D (the
theoretical mass of a C40:2 wax ester is 588.592357 D) by
high-resolution MS (analysis performed by Mass Search, Modesto, CA).
 |
RESULTS |
Purification of the Jojoba Embryo FAR
A microsomal membrane fraction enriched in FAR activity was
isolated from developing embryos of jojoba and used as the starting material for enzyme purification. Separation of the microsomal membrane
fraction on linear Suc density gradients revealed that the vast
majority of the membranes in that fraction have a density typically
associated with the endoplasmic reticulum (ER) and that FAR activity
co-migrated with that fraction (data not shown). This presumed ER
fraction also possesses high levels of WS and FAE activities required
for wax synthesis in jojoba embryos (Lassner et al., 1996 ; Lardizabal
et al., 2000 ). Although an equivalent amount of activity partitions
with a wax pad that forms upon the initial centrifugation step, we were
unable to solubilize the activity from this fraction.
We used the detergent CHAPS to solubilize the jojoba FAR from
membranes. Although the presence of high levels of CHAPS in assay
solutions resulted in an apparent loss of enzyme activity, this
inhibition could be completely reversed by simple dilution of the
detergent to below its critical micellar concentration (CMC). The
nominal CMC of CHAPS is approximately 0.5% (w/v), but it does vary
with buffer and salt conditions (Chattopadhyay and Harikumar, 1996 ). We
routinely diluted the CHAPS to 0.3% (w/v) in our assays. The jojoba
embryo FAR activity is strictly dependent on NADPH, and NADH is not
utilized by the enzyme (Pollard et al., 1979 ).
Representative chromatographic separations obtained during FAR
purification are shown in Figure 1. The
inclusion of CHAPS at greater than CMC in all column buffers was
essential to prevent aggregation of the enzyme. Conversely, the use of
too high a CHAPS concentration (e.g. 1%) resulted in a rapid loss of
enzyme activity. Chromatography on Blue A agarose provided the majority
of enrichment of FAR activity (Fig. 1A). Only the material eluted by
1.0 M NaCl was utilized for further purification. Size
exclusion chromatography (Fig. 1B) was included to improve resolution
during the subsequent palmitoyl-CoA-agarose chromatography. The FAR
activity elution profile from the size-exclusion column corresponded to
an apparent mass of 49 kD compared with the elution of protein
standards run under the same conditions. Palmitoyl-CoA is not a
substrate for the jojoba FAR, however, it does act as an inhibitor of
the reduction of longer chain length acyl-CoA (data not shown). The
solubilized enzyme binds to a palmitoyl-CoA-agarose matrix and can be
affinity eluted by NADPH (Fig. 1C). Consistent with the reductant
specificity of the enzyme, NADH was ineffective at releasing activity
from this matrix. The enrichment of FAR specific activity obtained during purifications varied, but was typically 150- to 250-fold relative to a cell-free, homogenized embryo preparation.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 1.
Chromatographic enrichment of jojoba FAR activity.
A, Blue A agarose chromatography. Solubilized jojoba microsomal
membranes were applied to a Blue A agarose column in a buffer
containing 0.4 M NaCl. FAR activity was eluted using a
buffer containing 1.0 M NaCl. FAR activity is shown as
picomoles of alcohol formed per minute per fraction. Relative protein
concentrations of the various fractions are shown as the
A280 value of the UV monitor. The horizontal
bar indicates fractions pooled for subsequent chromatography. Arrows
indicate when buffer solutions containing other than 0.4 M
NaCl were applied to the column. B, Sephacryl S-100 chromatography.
Pooled fractions from the Blue A agarose column were concentrated and
applied to the column. Activity, relative protein, and fractions pooled
for the next chromatographic step are indicated as in A. C,
Palmitoyl-CoA agarose chromatography. Pooled fraction from the size
exclusion column step were applied to a palmitoyl-CoA-agarose column.
