Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (63)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, Y.
Right arrow Articles by Kieber, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, Y.
Right arrow Articles by Kieber, J. J.
Agricola
Right arrow Articles by Huang, Y.
Right arrow Articles by Kieber, J. J.

Plant Physiol, April 2000, Vol. 122, pp. 1301-1310

ATMPK4, an Arabidopsis Homolog of Mitogen-Activated Protein Kinase, Is Activated in Vitro by AtMEK1 through Threonine Phosphorylation1

Yafan Huang,2 Hui Li, Rajeev Gupta, Peter C. Morris, Sheng Luan, and Joseph J. Kieber3 *

Department of Biological Sciences, Laboratory for Molecular Biology, University of Illinois at Chicago, Chicago, Illinois 60607 (Y.H., H.L., J.J.K.); Department of Plant and Microbial Biology, University of California, Berkeley, California 94720 (R.G., S.L.); and Department of Biological Sciences, Heriot-Watt University, Riccarton, Edinburgh, EH14 4AS, United Kingdom (P.C.M.)


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
LITERATURE CITED

The modulation of mitogen-activated protein kinase (MAPK) activity regulates many intracellular signaling processes. In animal and yeast cells, MAP kinases are activated via phosphorylation by the dual-specificity kinase MEK (MAP kinase kinase). Several plant homologs of MEK and MAPK have been identified, but the biochemical events underlying the activation of plant MAPKs remain unknown. We describe the in vitro activation of an Arabidopsis homolog of MAP kinase, ATMPK4. ATMPK4 was phosphorylated in vitro by an Arabidopsis MEK homolog, AtMEK1. This phosphorylation occurred principally on threonine (Thr) residues and resulted in elevated ATMPK4 kinase activity. A second Arabidopsis MEK isoform, ATMAP2Kalpha , failed to phosphorylate ATMPK4 in vitro. Tyr dephosphorylation by the Arabidopsis Tyr-specific phosphatase AtPTP1 resulted in an almost complete loss of ATMPK4 activity. Immunoprecipitates of Arabidopsis extracts with anti-ATMPK4 antibodies displayed myelin basic protein kinase activity that was sensitive to treatment with AtPTP1. These results demonstrate that a plant MEK can phosphorylate and activate MAPK, and that Tyr phosphorylation is critical for the catalytic activity of MAPK in plants. Surprisingly, in contrast to the animal enzymes, AtMEK1 may not be a dual-specificity kinase but, rather, the required Tyr phosphorylation on ATMPK4 may result from autophosphorylation.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
LITERATURE CITED

The mitogen-activated protein kinase (MAPK) signal transduction cascade is utilized by eukaryotic cells to transduce a wide variety of extracellular signals such as growth factors, hormones, and stress stimuli (Seger and Krebs, 1995; Robinson and Cobb, 1997; Lewis et al., 1998). This cascade typically consists of three functionally interlinked protein kinases: Raf/MEKK (MAP kinase kinase kinase), MEK (MAP kinase kinase), and MAPK. In this phosphorylation module, either a Raf or a MEKK phosphorylates and activates a particular MEK, which in turn phosphorylates and activates a MAPK, which is also referred to as ERK in mammalian systems. Activated MAPK is often imported into the nucleus, where it phosphorylates specific transcription factors (Chen et al., 1992; Lenormand et al., 1993; Khokhlatchev et al., 1998).

The regulation of yeast and animal MAPK has been well characterized. In these systems, activation of MAPK requires dual phosphorylation of Thr and Tyr residues in the invariant TXY motif by the upstream dual-specificity protein kinase MEK (Payne et al., 1991). The stoichiometry of MAPK phosphorylation on Thr and Tyr residues by MEK is 1:1, and phosphorylation on both residues is required for full enzymatic activity (Anderson et al., 1990; Payne et al., 1991). The phosphorylation of Tyr generally precedes that of Thr (Haystead et al., 1992), and MAPK is thought to dissociate from MEK following the first phosphorylation (Ferrell and Bhatt, 1997). This Tyr is also the major site of MAPK autophosphorylation, but autophosphorylation is not sufficient to activate the kinase fully.

The process of inactivating MAPKs is also important in regulating cell growth and development. MAPKs are dephosphorylated and inactivated by several routes that involve distinct types of protein phosphatases (Cobb and Goldsmith, 1995; Keyse, 1998). Because MAPKs are phosphorylated on both Thr and Tyr by MEKs, they may be regulated by Tyr-specific, Ser/Thr-specific, and/or dual-specificity protein phosphatases. The activation of plant MAPKs has been correlated with Tyr phosphorylation (Seo et al., 1995; Usami et al., 1995; Knetsch et al., 1996; Ádám et al., 1997; Zhang and Klessig, 1997), and a cDNA encoding a Tyr-specific protein phosphatase, AtPTP1, has been cloned from Arabidopsis (Xu et al., 1998).

Elevated MAPK activities, assayed using myelin basic protein as a substrate, are observed when plant cells are stimulated by wounding (Usami et al., 1995; Börge et al., 1997; Zhang and Klessig, 1998; Seo et al., 1999), pathogen elicitors (Suzuki and Shinshi, 1995; Ligterink et al., 1997; Stratmann and Ryan, 1997; Zhang and Klessig, 1997; Zhang et al., 1998; Romeis et al., 1999), or extracellular stresses (Jonak et al., 1996; Mizoguchi et al., 1996). MAPKs are also postulated to act in the signaling pathways for the hormones auxin, abscisic acid (ABA), and ethylene (Mizoguchi et al., 1994; Knetsch et al., 1996; Kieber, 1997; Kovtun et al., 1998).

Several plant homologs of MEKs and MAPKs have been identified based on sequence similarity to the yeast and animal enzymes (Hirt, 1997; Mizoguchi et al., 1997). A plant MEK homolog was first identified in tobacco (Shibata et al., 1995), and in Arabidopsis, five MEK homologs have been identified: AtMEK1, ATMKK2, ATMKK3, ATMKK4, and MBP-ATMAP2Kalpha (Jouannic et al., 1996; Mizoguchi et al., 1997; Morris et al., 1997; Ichimura et al., 1998a). Phylogenetic analysis indicates that these five MEK homologs belong to three subgroups. A family of MAPKs, consisting of nine members (ATMPK1-9), which can be categorized into four subgroups, has been isolated from Arabidopsis (Mizoguchi et al., 1993, 1997). The interaction of the Arabidopsis MEKs and MAPKs has been examined (Ichimura et al., 1998b; Mizoguchi et al., 1998). AtMEK1 and ATMPK4, which are the subject of this report, were found to specifically interact using both two-hybrid analysis and functional complementation in yeast. It has been suggested that this pair along with ATMEKK1 form a functional kinase cascade (Ichimura et al., 1998b; Mizoguchi et al., 1998).

To understand how plant MAPKs are regulated, we set out to examine the biochemical interactions of the proteins encoded by AtMEK1, ATMPK4, and AtPTP1. We describe the activation of ATMPK4 by AtMEK1 and its inactivation by AtPTP1. ATMPK4 was activated by AtMEK1 in vitro through Thr phosphorylation. Notably, we failed to detect Tyr phosphorylation of ATMPK4 by AtMEK1 using recombinant enzymes. Tyr dephosphorylation by AtPTP1 results in almost complete loss of ATMPK4 enzymatic activity, suggesting that ATMPK4 activation requires Tyr phosphorylation, which appears to occur in vitro primarily by autophosphorylation. These results implicate Tyr phosphorylation in the activation of plant MAPKs, which are similar to animal MAPKs except the source of the Tyr phosphorylation of ATMPK4 may be distinct.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
LITERATURE CITED

Materials

Arabidopsis ecotype Wassilewskija was used in this study. Plants were grown as described previously (Vogel et al., 1998). Myelin basic protein was purchased from Gibco/BRL (Cleveland), [gamma -32P]ATP (6,000 Ci/mmol) was from Amersham Pharmacia (Piscataway, NJ), and ATP was from Boehringer Mannheim/Roche (Basel). Leupeptin and pepstatin A were from Sigma-Aldrich (St. Louis).