After washing with equilibration buffer and then buffer containing
NADH, FAR activity was eluted with buffer containing NADPH. The effect
of subsequent washing with a buffer containing 0.5 M NaCl
is also shown. Arrows indicate when various solutions were applied to
the column.
|
|
Figure 2 shows the polypeptide profiles
of samples taken from various stages of a representative purification
experiment. SDS-PAGE analysis revealed that two heavily stained
polypeptides (relative molecular masses of 56 and 54 kD) were present
in the NADPH eluted fractions from the palmitoyl-CoA-agarose column
(Fig. 2, lane 6). Other minor bands visible in this gel were not always detected in other preparations and, when present, did not consistently track with FAR activity during chromatographic separations. Several peptides generated using either trypsin or cyanogen bromide were isolated from the two electrophoretically separated proteins and their
N-terminal sequences determined. Most of the sequences obtained from
peptides of the 54-kD protein were also found in peptides isolated from
the 56-kD polypeptide. Additionally, immunoblot analysis of a jojoba
embryo cell-free extract showed that only the 56-kD polypeptide was
present (data not shown). The smaller polypeptide appeared to be an
artifact of protein purification.

View larger version (76K):
[in this window]
[in a new window]
|
Figure 2.
SDS-PAGE showing purification of jojoba FAR.
Proteins were resolved on a 10% to 15% polyacrylamide gradient gel
and stained with silver (Blum et al., 1987 ). The samples loaded onto
the gel were taken from a representative purification sequence. Lane 1, Cell-free homogenate; lane 2, microsomal membranes; lane 3, detergent-solubilized 200,000g supernatant fraction;
lane 4, Blue A agarose column (1.0 M NaCl elution); lane 5, size-exclusion column, pooled retained fractions; lane 6, palmitoyl-CoA
agarose column (NADPH elution); and lane 7, molecular mass standards.
|
|
Cloning of the Jojoba FAR cDNA
During optimization of the FAR purification procedures, samples
containing the 54- and 56-kD proteins and several others were separated
by SDS-PAGE and transferred to a polyvinylidene difluoride membrane for
N-terminal amino acid sequencing. No sequence data were obtained from
either the 54- or 56-kD proteins, indicating they had been blocked
either in vivo or during purification. A relatively minor 32-kD protein
was also analyzed. The sequence GATEKSIKSTMKDMGIERA was obtained from
this band and was used to design a degenerate oligonucleotide for use
in cloning. A combination of PCR amplification and cDNA library
screening was used to isolate a 1.7-kb cDNA clone. The deduced mass of
the protein encoded by this cDNA clone was 56.2 kD. The sequence
encoding the peptide used for cloning was near the center of the cDNA.
Subsequently, all of the peptide sequences obtained from the 56- and
54-kD proteins were found to be present in the deduced amino acid
sequence of this cDNA. The 32-kD protein apparently was generated by
proteolysis of either the 56- or 54-kD protein. The 32-kD protein was
not observed in samples containing FAR activity after optimization of
the purification protocol.
Figure 3 shows the deduced amino acid
sequence encoded by the 1.7-kb cDNA. The deduced protein has a pI of
8.76 and hydropathy analysis using the TopPredII program (Claros and
von Heijne, 1994 ) suggests that there are one or two transmembrane
domains. The sequence lacks the motif GXGXXG/A found in many
nucleotide-binding enzymes (Wierenga et al., 1985 ); however, it does
contain the similar motif (IVF) X(ILV) TGXTGFL(GA) suggested by Aarts
et al. (1998). A query of the public data banks with the jojoba FAR
sequence using the BLAST search program (Altschul et al., 1990 )
revealed significant homology with a family of Arabidopsis and B. napus proteins related to ms2 (GenBank accession
nos. 1491638, 1171027, 1491615, 3549681, and AB007651) (Aarts et al.,
1993 , 1997 ). Arabidopsis ms2 is a tapetum-specific protein of unknown
enzymatic activity that is essential for pollen formation (Aarts et
al., 1997 ). The other family members have unknown expression patterns, and are proteins of unknown function. There are also
Caenorhabditis elegans and Drosophila
melanogaster proteins of unknown function with significant
(E value <1e-05) homology to the jojoba FAR (GenBank accession nos.
3786433 and 2827491). Querying the dBEST database with the jojoba FAR
shows that related expressed sequence tags are found in cotton, rice,
and corn.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 3.