Expression of Arabidopsis AtPTP1, AtMEK1, ATMAP2Kalpha , and ATMPK4 in Escherichia coli

Arabidopsis Tyr-specific protein phosphatase AtPTP1 was expressed in E. coli and purified to homogeneity as described previously (Xu et al., 1998). cDNA fragments containing the AtMEK1 (from a cDNA clone), ATMAP2Kalpha or the ATMPK4 (both obtained by RT-PCR) coding regions were cloned into the E. coli expression vector pMAL-c2 (New England Biolabs, Beverly, MA). The resultant plasmids directed the expression of a fusion of each open reading frame to the maltose-binding protein: MBP-MEK1, MBP-ATMAP2Kalpha , and MBP-MPK4, respectively. The junctions of each plasmid, as well as the entire ATMAP2Kalpha and ATMPK4 coding regions, were verified using the automated sequencing facilities at the University of Illinois (Chicago). The fusion proteins were expressed and purified using amylose-affinity chromatography as described by the manufacturer (New England Biolabs). Fractions containing the fusion proteins were pooled and dialyzed overnight against 4 L of column buffer (25 mM Tris-HCl, pH 7.5, and 1 mM dithiothreitol [DTT]). The dialyzed sample was loaded onto a Q-Sepharose (Amersham Pharmacia Biotech, Piscataway, NJ) column (1.5 × 15 cm) previously equilibrated with column buffer, and the proteins eluted with a 200-mL linear gradient of 0 to 0.5 M NaCl in column buffer. Fractions containing purified MBP-MEK1, MBP-ATMAP2Kalpha , or MBP-MPK4 were pooled, desalted, and concentrated (Centriprep-30 concentrator, Amicon). All purification steps were carried out at 4°C.

PCR Site-Directed Mutagenesis of ATMPK4

A mutagenic oligonucleotide primer (CTGAATGCAAATTGTGATCTAAAGCTTGGGGCTTTCG) containing a single base change (from GAT to GCT) that converted Asp-187 to Ala (D187A), together with a downstream primer that included a PstI cloning site (aactgcagTCAAATTACAGACATATTATCAAACTTATC) were used to amplify the ATMPK4 gene from the wild-type cloned ATMPK4 cDNA using PCR. The PCR product was digested with BsmI (contained within the mutagenic oligonucleotide) and PstI, and the resultant fragment ligated with the plasmid used for expressing the MBP-MPK4 fusion. Plasmids containing the correct mutation were identified by DNA sequencing. The D187A MBP-MPK4 fusion protein was expressed in E. coli and purified as described above for the wild-type MBP-MPK4.

Preparation of Antiserum to ATMPK4

Purified MBP-MPK4 was separated by SDS-PAGE and the Coomassie Blue-visualized band corresponding to MBP-MPK4 was excised. The protein was eluted from the gel slice by electroelution and then emulsified in adjuvant (Ribi Immunochem Research, Hamilton, MT) to a final volume of 1 mL. MBP-MPK4 (250 µg) was injected into a 3-kg New Zealand rabbit on d 1 and booster injections given on d 21 and d 35 with 200 µg of the protein. High-titer antiserum was obtained 1 week after the final injection.

5'p-Flurosulfonylbenzoyl Adenosine (FSBA) Treatment of MBP-MPK4

Recombinant AtMPK4 was treated with FSBA under conditions similar to those reported for the mammalian p38 MAP kinase (Young et al., 1997). Purified MBP-MPK4 (0.2 mg/mL) was incubated in the dark for 30 min at room temperature with 100 mM MgCl2 and 1 mM FSBA (Sigma-Aldrich), followed by overnight incubation at 4°C. To remove the unbound FSBA from MBP-MPK4, the reaction mixture was passed through a PD-10 column (Pharmacia Biotech).

Kinase Assays

The autophosphorylation assay mixtures (30 µL) contained kinase reaction buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, and 10 mM MnCl2), 1 µCi of [gamma -32P]ATP, and 0.5 µM MBP-MEK1, MBP-MAP2Kalpha , MBP-MPK4, or D187A MAPK. For the phosphorylation assay of ATMPK4 by AtMEK1 or ATMAP2Kalpha , 0.5 µM MBP-MEK or MBP-MAP2Kalpha was incubated with 0.5 µM D187A MBP-MPK4 in reaction buffer containing 1 µCi of [gamma -32P]ATP. The reactions were started by the addition of the enzymes. After incubation at 30°C for 30 min, the reactions were terminated by the addition of 30 µL of Laemmli sample buffer (Laemmli, 1970). The samples were heated at 95°C for 5 min and then loaded on a SDS-polyacrylamide gel (7.5% acrylamide [w/v]). The gels were stained with Coomassie Blue R-250, and then destained and dried. The 32P-labeled bands were detected using X-Omat AR film (Eastman-Kodak, Rochester, NY).

Activation of ATMPK4 by AtMEK1

Assay mixtures (60 µL) contained kinase reaction buffer plus 50 µM ATP, 50 mM sodium ortho-vanadate, 1 µM okadaic acid, purified MBP-MPK4 (6 µg), and various amounts of MBP-MEK1 (0, 0.2, 0.6, 1, 2, and 3 µg). After incubation at 30°C for 30 min, 1 µL of anti-MBP-MPK4 antiserum was added to each reaction. The reaction mixtures were incubated at 15°C for 30 min, followed by the addition of 20 µL of protein A agarose beads (Boehringer Mannheim/Roche). After further incubation at 15°C for 30 min, the reaction mixtures were centrifuged at 10,000g for 1 min. The pellets were washed three times with kinase reaction buffer at 4°C, and then resuspended in 50 µL of kinase reaction buffer. A 10-µL aliquot of the resuspended immunoprecipitate was added to 20 µL of kinase reaction buffer plus 10 µM ATP, myelin basic protein (3 µg), and 1 µCi of [gamma -32P]ATP. The reactions were incubated at 30°C for 30 min and then analyzed by SDS-PAGE (15% acrylamide [w/v]) as described above, followed by autoradiography.

Dephosphorylation of ATMPK4 by AtPTP1

Dephosphorylation of ATMPK4 by AtPTP1 was performed as follows. Assay mixtures (30 µL) contained kinase reaction buffer plus 1 mM DTT, 1 µCi of [gamma -32P]ATP, and 5 µg of purified MBP-MPK4, or 5 µg of D187A MBP-MAPK that had been previously phosphorylated by MBP-MEK1 (2.5 µg). The assay mixtures were incubated at 30°C for 30 min, followed by the addition of 50 ng of purified AtPTP1 or a buffer control. The mixtures were further incubated at 30°C for 30 min and then terminated by the addition of Laemmli sample buffer. Aliquots of the above reactions were analyzed by SDS-PAGE (7.5% acrylamide [w/v]) followed by autoradiography. For the western analysis, purified MBP-MPK4 (2 µg), D187A MBP-MPK4 (2 µg), and MBP-MEK1 (1 µg) were mixed in various combinations in kinase reaction buffer containing cold ATP for 30 min at 30°C. AtPTP1 (50 ng) was then added to each reaction and the mixtures incubated a further 30 min at 30°C. The samples were then separated by SDS-PAGE and electroblotted onto a polyvinylidene difluoride (PVDF) membrane (Micron Separations, Westborough, MA). The blot was then probed with an anti-phospho-Tyr-specific mouse monoclonal antibody (clone 4G10 from Upstate Biotechnology, Lake Placid, NY) using an enhanced chemoluminescence detection system as described by the manufacturer (Amersham).

Inactivation of ATMPK4 by AtPTP1

To determine the effect of Tyr dephosphorylation on ATMPK4 activity, MBP-MPK4 (3 µg) was phosphorylated by MBP-MEK1 (1 µg) as described above, except that the ATP concentration was 100 µM and there was no [gamma -32P]ATP. After phosphorylation, MBP-MPK4 was immunoprecipitated by the addition of 1 µL of anti-ATMPK4 antibody, and the immunoprecipitate was treated with AtPTP1 (50 ng) or a control containing buffer alone as described above. The AtPTP1-treated sample was washed three times to remove the AtPTP1 and then resuspended in 50 µL of 50 mM Tris-HCl, pH 7.5. A 10-µL aliquot was added to the assay mixture (20 µL) containing kinase reaction buffer plus 2 mM DTT, 20 µM ATP, 3 µg of myelin basic protein, and 1 µCi of [gamma -32P]ATP. After incubation at 30°C for 30 min, the reaction was terminated by the addition of Laemmeli sample buffer and analyzed by SDS-PAGE.

Phosphoamino Acid Analysis

Phosphoproteins were first separated by SDS-PAGE in a mini-gel apparatus (Bio-Rad Laboratories, Hercules, CA), then electroblotted onto a PVDF membrane with 10 mM 3-(cyclohexylamino)propanesulfonic acid (CAPS), pH 10.6, and 10% (v/v) methanol. The 32P-labeled proteins were excised and hydrolyzed in 6 N HCl at 110°C for 1 h. The hydrolyzed samples were subjected to two-dimensional phosphoamino acid analysis, as described previously (Kamps and Sefton, 1989), using a Hunter apparatus (model HTLE 7000, VWR Scientific, S. Plainfield, NJ).

Inactivation of Immunoprecipitated MAPK from Arabidopsis Leaves by AtPTP1

Fully expanded adult Arabidopsis leaves (1 g) were ground with a mortar and pestle in 2 mL of extraction buffer (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 µg/mL leupeptin, 10 µg/mL pepstatin A, 10 µg/mL PMSF, and 5% [w/w] Polyclar AT) in the presence of acid-washed glass beads (150-200 µm; Sigma-Aldrich). The extract was centrifuged at 8,000g for 30 min at 4°C, and the supernatant used for immunoprecipitation. MBP-MPK4-depleted serum was prepared by incubating 4 µL of anti-MPK4 antiserum with 5 µg of purified D187A MBP-MPK4 for 30 min at 16°C. For the controls, 500 µg of protein extract was mixed with 4 µL of preimmune serum or 4 µL of MBP-MPK4-depleted serum. Various amounts of the extracts (125, 250, or 500 µg) were also mixed with 4 µL of anti-MPK4 antiserum. Immunoprecipitation was carried out as above. The immunoprecipitate was washed three times with 1 mL of buffer A (50 mM Tris-HCl, pH 7.5) and then resuspended in 100 µL of buffer A. Aliquots (50 µL) of immunoprecipitate were incubated with AtPTP1 (500 ng) or a buffer alone control for 20 min at 30°C. The samples were centrifuged, washed three times with buffer A, and resuspended in 50 µL of buffer A. The samples (10 µL) were assayed for kinase activity using myelin basic protein as a substrate (as described above).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
LITERATURE CITED

Expression and Purification of AtMEK1, ATMAP2Kalpha , ATMPK4, and D187A ATMPK4

To determine if AtMEK1 can activate ATMPK4 in vitro, and to delineate the biochemical properties of this interaction, we expressed ATMPK4, AtMEK1, and ATMAP2Kalpha in E. coli as fusions to the maltose-binding protein. The fusion proteins were present predominantly in the soluble portion of the E. coli extract (not shown). Using amylose-affinity chromatography followed by ion-exchange chromatography with Q-Sepharose, MBP-MEK1, MBP-MPK4, and a mutant, ATMPK4 (D187A MBP-MPK4; see below), were purified to apparent homogeneity as determined by Coomassie Blue staining of SDS-PAGE gels (Fig. 1). The MBP-ATMAP2Kalpha was purified solely by amylose-affinity chromatography. The apparent molecular masses of MBP-MEK1, MBP-ATMAP2Kalpha , MBP-MPK4, and D187A MBP-MPK4 on SDS-PAGE are in good agreement with those calculated from the predicted amino acid sequences.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 1.   SDS-PAGE analysis of purification of MBP-MEK1, MBP-MPK4, MBP-MAP2Kalpha , and D187A MBP-MPK4 from E. coli. Lanes 2 to 4 contain various steps of the MBP-MEK1 purification: the soluble fraction of the E. coli cells expressing MBP-MEK1 (lane 2), the pooled fractions from the amylose-agarose column (lane 3), and the pooled fractions of the Q-Sepharose column containing MBP-MEK1(1 µg, lane 4). Lanes 5, 6, and 7 contain purified MBP-MPK4 (5 µg), D187A MBP-MPK4 (4 µg), and MBP-MAP2Kalpha (1 µg), respectively. The gel (7.5% arcylamide [w/v]) was stained with Coomassie Blue R-250, and molecular mass markers as indicated were applied to lane 1.

Autophosphorylation of AtMEK1, ATMAP2Kalpha , and ATMPK4

To determine whether the AtMEK1, ATMAP2Kalpha , and ATMPK4 fusion proteins purified from E. coli are catalytically active, the enzymes were subjected to in vitro autophosphorylation assays. Purified MBP-MEK1, MBP-ATMAP2Kalpha , or MBP-MPK4 was incubated in reaction buffer in the presence of [gamma -32P]ATP, and the products analyzed by SDS-PAGE. Autoradiography of the gel revealed a single labeled band in each of the MBP-MEK1, MBP-ATMAP2Kalpha , and MBP-MPK4 lanes (Fig. 2), and the position of this labeled band was indistinguishable from that of the respective Coomassie Blue-stained protein bands. This suggests that the three recombinant enzymes are catalytically active protein kinases.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 2.   Kinase assays of AtMEK1 and ATMPK4. A, The products of in vitro autophosphorylation from purified MBP-MEK1, MBP-MAP2Kalpha , MBP-MPK4, and D187A MBP-MPK4, or the products of phosphorylation of D187A MBP-MPK4 by MBP-MEK1 or MBP-MAP2Kalpha were separated by SDS-PAGE subjected to autoradiography. B, The products of in vitro kinase assays from purified MBP-MEK1, untreated MBP-MPK4, FSBA-treated MBP-MPK4, D187A MBP-MPK4, or FSBA-treated MBP-MPK4 plus MBP-MEK1, as indicated above each lane. The products were separated by SDS-PAGE and analyzed by autoradiography.

A mutant form of ATMPK4, D187A MPK4, was generated by site-directed mutagenesis. The mutated Asp is located in the DFG motif (kinase subdomain VII) of the kinase, a motif absolutely conserved in all protein kinases, and the invariant Asp residue is responsible for base-catalyzed transfer of the phosphate in catalysis (Taylor, 1989). Substitution of the negatively charged Asp with an aliphatic Ala is predicted to abolish the kinase activity. As shown in Figure 2, no phosphate was incorporated into the mutant fusion protein, indicating that D187A ATMPK4 is indeed catalytically inactive.

ATMPK4 Is Phosphorylated and Activated by AtMEK1 in Vitro

To determine if AtMEK1 could phosphorylate ATMPK4, the inactive D187A MBP-MPK4 was incubated with MBP-MEK1 in a kinase reaction. The intensity of the band resulting from the reaction containing both MBP-MEK1 and D187A MBP-MPK4 is much stronger than the MBP-MEK1 autophosphorylation band (Fig. 2), indicating that the MBP-MPK4 is indeed phosphorylated by AtMEK1. MBP-MEK1 did not phosphorylate purified maltose binding protein in an in vitro kinase assay (data not shown), which indicates that AtMEK1 phosphorylates the ATMPK4 portion of the MBP-MPK4. A second MEK homolog, ATMAP2Kalpha , which is from a distinct Arabidopsis MEK subfamily, was tested for its ability to phosphorylate D187A MBP-MPK4. Using purified components, we failed to detect any significant phosphorylation of D187A MBP-MPK4 by MBP-ATMAP2Kalpha (Fig. 2).

To determine if phosphorylation of ATMPK4 by AtMEK1 leads to its activation, we performed a two-step in vitro kinase assay using purified recombinant MBP-MEK1, MBP-MPK4, and myelin basic protein as the end substrate. Myelin basic protein is an excellent substrate for MAPKs, and is widely used for MAPK assays. MBP-MPK4 was first incubated with MBP-MEK1 in the presence of ATP in kinase buffer (see "Materials and Methods). An aliquot was then added to a reaction cocktail containing myelin basic protein and [gamma -32P]ATP. As shown in Figure 3A, MBP-MPK4 activity, as measured by the incorporation of label into myelin basic protein, was greatly stimulated by prior treatment with MBP-MEK1. In the absence of MBP-MPK4, no phosphorylation was detected, suggesting that myelin basic protein is not a substrate of AtMEK1. However, a faint 32P signal was detected in the control with untreated MBP-MPK4, indicating that the purified MAPK possesses some low basal activity. The activity of ATMPK4 increased with increasing amounts of MBP-MEK1, up to a ratio of 0.5 mol of MBP-MEK1 to 1 mol of MBP-MPK4 (Fig. 3B).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 3.   Activation of ATMPK4 by AtMEK1. A, Purified MBP-MEK1 (1 µg) and/or MBP-MPK4 (as indicated) were incubated at 30°C for 30 min, and the products assayed for myelin basic protein (MBP) kinase activity. B, Purified MBP-MPK4 (6 µg) was incubated with the indicated amounts of MBP-MEK1 at 30°C for 30 min in the presence of ATP in kinase buffer, and the activity of the MBP-MPK4 was subsequently measured by phosphorylation of myelin basic protein.