Amino acid sequence of the jojoba FAR. The
predicted amino acid sequence of the jojoba FAR protein was translated
from the cDNA. Tryptic peptide sequences derived from both the 54- and
56-kD proteins are double-underlined. Tryptic peptide sequences derived
only from the 56-kD protein are single-underlined. A sequence derived
from a cyanogen bromide peptide is shown as an overline. The N-terminal
sequence of a 32-kD protein used to design a primer to isolate the cDNA
clone is underlined with a dashed line. Two potential transmembrane
helixes are shaded.
|
|
Expression of Functional FAR in E. coli
The 1.7-kb cDNA was expressed in E. coli using a T7
RNA-polymerase-based system. Enzyme assays showed the presence of FAR activity in the transformed cells that was not present in the control
cells (data not shown). Figure 4 shows
TLC separation of lipids extracted from those cells. The cells
transformed with the FAR construct contained fatty alcohols, while the
control E. coli cells did not. Further analysis (GC and
reversed-phase TLC) of material eluted from this region of the TLC
plate revealed that these were primarily C16:0 and C18:1 (cis-vaccenic)
alcohols (data not shown). Assays of jojoba embryo extracts indicated
that the FAR is capable of reducing C16:0-ACP, suggesting that the alcohol accumulating in these E. coli cells may be derived
from acyl-ACP. No waxes were detected in the E. coli cells
expressing FAR using either radiochemical assays or lipid analyses.

View larger version (54K):
[in this window]
[in a new window]
|
Figure 4.
TLC analysis of E. coli lipids.
Lipids were extracted from E. coli, analyzed using
normal phase TLC, and visualized by staining with iodine. The standards
lane contains a wax ester (jojoba oil), a free fatty acid (oleic acid),
and a fatty alcohol (oleyl alcohol). The lane labeled pET3A contains
lipids from E. coli transformed with the empty
expression vector pET3A. The lane labeled pCGN7800 contains lipids from
E. coli transformed with the pET3A containing the jojoba
FAR.
|
|
Seed Oils of Transgenic Plants Expressing the Jojoba FAR Contain
Wax Esters
The jojoba FAR cDNA was placed under the control of oleosin
regulatory sequences (Lee and Huang, 1991 ). Oleosin is an oil body
protein that is highly expressed in developing B. napus embryos. The oleosin promoter-FAR gene fusion was
transferred to a binary A. tumefaciens vector and used to
generate transgenic high erucic acid rapeseed (HEAR) plants. HEAR
(B. napus cv Reston) was chosen as the host due to the
presence of C20:1 and C22:1 fatty acids in its seed lipids. Developing
HEAR embryos have an active FAE system that produces the long-chain
acyl-CoA substrates preferred by the jojoba FAR. The seed lipids from
19 transgenic HEAR plants were transmethylated and analyzed by GC.
Eleven of the samples from these transgenic plants were found to
contain up to 0.16 weight % of their lipids as fatty alcohols (Fig.
5A), whereas the control samples were
completely devoid of such alcohols. When single seeds from the best
event were analyzed, up to 0.56 weight % of the lipids were determined
to be fatty alcohols. As anticipated, C22:1 was the predominant alcohol
species detected. Its identity was confirmed using GC-MS.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 5.
Fatty alcohols and wax esters in transgenic
HEAR seed oils. A, Alcohol content of the pooled seeds from
plants transformed with the native and resynthesized FAR genes. Pooled
seeds from transgenic plants containing either the native jojoba FAR or
the synthetic gene designed to reduce AT content were analyzed by
transmethylation of the seed oil and GC. The frequency of independent
transgenic plants whose seed alcohol content fell in the various ranges
was plotted against the amount of fatty alcohol present in the seed
oil. Gene resynthesis increased both the frequency of transgenic plants
with detectable fatty alcohol in their oil and the quantity of fatty
alcohol found in the seed oil. B, Wax versus alcohol content of
individual seeds. The wax ester and fatty alcohol content of single
seeds from transgenic plants containing the synthetic FAR were
determined as described in "Materials and Methods." The upper line
represents complete esterification of the fatty alcohol into wax
esters, and the lower line represents 50% esterification of the fatty
alcohols into wax esters. As the fatty alcohol content of the seed
increases, the endogenous wax synthase fails to esterify all of the
fatty alcohol into wax esters.
|
|
Although GC analysis of transmethylated oil demonstrated the presence
of fatty alcohols in transgenic plants, it did not indicate if the
alcohols were present in a free or a combined state. High-temperature GC and GC-MS of underivatized oil from HEAR transformants containing the native FAR cDNA sequence failed to detect any free alcohols, but,
rather, suggested the presence of a series of wax esters with chain
lengths of 38, 40, 42, and 44 carbons and two, three, and four double
bonds (data not shown, but see later sections and Lardizabal et al.,
2000 ). These compounds were not detected in oil from control plants.