Activation of ATMPK4 Is Accompanied by Thr and Tyr Phosphorylation

To begin to unravel the activation mechanism of ATMPK4, we performed phosphoamino acid analysis on the products of in vitro kinase reactions (Fig. 4). AtMEK1 autophosphorylated principally on Ser(s), and slightly on Thr(s) (Fig. 4A). Notably, we did not detect any phospho-Tyr from the AtMEK1 autophosphorylation reaction. This autophosphorylation property is different from that of animal MEKs, which autophosphorylate on Ser, Thr, and Tyr residues (Crews and Erikson, 1992; Seger et al., 1992; Resing et al., 1995). ATMPK4 autophosphorylated predominately on Tyr; small amounts of phospho-Ser were also detected (Fig. 4B), although the level was variable. Analysis of wild-type MBP-MPK4 phosphorylated by MBP-MEK1 revealed predominately Thr and Tyr phosphorylation, with variable levels of phospho-Ser (Fig. 4C). Activated ATMPK4 phosphorylated myelin basic protein almost exclusively on Thr residue(s) (Fig. 4D).



View larger version (85K):
[in this window]
[in a new window]
 
Figure 4.   Phosphoamino acid analysis of AtMEK1 and ATMPK4. Following in vitro kinase assays, the 32P-labeled proteins were hydrolyzed with 6 N HCl and the phosphoamino acids were separated by two-dimensional thin layer electrophoresis. The phosphoamino acids were detected by staining with 0.25% (w/v) ninhydrin (for the unlabeled standards) and autoradiography. The position of the phosphoamino acid standards is indicated by dashed ovals. pS, Phospho-Ser; pT, phospho-Thr; and pY, phospho-Tyr. Phosphoamino acid analysis of autophosphorylated AtMEK1 (A), autophosphorylated ATMPK4 (B), ATMPK4 phosphorylated by AtMEK1 (C), myelin basic protein phosphorylated by AtMEK1-activated ATMPK4 (D), D187A MBP-MPK4 phosphorylated by AtMEK1 (E), FSBA-treated MBP-MPK4 phosphorylated by AtMEK1 (F).

To determine if phospho-Tyr was the result of MBP-MPK4 autophosphorylation or due to phosphorylation by MBP-MEK1, we analyzed the phosphoamino acids that resulted from phosphorylation of FSBA-treated MBP-MPK4. FSBA is an ATP analog that covalently binds to the ATP-binding site of protein kinases, which results in inactivation of many protein kinases, including MAPK (Young et al., 1997). As shown in Figure 2B, treatment of MBP-MPK4 with FSBA greatly reduced its autophosphorylation activity. The reduction in autophosphorylation activity is approximately equal to the effect of the D187A mutation, which also disrupts the ATP binding site of ATMPK4. The FSBA-treated MBP-MPK4 was phosphorylated by MBP-MEK1, and the phosphorylation occurred predominately on Thr residue(s); only minute amount of phospho-Tyr were detected (Fig. 4F). To further confirm that AtMEK1 does not phosphorylate ATMPK4 on Tyr, we examined the phosphorylation of the catalytically inactive D187A MBP-MAPK4 by MBP-MEK1. Consistent with the results obtained with the FSBA-treated ATMPK4, phosphorylation of the D187A mutant occurred predominately on Thr residue(s), and little or no phospho-Tyr was detected (Fig. 4E). This is also consistent with the lack of phospho-Tyr in the AtMEK1 autophosphorylation reaction.

Dephosphorylation of Tyr Results in Complete Loss of ATMPK4 Activity

To determine if Tyr phosphorylation plays a role in the regulation of ATMPK4, we utilized the Arabidopsis phosphatase AtPTP1. Purified, recombinant AtPTP1 specifically hydrolyzes phospho-Tyr from artificial substrates (Xu et al., 1998). We examined the ability of purified AtPTP1 to dephosphorylate ATMPK4 in vitro. Treatment of autophosphorylated ATMPK4 with purified AtPTP1 results in the removal of most of the incorporated 32P label (Fig. 5A), and because the majority of this label is on Tyr, it indicates that AtPTP1 efficiently dephosphorylates phospho-Tyr. Specific Tyr dephosphorylation of ATMPK4 by PTP1 was demonstrated further by our phosphoamino acid analysis, which showed specific removal of phosphate from the phospho-Tyr of ATMPK4 upon the treatment of AtPTP1, and little or no dephosphorylation on Ser or Thr (Fig. 5C). AtPTP1 treatment also results in the loss of immunoreactivity with a phospho-Tyr-specific antibody (Fig. 5B), confirming that the residual phosphorylation is not on Tyr. However, treatment of MBP-D187A MPK4, which is phosphorylated predominately on Thr residues (Fig. 4E), with AtPTP1 did not result in significant hydrolysis of the phosphate, as would be expected if AtPTP1 is specific for Tyr residues (Fig. 5A).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 5.   Tyr dephosphorylation and inactivation of ATMPK4 by AtPTP1. A, Specificity of AtPTP1. Purified MBP-MPK4 (auto, 5 µg) and MBP-MEK1 (2.5 µg) plus D187A MBP-MPK4 (MEK-treated, 5 µg) were incubated in kinase buffer in the presence of [gamma -32P]ATP for 30 min at 30°C. Either 50 ng of purified AtPTP1 or a buffer alone control was then added and the reaction was incubated an additional 30 min at 30°C. The products were then separated by SDS-PAGE, and the incorporated 32P was quantified with a phosphor imager. The highest signal was assigned a value of 1, and the other signals normalized to it. The values represent the means ± SD from two replicates. B, Western-blot analysis of the products of in vitro kinase assays using cold ATP. The western blots were probed with an anti-phospho-Tyr antibody. The lanes contain the products of the following reactions: Lane 1, MBP-MEK1; lane 2, MBP-MPK4; lane 3, D187A MBP-MPK4; lane 4, MBP-MEK1 plus D187A MBP-MPK4; lane 5, MBP-MPK4 plus AtPTP1; and lane 6, MBP-MEK1 plus D187A MBP-MPK4 plus AtPTP1. C, Phosphoamino acid analysis of wild-type MBP-ATMPK4 phosphorylated by MBP-AtMEK1 and either untreated or treated with 50 ng of AtPTP1 as indicated. D, Effect of Tyr dephosphorylation on MBP-MPK4 activity. MBP-MPK4 (3 µg) was incubated with MBP-MEK1 (1 µg) in the presence of 100 µM ATP, then purified by immunoprecipitation with anti-MPK4 antibody. The immunoprecipitate was washed and then treated with 50 ng of AtPTP1 (right lane) or a buffer alone control (left lane). The beads were washed to remove the AtPTP1, and the activity of ATMPK4 was then measured by the phosphorylation of myelin basic protein.

We examined the effect of Tyr dephosphorylation on the activity of AtMEK1-activated MBP-MPK4. As shown in Figure 5D, treatment of MEK-activated MBP-MPK4 by AtPTP1 resulted in a near complete loss of ATMPK4 activity, suggesting that Tyr phosphorylation is essential for high ATMPK4 activity.