The most abundant putative wax ester, C40:2, was purified by TLC and
silver-phase HPLC and subjected to infrared spectrometry, proton NMR,
methanolysis and GC analysis, and high-resolution MS. The data
demonstrated that this compound was indeed a wax ester comprised of a
C22:1 alcohol and a C18:1 fatty acid. Thus, HEAR embryos contain an
endogenous activity capable of esterifying at least a portion of the
fatty alcohol product of the introduced FAR.
Resynthesis of the FAR cDNA Increases Expression in Transgenic
Plants
Although alcohols were produced in transgenic HEAR embryos, the
amount that accumulated was very low. Immunoblots and enzymatic assays
of extracts from developing embryos indicated that very little FAR was
being produced. RNA blots probed with a FAR-specific probe revealed a
smear of hybridizing material of small size with little full-length
message (data not shown). Subsequent probing of the RNA filter with a
napin probe (Kridl et al., 1991 ) suggested that the napin RNA was
intact. Examination of the FAR cDNA showed that portions of the coding
region contained approximately 75% A + T content (Fig.
6). Transgenes with high A + T content
have been associated with aberrant transcript processing and RNA
instability (De Rocher et al., 1998 ; Diehn et al., 1998 ). Therefore,
the cDNA sequence was altered to lower its A + T content without
changing the amino acid composition of the encoded protein. The
resynthesized coding region was placed under control of oleosin
regulatory sequences, and transgenic HEAR plants were generated.
Analysis of transmethylated seed lipids from pools of seeds from these
plants showed that the gene resynthesis resulted in an increase in the
proportion of plants with detectable levels of fatty alcohol in their
seed oils, and an increase in the quantity of fatty alcohols relative to plants with the native cDNA (Fig. 5A). Oils from pooled seeds of
several primary transformants contained as much as 0.9% fatty alcohol
by weight. When single seeds from the individual with the highest
alcohol content were analyzed, the alcohol content ranged up to 4.4 weight % of seed lipids (Fig. 5B).

View larger version (45K):
[in this window]
[in a new window]
|
Figure 6.
A + T content of the native jojoba FAR open
reading frame (ORF) and a synthetic ORF. The A + T content of 25 nucleotide windows of the jojoba FAR ORFs were plotted against their
position in the ORFs. A, The A + T content of the native jojoba FAR
ORF. Several regions of the ORF have A + T contents exceeding 75%. B,
The A + T content of a synthetic FAR ORF designed to reduce the A + T content without changing the protein encoded by the native FAR
ORF.
|
|
Analysis of Underivatized Seed Oil of Transgenic HEAR
Expressing the Resynthesized FAR Gene
The presence of wax esters in seeds from plants containing the
resynthesized FAR cDNA was demonstrated by high-temperature GC of the
underivatized oil. Unlike the oils from the plants containing the FAR
gene prior to resynthesis, free fatty alcohols were detected in the
oil. The wax and alcohol contents of oil from a number of seeds were
determined. The wax was quantified by using high-temperature GC and
comparing the area of the wax peaks against that of an internal wax
standard (C35:1 wax composed of C18:1 alcohol and C17:0 fatty acid).
The total fatty acid and fatty alcohol content of the same oil was
quantified by GC analysis of the transmethylated oil. Figure 5B shows
that in seed oils with less than 1% alcohol, most of the
alcohol is esterified into wax esters. In seed oils with greater than
1% alcohol, the ratio of wax to alcohol is variable. In some of the
oils, nearly all of the alcohol is converted to wax, and in some, less
than half of the alcohol is converted to wax esters.
HEAR Embryos Possess WS Activity
Enzyme assays of extracts from developing HEAR embryos revealed
the presence of a low level of endogenous WS activity. Specifically, when the extracts were incubated with oleyl alcohol and
[1-14C]16:0-CoA, a radiolabeled product was
formed that co-migrated with a wax standard upon TLC analysis. This
activity is minor compared with the WS activity detected in jojoba.
Cell-free extracts of developing jojoba embryos have WS activities that
range from 500 to 900 pmol min 1
mg 1 protein. The activity detected in
HEAR embryos was measured to be about 15 to 25 pmol
min 1 mg 1 protein. We
have not attempted to further characterize the HEAR activity in
terms of its substrate preferences or cellular location.
 |
DISCUSSION |
We have purified from jojoba embryos a membrane-associated,
alcohol-forming FAR involved in wax formation and cloned its cDNA. Analyses of E. coli expressing the FAR cDNA demonstrate that
the product of the FAR is free alcohol, and that the enzyme itself has
no capacity to form wax esters from those alcohols.
The jojoba FAR cDNA is predicted to encode a protein with a molecular
mass of 56.2 kD. This is in good agreement with the apparent molecular
mass estimated from SDS-PAGE of the purified protein. Thus, FAR from
jojoba, pea (Vioque and Kolattukudy, 1997 ), and duck (Wang and
Kolattukudy, 1995b ) all have very similar molecular masses. It will be
interesting to compare the sequence of the jojoba FAR with those of the
other FAR proteins once they become available. Although two bands of 56 and 54 kD were present in the purified jojoba FAR preparation,
immunoblot analysis suggests that the 54-kD band was an artifact
(data not shown). Additionally, no evidence of a second class of
FAR transcript was found during the cloning process. The isolation of a
cyanogen-bromide-generated peptide whose amino acid sequence begins
near the amino terminus of the deduced protein sequence (Fig. 3)
suggests that the FAR does not have a cleaved signal peptide. As has
been noted for several proteins associated with lipid metabolism, the
jojoba FAR has a basic pI, a characteristic suggested to be important in interactions with the acidic phospholipid membrane (Coleman, 1990 ). The 49-kD size estimate obtained by size exclusion
chromatography of the solubilized enzyme suggests that FAR is a
monomeric enzyme.
The jojoba FAR sequence shows extensive homology to the Arabidopsis
tapetum-specific protein ms2. Several recent publications demonstrate
the presence of neutral lipids in two novel organelles, elaioplasts and
tapetosomes, found in tapetal cells (Ting et al., 1998 ;
Hernandez-Pinzon et al., 1999 ). Elaioplasts are plastids that contain
TAG and sterol esters. The elaioplast sterol esters are deposited on
the surface of mature pollen grains. Tapetosomes are lipid
bodies that contain oleosin-like proteins and neutral lipids including
TAG and wax esters. TAG is the most abundant tapetosome lipid. An
attractive hypothesis is that the ms2 protein forms fatty alcohols that
are constituents of the tapetosome wax esters. The tapetosome lipids
are not deposited in mature pollen, but are broken down as the tapetum
degrades. The oxidation of the tapetosome neutral lipids could provide
an energy source for developing pollen, much as neutral lipids can
serve as an energy reserve in germinating seeds. Because TAG is more
abundant than wax esters in the tapetosome, it remains cryptic why an
alcohol-forming reductase would be necessary for pollen development if
the waxes are simply energy sources. It is possible that wax esters or
fatty alcohols are essential precursors for the formation of pollen constituents.
The evolutionary origin of wax synthesis in jojoba seeds has been
obscure. The discovery of at least four related genes in Arabidopsis
and expressed sequence tags from other plant species suggests that
FAR-like genes are ubiquitous in plants. In addition to their role in
pollen formation, these FAR-like enzymes may be responsible for the
formation of the alcohol component of the wax esters found in the
cuticular lipids of Arabidopsis and other species. We do not know if
any of the FAR-related proteins from other plant species are seed
expressed, or if jojoba recruited a FAR expressed in tapetal,
epidermal, or other tissues for the formation of the alcohol component
of its seed wax esters. The identification of related proteins in
animals as diverse as C. elegans and D. melanogaster suggests that these proteins may be ubiquitous in
animals, and might form fatty alcohols that animals use for the
formation of wax esters, ether lipids, or other compounds.
We know of no examples in which free long-chain alcohols accumulate to
high levels within living cells, and it is likely that high levels of
fatty alcohols are detrimental to cell viability. Thus, the capacity to
esterify or otherwise modify any alcohols produced seems essential. It
is intriguing that HEAR, a plant that does not produce waxes in its
seed oil, possesses an endogenous wax synthesis capability. It is
tempting to speculate that an acyl-transferase enzyme, perhaps involved
in triglyceride or phospholipid synthesis, is also capable of
catalyzing wax formation. For example, diacylglycerol acyltransferase,
the only microsomal enzyme unique to triglyceride (versus phospholipid)
synthesis, combines diacylglycerol (an alcohol) with fatty acyl-CoA.