Tyr Phosphorylation of MAPKs in Vivo

To determine if the phosphorylation of Tyr plays a role in the activity of MAPK in vivo, we examined the effect of AtPTP1 treatment on myelin basic protein kinase activity measured from extracts of Arabidopsis leaves that had been immunoprecipitated with an anti-ATMPK4 polyclonal antibody (Fig. 6). This polyclonal antibody was raised against the entire ATMPK4 protein and, given the similarity of the Arabidopsis MAPK gene family, it likely recognizes multiple MAPK isoforms. This antibody immunoprecipitated MBP-MPK4 purified from E. coli, but the preimmune serum or antibody that had been pretreated with purified MBP-D187A-MPK4 failed to do so (Fig. 6A). Treatment of Arabidopsis leaf extracts with the anti-MPK4 antibody immunoprecipitated a level of myelin basic protein kinase activity proportional to the amount of extract analyzed (Fig. 6B, lanes 3-5), as would be expected if the antibody were in excess. Arabidopsis extracts treated with either preimmune serum (controls) or with the MBP-D187A-MPK4-depleted serum failed to precipitate myelin basic protein kinase activity (Fig. 6B, lanes 1 and 2). Treatment of the immunoprecipitated protein with AtPTP1 resulted in a substantial reduction in kinase activity (Fig. 6B, lanes 6-8). These results suggest that Arabidopsis MAPKs are phosphorylated on Tyr in vivo, and that this phosphorylation is required for high activity.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 6.   Inactivation of Arabidopsis MBP kinase activity by AtPTP1. A, In vitro kinase assay of immunoprecipitated MBP-MAPK4. Purified MBP-MAPK4 was treated with preimmune serum (lane 1), anti-MAPK4 serum (lane 2), or ATMPK4-depleted anti-MAPK4 serum (lane 3). The immunoprecipitates were then mixed with myelin basic protein in kinase buffer containing of [gamma -32P]ATP and the products analyzed by SDS-PAGE followed by autoradiography. B, Effect of PTP treatment on myelin basic protein kinase activity from Arabidopsis leaf extracts. Fifty microliters (lanes 3 and 6), 100 µL (lanes 4 and 7), or 200 µL (lanes 1, 2, 5, and 8) of soluble Arabidopsis leaf extracts were incubated with preimmune (lane 1), ATMPK4-depleted (lane 2), or anti-MAPK4 serum (lanes 3-8). The immunoprecipitates were then treated with 500 ng of AtPTP1 (lanes 6-8) or a buffer alone control (lanes 1-5) for 30 min at 30°C. The products were then assayed in vitro for myelin basic protein kinase activity as described in "Materials and Methods" and the products analyzed by SDS-PAGE followed by autoradiography.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
LITERATURE CITED

We have expressed Arabidopsis homologs of MEK and MAPK in E. coli and purified them to apparent homogeneity using affinity chromatography. Consistent with their similarity to other protein kinases, both possess intrinsic protein kinase activity, as determined by in vitro phosphorylation assays. Purified, recombinant AtMEK1 was able to phosphorylate and activate ATMPK4 in vitro, which indicates that a plant MEK homolog is able to phosphorylate and activate a MAPK from plants.

Activation of animal MAPK is achieved by phosphorylation of both Tyr and Thr by the dual-specificity kinase MEK. Similarly, in order for ATMPK4 to be highly active requires phosphorylation of both Tyr and Thr residues, as demonstrated using phospho-Tyr-specific phosphatases and antibodies. This is consistent with the findings of Ádám et al. (1997), who utilized an animal Tyr phosphatase to demonstrate that Tyr phosphorylation is required for full activity of a myelin basic protein kinase from harpin-treated tobacco leaves. However, phosphoamino acid analysis of catalytically inactive ATMPK4 phosphorylated by AtMEK1 indicated that there was almost no phosphorylation of Tyr residues. Additionally, analysis of AtMEK1 autophosphorylation revealed that it did not autophosphorylate on Tyr residues, which is distinct from the animal enzymes. These results suggest that, in contrast to animal MEKs, AtMEK1 may not be a dual-specificity kinase, but rather a Ser/Thr specific kinase. Alternatively, it is possible that the lack of Tyr phosphorylation by AtMEK1 in vitro is an artifact of the recombinant enzyme, although this is unlikely because other recombinant MEKs from animal and fungal sources have phosphorylation profiles similar to the native enzymes.

Tyr phosphorylation is clearly required for full ATMPK4 activity, and this, at least in vitro, results from ATMPK4 autophosphorylation activity. Animal MAPKs autophosphorylate, via an intramolecular reaction, on the Tyr and Thr residues of the TXY motif, with the Tyr phosphorylation being stronger (Seger et al., 1991; Wu et al., 1991; Robbins and Cobb, 1992; Her et al., 1993; Robbins et al., 1993). The rate of autophosphorylation varies widely among MAP kinases, and this variance has been linked to differences in the loop between the kinase subdomains VII and VIII (Jiang et al., 1997). Interestingly, this loop is very divergent in the Arabidopsis MAP kinase family (Mizoguchi et al., 1993). The Tyr autophosphorylation of ATMPK4 may play an important role in its activation, although it is not yet known if this occurs on the Tyr residue of the TEY motif. However, the observation that removal of this autophosphorylated Tyr by AtPTP1 decreased the activity of ATMAPK4 indicates that it occurs on a regulatory Tyr. Kinetic analysis indicates that animal MEK exhibits a 10-fold increase in apparent affinity for the Tyr phosphorylated MAPK (Haystead et al., 1992), and perhaps Tyr autophosphorylation of AtMPK4 is a prerequisite for its activation and may obviate the requirement for phosphorylation of this residue by AtMEK1.

An alternative to autophosphorylation being the in vivo source of phospho-Tyr in ATMPK4 is that a second MEK catalyzes the Tyr phosphorylation. There is some precedent for this mode of activation for MAP kinases. The SAPK1/JNK1 MAP kinase is phosphorylated by two MEKs synergistically, one of which phosphorylates the Tyr residue and one of which phosphorylates the Thr residue within the TXY motif (Lawler et al., 1998). There are multiple MEK genes in Arabidopsis, and it may be that AtMEK1 phosphorylates ATMPK4 on Thr and a distinct isoform phosphorylates the Tyr residue of the TXY motif. Nevertheless, results presented here indicate that the autophosphorylation of ATMPK4 on Tyr is sufficient to activate, at least partially, the enzyme in vitro in combination with the Thr phosphorylation catalyzed by AtMEK1.

The activation of ATMPK4 by AtMEK was close to linear up to a 1:1 ratio. This is similar to animal systems in which high ratios of MEK:MAPK (40:1) are required to fully phosphorylate MAPK in vitro (Scott et al., 1995). However, addition of a MEK-enhancing factor results in full phosphorylation of MAPK by MEK at equal molar concentrations in vitro (Scott et al., 1995). Interestingly, MEK-enhancing factor also greatly stimulates MAPK autophosphorylation activity in vitro. Consistent with the relatively poor phosphorylation, MAPK and MEK are present at roughly equal concentrations in vivo, and is some cases MEK is even in excess (Ferrell, 1996). This suggests that little or no amplification occurs when a signal is passed from MEK to MAPK. It has been postulated that the dual phosphorylation of MAPK by MEK may play a role in converting graded inputs into a switch-like output (Ferrell, 1996). If autophosphorylation of ATMPK4 is indeed the in vivo source of Tyr phosphorylation, then it may be that it acts less switch-like and perhaps produces a more graded signaling output.

ATMPK4 is efficiently dephosphorylated by AtPTP1 in vitro, but it is unclear whether AtPTP1 interacts with ATMPK4 in vivo. Animal and yeast MAPKs are deactivated by dual specificity protein phosphatases, or by the combination of a Ser/Thr protein phosphatase and a Tyr-specific phosphatase (Cobb and Goldsmith, 1995; Keyse, 1998). A dual-specificity protein phosphatase, AtDsPTP1, has also been identified from Arabidopsis (Gupta et al., 1998). AtDsPTP1 is able to hydrolyze both phospho-Ser and phospho-Tyr using artificial protein substrates. Furthermore, this enzyme is capable of dephosphorylating and inactivating ATMPK4; however, the catalytic efficiency is at least 30-fold lower than that of AtPTP1 (data not shown). Thus, AtDsPTP1 is unlikely to deactivate ATMPK4 in vivo. Arabidopsis homologs of the Ser/Thr phosphatase PP2C have also been identified and have been implicated in the repression of MAPK cascades (Luan, 1998; Meskiene et al., 1998).

    FOOTNOTES

Received August 25, 1999; accepted November 23, 1999.

1 This work was supported by the National Science Foundation (grant nos. MCB-9816914 and IBN-9416017 to J.J.K.).

2 Present address: Performance Plants, Inc., Bioscience Complex, Queen's University Kingston, Ontario, Canada K7L 3N6.

3 Present address: University of North Carolina, Biology Department, CB#3280, Chapel Hill, NC 27599-3280.

* Corresponding author; e-mail jkieber{at}unc.edu; fax 919-962-1625.


    LITERATURE CITED
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
LITERATURE CITED

  • Ádám AL, Pike S, Hoyos ME, Stone JM, Walker JC, Novacky A (1997) Rapid and transient activation of a myelin basic protein kinase in tobacco leaves treated with harpin from Erwinia amylovora. Plant Physiol 115: 853-861 [Abstract]
  • Anderson NG, Maller JL, Tonks NK, Sturgill TW (1990) Requirement for integration of signals from two distinct phosphorylation pathways for activation of MAP kinase. Nature 343: 651-653 [CrossRef][Medline]
  • Börge L, Ligterink W, Meskiene I, Barker PJ, Heberle-Bors E, Huskisson NS, Hirt H (1997) Wounding induces the rapid and transient activation of a specific MAP kinase pathway. Plant Cell 9: 75-83 [Abstract]
  • Chen RH, Sarnecki C, Blenis J (1992) Nuclear localization and regulation of Erk- and Rsk-encoded protein kinases. Mol Cell Biol 12: 915-927 [Abstract/Free Full Text]
  • Cobb MH, Goldsmith EJ (1995) How MAP kinases are regulated. J Biol Chem 270: 14843-14846 [Free Full Text]
  • Crews CM, Erikson RL (1992) Purification of a murine protein-tyrosine/threonine kinase that phosphorylates and activates the Erk-1 gene product: relationship to the fission yeast byr1 gene product. Proc Natl Acad Sci USA 89: 8205-8209 [Abstract/Free Full Text]
  • Ferrell JE Jr (1996) Tripping the switch fantastic: how a protein kinase cascade can convert graded inputs into switch-like outputs. Trends Biochem 21: 460-466 [CrossRef][Web of Science][Medline]
  • Ferrell JE Jr, Bhatt RR (1997) Mechanistic studies of the dual phosphorylation of mitogen-activated protein kinase. J Biol Chem 272: 19008-19016 [Abstract/Free Full Text]
  • Gupta R, Huang Y, Kieber JJ, Luan S (1998) Identification of a dual-specificity protein phosphatase that inactivates a MAP kinase from Arabidopsis. Plant J 16: 581-590 [CrossRef][Web of Science][Medline]
  • Haystead TA, Dent P, Wu J, Haystead CM, Sturgill TW (1992) Ordered phosphorylation of p42mapk by MAP kinase kinase. FEBS Lett 306: 17-22 [CrossRef][Web of Science][Medline]
  • Her J, Lakhani S, Zu K, Vila J, Dent P, Sturgill TW, Weber MJ (1993) Dual phosphorylation and autophosphorylation in mitogen-activated protein (MAP) kinase activation. Biochem J 296: 25-31
  • Hirt H (1997) Multiple roles of MAP kinases in plant signal transduction. Trends Plant Sci 2: 11-15 [CrossRef][Web of Science]
  • Ichimura K, Mizoguchi T, Hayashida N, Seki M, Shinozaki K (1998a) Molecular cloning and characterization of three cDNAs encoding putative mitogen-activated protein kinase kinases (MAPKKs) in Arabidopsis thaliana. DNA Res 5: 341-348 [Abstract]
  • Ichimura K, Mizoguchi T, Irie K, Morris P, Giraudat J, Matsumoto K, Shinozaki K (1998b) Isolation of ATMEKK1 (a MAP kinase kinase kinase)-interacting proteins and analysis of a MAP kinase cascade in Arabidopsis. Bichem Biophys Res Commun 253: 532-543 [CrossRef][Web of Science][Medline]
  • Jiang Y, Li Z, Schwarz EM, Lin A, Guan K, Ulevitch RJ, Han J (1997) Structure-function studies of p38 mitogen-activated protein kinase. J Biol Chem 272: 11096-11102 [Abstract/Free Full Text]
  • Jonak C, Kiegerl S, Ligterink W, Barker PJ, Huskisson NS, Hirt H (1996) Stress signaling in plants: a mitogen-activated protein kinase pathway is activated by cold and drought. Proc Natl Acad Sci USA 93: 11274-11279 [Abstract/Free Full Text]
  • Jouannic S, Hamal A, Kreis M, Henry Y (1996) Molecular cloning of an Arabidopsis thaliana MAP kinase kinase-related cDNA (accession no. Y07694) (PGR 96-098). Plant Physiol 112: 1397 [Medline]
  • Kamps MP, Sefton BM (1989) Acid and base hydrolysis of phosphoproteins bound to Immobilon facilitates analysis of phosphoamino acids in gel-fractionated proteins. Anal Biochem 176: 22-27 [CrossRef][Web of Science][Medline]
  • Keyse SM (1998) Protein phosphatases and the regulation of MAP kinase activity. Semin Cell Dev Biol 9: 143-152 [CrossRef][Web of Science][Medline]
  • Khokhlatchev AV, Canagarajah B, Wilsbacher J, Robinson M, Atkinson M, Goldsmith E, Cobb MH (1998) Phosphorylation of the MAP kinase ERK2 promotes its homodimerization and nuclear translocation. Cell 93: 605-615 [CrossRef][Web of Science][Medline]
  • Kieber JJ (1997) The ethylene response pathway in Arabidopsis. Annu Rev Plant Physiol Plant Mol Biol 48: 277-296 [CrossRef][Web of Science][Medline]
  • Knetsch MLW, Wang M, Snaar-Jagalska BE, Heimovaara-Dijkstra S (1996) Abscisic acid induces mitogen-activated protein kinase activation in barley aleurone protoplasts. Plant Cell 8: 1061-1067 [Abstract]
  • Kovtun Y, Chui WL, Zeng W, Sheen J (1998) Suppression of auxin signal transduction by a MAPK cascade in higher plants. Nature 395: 716-720 [CrossRef][Medline]
  • Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685 [CrossRef][Medline]
  • Lawler S, Fleming Y, Goedert M, Cohen P (1998) Synergistic activation of SAPK1/JNK1 by two MAP kinase kinases in vitro. Curr Biol 8: 1387-1390 [CrossRef][Web of Science][Medline]
  • Lenormand P, Sardet C, Pages G, L'Allemain G, Brunet A, Pouyssegur J (1993) Growth factors induce nuclear translocation of MAP kinases (p42mapk and p44 mapk) but not of their activator MAP kinase kinase (p45mapkk) in fibroblasts. J Cell Biol 122: 1079-1088 [Abstract/Free Full Text]
  • Lewis TS, Shapiro PS, Ahn NG (1998) Signal transduction through MAP kinase cascades. Adv Cancer Res 74: 49-139 [Web of Science][Medline]
  • Ligterink W, Kroj T, zur Nieden U, Hirt H, Scheel D (1997) Receptor-mediated activation of a MAP kinase in pathogen defense of plants. Science 276: 2054-2057 [Abstract/Free Full Text]
  • Luan S (1998) Protein phosphatases and signaling cascades in higher plants. Trends Plant Sci 3: 271-275 [CrossRef][Web of Science]
  • Meskiene I, Bögre L, Glaser W, Balog J, Brandstötter M, Zwerger K, Ammerer G, Hirt H (1998) MP2C, a plant protein phosphatase 2C, functions as a negative regulator of mitogen-activated protein kinase pathways in yeast and plants. Proc Natl Acad Sci USA 95: 1938-1943 [Abstract/Free Full Text]
  • Mizoguchi T, Gotoh Y, Nishida E, Yamaguchi-Shinozaki K, Hayashida N, Iwasaki T, Kamada H, Shinozaki K (1994) Characterization of two cDNAs that encode MAP kinase homologues in Arabidopsis thaliana and analysis of the possible role of auxin in activating such kinase activities in cultured cells. Plant J 5: 111-122 [CrossRef][Web of Science][Medline]