However, the data do not exclude the possibility that an enzyme with a
dedicated wax synthesis activity, such as those assumed to be
associated with the formation of cuticular lipids, may be present in
these HEAR cells. Regardless of the origin, the presence of WS
activity in HEAR seeds suggests a pathway for the evolution from
TAG to waxes as seed storage lipids. After recruiting a reductase for
the formation of fatty alcohols in developing embryos of jojoba,
natural selection would favor the evolution of greater wax synthase
activity in the embryos to reduce the free alcohol composition of the
seeds. Other adaptation steps could include the ability to oxidize the
wax esters to release their energy for seed germination (Moreau and
Huang, 1977 ) and the loss of TAG synthesis, possibly via a reduction of
diacylglycerol acyltransferase activity.
We have shown that the introduction of a single foreign cDNA into HEAR
can result in a redirection of the storage oil synthesis pathways from
TAG to wax. Although the fatty alcohol product of the introduced FAR
can be esterified to form waxes, this conversion is often incomplete.
In an accompanying paper (Lardizabal et al., 2000 ), we show the effects
of combining a WS and a fatty acid elongation enzyme with FAR to
increase both the alcohol formation and wax ester content of transgenic
plant oils.
 |
ACKNOWLEDGMENTS |
We thank Calvin Fan, Polly Goldman, and Janice Bleibaum for
expert technical support; Chingying Li, Joann Turner, and Brenda Reed
for HEAR transformation and plant care; and Akira Sato and Tetsuo Sakamoto of the Nippon Steel Corporation, Tokyo, for valuable advice and discussions.
 |
FOOTNOTES |
Received August 18, 1999; accepted November 5, 1999.
1
Present address: Department of Botany and Plant
Pathology, Michigan State University, East Lansing, MI 48824-1312.
2
Present address: Maxygen Inc., 515 Galveston
Drive, Redwood City, CA 94063.
*
Corresponding author; e-mail jim.metz{at}monsanto.com; fax
530-792-2453.
 |
LITERATURE CITED |
-
Aarts MGM, Dirkse WG, Stiekema WJ, Pereira P
(1993)
Transposon tagging of a male sterility gene in Arabidopsis.
Nature
363: 715-717
[CrossRef][Medline]
-
Aarts MGM, Hodge R, Kalantidis K, Florack D, Wilson ZA, Mulligan BJ, Stiekema WJ
(1997)
The Arabidopsis MALE STERILITY 2 protein shares similarity with reductases in elongation/condensation complexes.
Plant J
12: 615-623
[CrossRef][ISI][Medline]
-
Alexander DC
(1987)
An efficient vector-primer cDNA cloning system.
Methods Enzymol
154: 41-64
[ISI][Medline]
-
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ
(1990)
Basic local alignment search tool.
J Mol Biol
215: 403-410
[CrossRef][ISI][Medline]
-
Bambot SB, Russell AJ
(1993)
Efficient total gene synthesis of 1.35-kb hybrid alpha-lytic protease gene using the polymerase chain reaction.
PCR Methods Applic
2: 266-271
[Medline]
-
Bishop JE, Hajra AK
(1981)
Mechanism and specificity of formation of long-chain alcohols by developing rat brain.
J Biol Chem
256: 9542-9550
[Abstract/Free Full Text]
-
Blum H, Beier H, Gross HS
(1987)
Improved silver staining of plant proteins, RNA, and DNA in polyacrylamide gels.
Electrophoresis
8: 93-99
[CrossRef][ISI]
-
Bradford MM
(1976)
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
71: 248-254
[CrossRef]
-
Chattopadhyay A, Harikumar KG
(1996)
Dependence of critical micelle concentration of a zwitterionic detergent on ionic strength: implications in receptor solubilization.
FEBS Lett
391: 199-202
[Medline]
-
Claros MG, von Heijne G
(1994)
TopPred II: an improved software for membrane protein structure predictions.
Comput Appl Biosci
10: 685-686
[Free Full Text]
-
Coleman J
(1990)
Characterization of the Escherichia coli gene for 1-acyl-sn-glycerol-3-phosphate acyltransferase (plsC).
Mol Gen Genet
232: 295-303
-
De Rocher EJ, Vargo-Gogola TC, Diehn SH, Green PJ
(1998)
Direct evidence for rapid degradation of Bacillus thuringiensis toxin mRNA as a cause of poor expression in plants.
Plant Physiol
117: 1445-1461
[Abstract/Free Full Text]
-
Diehn SH, Chiu W, De Rocher EJ, Green PJ
(1998)
Premature polyadenylation at multiple sites within a Bacillus thuringiensis toxin gene-coding region.
Plant Physiol
117: 1433-1443
[Abstract/Free Full Text]
-
Frohman MA, Dush MK, Martin GR
(1988)
Rapid production of full length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer.