  • Mizoguchi T, Hayashida N, Yamaguchi-Shinozaki K, Kamada H, Shinozaki K (1993) ATMPKs: a gene family of plant MAP kinases in Arabidopsis thaliana. FEBS Lett 336: 440-444 [CrossRef][Web of Science][Medline]
  • Mizoguchi T, Ichimura K, Irie K, Morris P, Giraudat J, Matsumoto K, Shinozaki K (1998) Identification of a possible MAP kinase cascade in Arabidopsis thaliana based on pairwise yeast two-hybrid analysis and functional complementation tests of yeast mutants. FEBS Lett 437: 56-60 [CrossRef][Web of Science][Medline]
  • Mizoguchi T, Ichimura K, Shinozaki K (1997) Environmental stress response in plants: the role of mitogen-activated protein kinases (MAPKs). Trends Biotechnol 15: 15-19 [CrossRef][Web of Science][Medline]
  • Mizoguchi T, Irie K, Hirayama T, Hayashida N, Yamaguchi-Shinozaki K, Matsumoto K, Shinozaki K (1996) A gene encoding a mitogen-activated protein kinase kinase kinase is induced simultaneously with genes for a mitogen-activated protein kinase and an S6 ribosomal protein kinase by touch, cold, and water stress in Arabidopsis thaliana. Proc Natl Acad Sci USA 93: 765-769 [Abstract/Free Full Text]
  • Morris PC, Guerrier D, Leung J, Giraudat J (1997) Cloning and characterization of MEK1, an Arabidopsis gene encoding a homo-logue of MAP kinase kinase. Plant Mol Biol 35: 1057-1064 [CrossRef][Web of Science][Medline]
  • Payne DM, Rossomando AJ, Martino P, Erickson AK, Her J-H, Shabanowitz J, Hunt DF, Weber MJ, Sturgill TW (1991) Identi-fication of the regulatory phosphorylation sites in pp42/mitogen-activated protein kinase MAP kinase. EMBO J 10: 885-892 [Web of Science][Medline]
  • Resing KA, Mansour SJ, Hermann AS, Johnson RS, Candia JM, Fukasawa K, Vande Woude GF, Ahn NG (1995) Determination of v-Mos-catalyzed phosphorylation sites and autophosphorylation sites on MAP kinase kinase by ESI/MS. Biochemistry 34: 2610-2620 [CrossRef][Medline]
  • Robbins DJ, Cobb MH (1992) Extracellular signal-regulated kinases 1 and 2 autophosphorylate on a subset of peptides phosphorylated in intact cells in response to insulin and nerve growth factor: analysis by peptide mapping. Mol Biol Cell 3: 299-308 [Abstract]
  • Robbins DJ, Zhen E, Owaki H, Vanderbilt CA, Ebert D, Geppert TD, Cobb MH (1993) Regulation and properties of extracellular signal-regulated protein kinases 1 and 2 in vitro. J Biol Chem 268: 5097-5106 [Abstract/Free Full Text]
  • Robinson MJ, Cobb MH (1997) Mitogen-activated protein kinase pathways. Curr Opin Cell Biol 9: 180-186 [CrossRef][Web of Science][Medline]
  • Romeis T, Piedras P, Zhang S, Klessig D, Hirt H, Jones JDG (1999) Rapid Avr9- and Cf-9-dependent activation of MAP kinases in tobacco cell cultures and leaves: convergence of resistance gene, elicitor, wound, and salicylate responses. Plant Cell 11: 273-287 [Abstract/Free Full Text]
  • Scott A, Haystead CMM, Haystead TAJ (1995) Purification of a 12,020-dalton protein that enhances the activation of mitogen-activated protein (MAP) kinase by MAP kinase kinase. J Biol Chem 270: 24540-24547 [Abstract/Free Full Text]
  • Seger R, Ahn NG, Boulton TG, Yancopoulos GD, Panayotatos N, Radziejewska E, Ericsson L, Bratlien RL, Cobb MH, Krebs EG (1991) Microtubule-associated protein kinases, ERK1 and ERK2, undergo autophosphorylation on both tyrosine and threonine residues: implications for their mechanism of activation. Proc Natl Acad Sci USA 88: 6142-6146 [Abstract/Free Full Text]
  • Seger R, Ahn NG, Posada J, Munar ES, Jensen AM, Cooper JA, Cobb MH, Krebs EG (1992) Purification and characterization of mitogen-activated protein kinase activator(s) from epidermal growth factor-stimulated A431 cells. J Biol Chem 267: 14373-14381 [Abstract/Free Full Text]
  • Seger R, Krebs EG (1995) The MAPK signaling cascade. FASEB J 9: 726-735 [Abstract]
  • Seo S, Okamoto M, Seto H, Ishizuka K, Sano H, Ohashi Y (1995) Tobacco MAP kinase: a possible mediator in wound signal transduction pathways. Science 270: 1988-1992 [Abstract/Free Full Text]
  • Seo S, Sano H, Ohashi Y (1999) Jasmonate-based wound signal transduction requires activation of WIPK, a tobacco mitogen-activated protein kinase. Plant Cell 11: 289-298 [Abstract/Free Full Text]
  • Shibata W, Banno H, Ito Y, Hirano K, Irie K, Usami S, Machida C, Machida Y (1995) A tobacco protein kinase, NPK2, has a domain homologous to a domain found in activators of mitogen-activated protein kinases (MAPKKs). Mol Gen Genet 246: 401-410 [CrossRef][Web of Science][Medline]
  • Stratmann JW, Ryan CA (1997) Myelin basic protein kinase activity in tomato leaves is induced systemically by wounding and increases in response to systemin and oligosaccharide elicitors. Proc Natl Acad Sci USA 94: 11085-11089 [Abstract/Free Full Text]
  • Suzuki K, Shinshi H (1995) Transient activation and tyrosine phosphorylation of a protein kinase in tobacco cells treated with a fungal elicitor. Plant Cell 7: 639-647 [Abstract]
  • Taylor CC (1989) cAMP-dependent protein kinase: model for an enzyme family. J Biol Chem 264: 8443-8446 [Free Full Text]
  • Usami S, Banno H, Ito Y, Nishihama R, Machida Y (1995) Cutting activates a 46-kilodalton protein kinase in plants. Proc Natl Acad Sci USA 92: 8660-8664 [Abstract/Free Full Text]
  • Vogel J, Woeste K, Theologis A, Kieber JJ (1998) Recessive and dominant mutations in the ethylene biosynthetic gene ACS5 of Arabidopsis confer cytokinin insensitivity and ethylene overproduction, respectively. Proc Natl Acad Sci USA 95: 4766-4771 [Abstract/Free Full Text]
  • Wu J, Rossomando AJ, Her J-H, Del Vecchio R, Weber MJ, Sturgill TW (1991) Autophosphorylation in vitro of recombinant 42-kilodalton mitogen-activated protein kinase on tyrosine. Proc Natl Acad Sci USA 88: 9508-9512 [Abstract/Free Full Text]
  • Xu Q, Fu H, Gupta R, Luan S (1998) Molecular characterization of a tyrosine-specific protein phosphatase encoded by a stress-responsive gene in Arabidopsis. Plant Cell 10: 849-857 [Abstract/Free Full Text]
  • Young PR, McLaughlin MM, Kumar S, Kassis S, Doyle ML, McNulty D, Gallagher TF, Fisher S, McDonnell PC, Carr SA, Huddleston MJ, Seibel G, Porter TG, Livi GP, Adams JL, Lee JC (1997) Pyridinyl imidazole inhibitiors of p38 mitogen-activated protein kinase bind in the ATP site. J Biol Chem 272: 12116-12121 [Abstract/Free Full Text]
  • Zhang S, Du H, Klessig DF (1998) Activation of the tobacco SIP kinase by both a cell wall-derived carbohydrate elicitor and purified proteinaceous elicitins from Phytophthora spp. Plant Cell 10: 435-449 [Abstract/Free Full Text]
  • Zhang S, Klessig DF (1997) Salicylic acid activates a 48-kD MAP kinase in tobacco. Plant Cell 9: 809-824 [Abstract]
  • Zhang S, Klessig DF (1998) The tobacco wounding-activated mitogen-activated protein kinase is encoded by SIPK. Proc Natl Acad Sci USA 95: 7225-7230 [Abstract/Free Full Text]
© 2000 American Society of Plant Physiologists



This article has been cited by other articles:


Home page
Plant CellHome page
S. Bartels, J. C. Anderson, M. A. Gonzalez Besteiro, A. Carreri, H. Hirt, A. Buchala, J.-P. Metraux, S. C. Peck, and R. Ulm
MAP KINASE PHOSPHATASE1 and PROTEIN TYROSINE PHOSPHATASE1 Are Repressors of Salicylic Acid Synthesis and SNC1-Mediated Responses in Arabidopsis
PLANT CELL, September 1, 2009; 21(9): 2884 - 2897.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
J.-L. Qiu, L. Zhou, B.-W. Yun, H. B. Nielsen, B. K. Fiil, K. Petersen, J. MacKinlay, G. J. Loake, J. Mundy, and P. C. Morris
Arabidopsis Mitogen-Activated Protein Kinase Kinases MKK1 and MKK2 Have Overlapping Functions in Defense Signaling Mediated by MEKK1, MPK4, and MKS1
Plant Physiology, September 1, 2008; 148(1): 212 - 222.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
R. Doczi, G. Brader, A. Pettko-Szandtner, I. Rajh, A. Djamei, A. Pitzschke, M. Teige, and H. Hirt
The Arabidopsis Mitogen-Activated Protein Kinase Kinase MKK3 Is Upstream of Group C Mitogen-Activated Protein Kinases and Participates in Pathogen Signaling
PLANT CELL, October 1, 2007; 19(10): 3266 - 3279.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
Y. Xing, W. Jia, and J. Zhang
AtMEK1 mediates stress-induced gene expression of CAT1 catalase by triggering H2O2 production in Arabidopsis
J. Exp. Bot., August 28, 2007; (2007) erm144v1.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
F. Takahashi, R. Yoshida, K. Ichimura, T. Mizoguchi, S. Seo, M. Yonezawa, K. Maruyama, K. Yamaguchi-Shinozaki, and K. Shinozaki
The Mitogen-Activated Protein Kinase Cascade MKK3-MPK6 Is an Important Part of the Jasmonate Signal Transduction Pathway in Arabidopsis
PLANT CELL, March 1, 2007; 19(3): 805 - 818.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
K. Gomi, D. Ogawa, S. Katou, H. Kamada, N. Nakajima, H. Saji, T. Soyano, M. Sasabe, Y. Machida, I. Mitsuhara, et al.
A Mitogen-activated Protein Kinase NtMPK4 Activated by SIPKK is Required for Jasmonic Acid Signaling and Involved in Ozone Tolerance via Stomatal Movement in Tobacco
Plant Cell Physiol., December 1, 2005; 46(12): 1902 - 1914.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Katou, E. Karita, H. Yamakawa, S. Seo, I. Mitsuhara, K. Kuchitsu, and Y. Ohashi
Catalytic Activation of the Plant MAPK Phosphatase NtMKP1 by Its Physiological Substrate Salicylic Acid-induced Protein Kinase but Not by Calmodulins
J. Biol. Chem., November 25, 2005; 280(47): 39569 - 39581.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
Y.-K. Yap, Y. Kodama, F. Waller, K. M. Chung, H. Ueda, K. Nakamura, M. Oldsen, H. Yoda, Y. Yamaguchi, and H. Sano
Activation of a Novel Transcription Factor through Phosphorylation by WIPK, a Wound-Induced Mitogen-Activated Protein Kinase in Tobacco Plants
Plant Physiology, September 1, 2005; 139(1): 127 - 137.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. Boudsocq and C. Lauriere
Osmotic Signaling in Plants. Multiple Pathways Mediated by Emerging Kinase Families
Plant Physiology, July 1, 2005; 138(3): 1185 - 1194.
[Full Text] [PDF]


Home page
Crop Sci.Home page
V. Chinnusamy, A. Jagendorf, and J.-K. Zhu
Understanding and Improving Salt Tolerance in Plants
Crop Sci., January 31, 2005; 45(2): 437 - 448.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Boudsocq, H. Barbier-Brygoo, and C. Lauriere
Identification of Nine Sucrose Nonfermenting 1-related Protein Kinases 2 Activated by Hyperosmotic and Saline Stresses in Arabidopsis thaliana
J. Biol. Chem., October 1, 2004; 279(40): 41758 - 41766.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Lee, J. J. Rudd, V. K. Macioszek, and D. Scheel
Dynamic Changes in the Localization of MAPK Cascade Components Controlling Pathogenesis-related (PR) Gene Expression during Innate Immunity in Parsley
J. Biol. Chem., May 21, 2004; 279(21): 22440 - 22448.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Mayrose, A. Bonshtien, and G. Sessa
LeMPK3 Is a Mitogen-activated Protein Kinase with Dual Specificity Induced during Tomato Defense and Wounding Responses
J. Biol. Chem., April 9, 2004; 279(15): 14819 - 14827.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
F. L.H. Menke, J. A. van Pelt, C. M.J. Pieterse, and D. F. Klessig
Silencing of the Mitogen-Activated Protein Kinase MPK6 Compromises Disease Resistance in Arabidopsis
PLANT CELL, April 1, 2004; 16(4): 897 - 907.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
V. Chinnusamy, K. Schumaker, and J.-K. Zhu
Molecular genetic perspectives on cross-talk and specificity in abiotic stress signalling in plants
J. Exp. Bot., January 2, 2004; 55(395): 225 - 236.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
R. Gupta and S. Luan
Redox Control of Protein Tyrosine Phosphatases and Mitogen-Activated Protein Kinases in Plants
Plant Physiology, July 1, 2003; 132(3): 1149 - 1152.
[Full Text] [PDF]


Home page
Plant CellHome page
L. Xiong and Y. Yang
Disease Resistance and Abiotic Stress Tolerance in Rice Are Inversely Modulated by an Abscisic Acid-Inducible Mitogen-Activated Protein Kinase
PLANT CELL, March 1, 2003; 15(3): 745 - 759.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
R. Gupta, J. T. L. Ting, L. N. Sokolov, S. A. Johnson, and S. Luan
A Tumor Suppressor Homolog, AtPTEN1, Is Essential for Pollen Development in Arabidopsis
PLANT CELL, October 1, 2002; 14(10): 2495 - 2507.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Luan
Tyrosine phosphorylation in plant cell signaling
PNAS, September 3, 2002; 99(18): 11567 - 11569.
[Full Text] [PDF]


Home page
Plant CellHome page
S. Zhang and Y. Liu
Activation of Salicylic Acid-Induced Protein Kinase, a Mitogen-Activated Protein Kinase, Induces Multiple Defense Responses in Tobacco
PLANT CELL, August 1, 2001; 13(8): 1877 - 1889.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
R. Desikan, J. T. Hancock, K. Ichimura, K. Shinozaki, and S. J. Neill
Harpin Induces Activation of the Arabidopsis Mitogen-Activated Protein Kinases AtMPK4 and AtMPK6
Plant Physiology, August 1, 2001; 126(4): 1579 - 1587.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
R. Ulm, E. Revenkova, G.-P. di Sansebastiano, N. Bechtold, and J. Paszkowski
Mitogen-activated protein kinase phosphatase is required for genotoxic stress relief in Arabidopsis
Genes & Dev., March 15, 2001; 15(6): 699 - 709.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. F. Bent
Plant mitogen-activated protein kinase cascades: Negative regulatory roles turn out positive
PNAS, January 30, 2001; 98(3): 784 - 786.
[Full Text] [PDF]


Home page
Plant CellHome page
S. Kiegerl, F. Cardinale, C. Siligan, A. Gross, E. Baudouin, A. Liwosz, S. Eklöf, S. Till, L. Bögre, H. Hirt, et al.
SIMKK, a Mitogen-Activated Protein Kinase (MAPK) Kinase, Is a Specific Activator of the Salt Stress-Induced MAPK, SIMK
PLANT CELL, November 1, 2000; 12(11): 2247 - 2258.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
O. Calderini, N. Glab, C. Bergounioux, E. Heberle-Bors, and C. Wilson
A Novel Tobacco Mitogen-activated Protein (MAP) Kinase Kinase, NtMEK1, Activates the Cell Cycle-regulated p43Ntf6 MAP Kinase
J. Biol. Chem., May 18, 2001; 276(21): 18139 - 18145.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (63)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, Y.
Right arrow Articles by Kieber, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, Y.
Right arrow Articles by Kieber, J. J.
Agricola
Right arrow Articles by Huang, Y.
Right arrow Articles by Kieber, J. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2000 by the American Society of Plant Biologists