Proc Natl Acad Sci USA
85: 8998-9002
[Abstract/Free Full Text]
-
Hara A, Radin NS
(1978)
Lipid extraction of tissues with a low-toxicity solvent.
Anal Biochem
90: 420-426
[CrossRef][ISI][Medline]
-
Hernandez-Pinzon I, Ross JHE, Barnes KA, Damant AP, Murphy DJ
(1999)
Composition and role tapetal lipid bodies in the biogenesis of the pollen coat of Brassica napus.
Planta
208: 588-598
[CrossRef][ISI][Medline]
-
Kahn AA, Kolattukudy PE
(1973)
Control of synthesis and distribution of acyl moieties in etiolated Euglena gracilis.
Biochem
12: 1939-1948
[Medline]
-
Knutzon DS, Lardizabal KD, Nelsen JS, Bleibaum JL, Davies M, Metz JG
(1995)
Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.
Plant Physiol
109: 999-1006
[Abstract]
-
Kolattukudy PE
(1970)
Reduction of fatty acids to alcohols by cell-free preparations of Euglena gracilis.
Biochemistry
9: 1095-1102
[CrossRef][Medline]
-
Kolattukudy PE, Rogers L
(1978)
Biosynthesis of fatty alcohols, alkane-1,2-diols and wax esters in particulate preparations from the uropygial glands of white-crowned sparrows (Zonotrichia Leucophyrus).
Arch Biochem Biophys
191: 244-258
[Medline]
-
Kolattukudy PE, Rogers L
(1986)
Acyl-CoA reductase and acyl-CoA: fatty acyl transferase in the microsomal preparation from the bovine meibomian gland.
J Lipid Res
27: 404-411
[Abstract]
-
Kridl JC, McCarter DW, Rose RE, Scherer DE, Knutzon DS, Radke SE, Knauf VC
(1991)
Isolation and characterization of an expressed napin gene from Brassica rapa.
Seed Sci Res
1: 209-219
-
Kunkel TA, Roberts JD, Zakour RA
(1987)
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Methods Enzymol
154: 367-382
[ISI][Medline]
-
Lardizabal KD, Metz JG, Sakamoto T, Hutton WC, Pollard MR, Lassner MW
(2000)
Purification of a jojoba embryo wax synthase, cloning of its cDNA, and production of high levels of wax in seeds of transgenic Arabidopsis.
Plant Physiol
122: 645-655
[Abstract/Free Full Text]
-
Lassner MW, Lardizabal K, Metz JG
(1996)
A jojoba
-ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.
Plant Cell
8: 281-292
[Abstract] -
Lee K, Huang AHC
(1991)
Genomic nucleotide sequence of a Brassica napus 20-kilodalton oleosin gene.
Plant Physiol
96: 1395-1397
[Free Full Text]
-
McBride KE, Summerfelt KR
(1990)
Improved binary vectors for Agrobacterium-mediated plant transformation.
Plant Mol Biol
14: 269-276
[CrossRef][ISI][Medline]
-
Miwa TK
(1971)
Jojoba oil wax esters and derived fatty acids and alcohols: Gas chromatographic analyses.
J Am Oil Chem Soc
48: 259-264
-
Moreau RA, Huang AC
(1977)
Gluconeogenesis from storage wax in the cotyledons of jojoba seedlings.
Plant Physiol
60: 329-333
[Abstract/Free Full Text]
-
Ohlrogge JB, Pollard MR, Stumpf PK
(1978)
Studies on biosynthesis of waxes by developing jojoba seed tissues.
Lipids
13: 203-210
[CrossRef]
-
Pollard MR, McKeon T, Gupta LM, Stumpf PK
(1979)
Studies on biosynthesis of waxes by developing jojoba seed. II. The demonstration of wax biosynthesis by cell-free homogenates.
Lipids
14: 651-662
-
Radke SE, Andrews BM, Moloney MM, Crouch ML, Kridl JC, Knauf VK
(1987)
Transformation of Brassica napus L. using Agrobacterium tumefaciens: developmentally regulated expression of a reintroduced napin gene.
Theor Appl Genet
75: 685-694
-
Reiser S, Somerville C
(1997)
Isolation of mutants of Acinetobacter calcoaceticus deficient in wax ester synthesis and complementation of one mutation with a gene encoding a fatty acyl coenzyme A reductase.
J Bacteriol
179: 2969-2975
[Abstract/Free Full Text]
-
Rosenberg AH, Lade BN, Chui D, Lin S, Dunn JJ, Studier FW
(1987)
Vectors for selective expression of cloned DNA's by T7 RNA polymerase.
Gene
56: 125-135
[CrossRef][ISI][Medline]
-
Ting JTL, Wu SSH, Ratnayake C, Huang AHC
(1998)
Constituents of the tepetosomes and eleaioplasts in Brassica campestris tapetum and their degradation and retention during microsporogenesis.
Plant J
16: 541-551
[CrossRef][ISI][Medline]
-
Vioque J, Kolattukudy PE
(1997)
Resolution and purification of an aldehyde-generating and an alcohol-generating fatty acyl-CoA reductase from pea leaves (Pisum sativum L.).
Arch Biochem Biophys
340: 64-72
[CrossRef][ISI][Medline]
-
Wang X, Kolattukudy PE
(1995a)
Solubilization and purification of aldehyde-generating fatty acyl-CoA reductase from green alga Botryococcus braunii.
FEBS Lett
370: 15-18
[Medline]
-
Wang X, Kolattukudy PE
(1995b)
Solubilization, purification and characterization of fatty acyl-CoA reductase from duck uropygial gland.
Biochem Biophys Res Commun
208: 210-215
[Medline]
-
Wierenga RK, De Maeyer MCH, Hol WG
(1985)
Interaction of pyrophosphate moieties with
-helices in dinucleotide binding proteins.
Biochemistry
24: 1346-1357
[CrossRef] -
Wu X-Y, Moreau RA, Stumpf PK
(1981)
Studies of biosynthesis of waxes by developing jojoba seed. III. Biosynthesis of wax esters from acyl-CoA and long-chain alcohols.
Lipids
6: 897-902
© 2000 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
O. Rowland, H. Zheng, S. R. Hepworth, P. Lam, R. Jetter, and L. Kunst
CER4 Encodes an Alcohol-Forming Fatty Acyl-Coenzyme A Reductase Involved in Cuticular Wax Production in Arabidopsis
Plant Physiology,
November 1, 2006;
142(3):
866 - 877.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Kalscheuer, T. Stoveken, H. Luftmann, U. Malkus, R. Reichelt, and A. Steinbuchel
Neutral Lipid Biosynthesis in Engineered Escherichia coli: Jojoba Oil-Like Wax Esters and Fatty Acid Butyl Esters
Appl. Envir. Microbiol.,
February 1, 2006;
72(2):
1373 - 1379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Cheng and D. W. Russell
Mammalian Wax Biosynthesis: I. IDENTIFICATION OF TWO FATTY ACYL-COENZYME A REDUCTASES WITH DIFFERENT SUBSTRATE SPECIFICITIES AND TISSUE DISTRIBUTIONS
J. Biol. Chem.,
September 3, 2004;
279(36):
37789 - 37797.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. N. Arbeitman, A. A. Fleming, M. L. Siegal, B. H. Null, and B. S. Baker
A genomic analysis of Drosophila somatic sexual differentiation and its regulation
Development,
May 1, 2004;
131(9):
2007 - 2021.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.'i. Moto, T. Yoshiga, M. Yamamoto, S. Takahashi, K. Okano, T. Ando, T. Nakata, and S. Matsumoto
Pheromone gland-specific fatty-acyl reductase of the silkmoth, Bombyx mori
PNAS,
August 5, 2003;
100(16):
9156 - 9161.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. D. Lardizabal, J. T. Mai, N. W. Wagner, A. Wyrick, T. Voelker, and D. J. Hawkins
DGAT2 Is a New Diacylglycerol Acyltransferase Gene Family. PURIFICATION, CLONING, AND EXPRESSION IN INSECT CELLS OF TWO POLYPEPTIDES FROM MORTIERELLA RAMANNIANA WITH DIACYLGLYCEROL ACYLTRANSFERASE ACTIVITY
J. Biol. Chem.,
October 12, 2001;
276(42):
38862 - 38869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. D. Lardizabal, J. G. Metz, T. Sakamoto, W. C. Hutton, M. R. Pollard, and M. W. Lassner
Purification of a Jojoba Embryo Wax Synthase, Cloning of its cDNA, and Production of High Levels of Wax in Seeds of Transgenic Arabidopsis
Plant Physiology,
March 1, 2000;
122(3):
645 - 656.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|