|
Plant Physiol, June 2000, Vol. 123, pp. 463-470
Subcellular Localization of Expansin mRNA in Xylem
Cells1,2
Kyung-Hoan
Im,
Daniel J.
Cosgrove, and
Alan M.
Jones*
Department of Biology, The University of North Carolina, Chapel
Hill, North Carolina 27599-3280 (K.-H.I., A.M.J.); and Department
of Biology, 208 Mueller Laboratory, The Pennsylvania State University,
University Park, Pennsylvania 16802 (D.J.C.)
 |
ABSTRACT |
Terminal differentiation of many
vascular cells involves cell wall changes. Cells first elongate their
primary wall, then lay down a lignified secondary wall, which is often
followed by digestion of the primary wall. Expansins are wall proteins
that regulate wall changes, but little is known about the specific functions of the many individual expansin isoforms. An in vitro cell
culture of synchronously differentiating tracheary elements was used to
identify three new expansins and to compare their expression kinetics
with the timing of wall changes. The genes encoding these expansins
from zinnia (Zinnia elegans), designated ZeExp1, ZeExp2, ZeExp3,
are expressed during cell elongation. ZeExp1 and
ZeExp2 mRNA decrease at the early stage of secondary wall formation, whereas ZeExp3 does not. In planta, all
three ZeExp mRNAs are found predominantly in a single
flank of cells adjacent to protoxylem and metaxylem vessels and in
cells roughly at the radial position of the fasicular and
interfasicular cambium. Furthermore, within these cells,
Exp mRNA is localized exclusively either to the apical
or basipetal end of cells depending on the expansin gene and organ,
providing the first evidence for polar localization of mRNA in plant
cells. ZeExp1 and ZeExp3 mRNA are localized at the apical tip, whereas ZeExp2 mRNA is
found in the basal tip. These observations indicate that these three
expansins are xylem cell specific and possibly involved in the
intrusive growth of the primary walls of differentiating xylem cells.
 |
INTRODUCTION |
Plant cells expand by controlling
slippage of the wall network of microfibrils and adhering matrix
polysaccharides and proteins (Cosgrove, 1993 ). A family of cell wall
proteins called -expansins are wall-loosening factors that can
promote extension of isolated cell wall, probably by
disrupting noncovalent bonds between the cellulose
microfibrils and matrix polymers (McQueen-Mason and Cosgrove, 1994 ;
McQueen-Mason, 1995 ; Cosgrove, 1998 ). The -expansins are represented
by a large gene family (Cosgrove, 1998 , 1999 ), suggesting that they
serve various functions throughout development. A ripening-related
expansin in tomato fruit may enhance accessibility of noncovalently
bound polymers to endogenous enzyme action during ripening (Rose et
al., 1997 ). It has also been proposed that -expansins are involved
in leaf organogenesis (Fleming et al., 1997 ; Reinhardt et al., 1998 )
and vascular cell differentiation (Cho and Kende, 1998 ), but otherwise
little is known about the specific role of the individual expansins.
Tracheary elements (TEs) are functional cell corpses that form the
water-conducting vessels in plant xylem. During normal stem
development, primary TEs develop from meristematic cells of procambial
cells, then later by fascicular and interfascicular cambial cells
(Shininger, 1979 ). Prior to secondary wall formation, procambium cells
first expand primarily along the longitudinal axis by intrusive growth
(Bannan, 1956 ; Roberts and Uhnak, 1998 ). In this type of cell extension
found among different xylem cell types, the wall matrix in the apical
regions of the cell shears. Since these apical regions do not attenuate
during growth, wall precursors and growth-limiting proteins must also
be directed to the cell wall-growing zone, probably by longitudinal microtubules.
 |
RESULTS |
Three -expansin cDNA clones (ZeExp1,
ZeExp2, and ZeExp3) were isolated from a cDNA
library constructed from zinnia (Zinnia elegans) cell
culture induced for TEs for 48 h (Ye and Varner, 1993 ) using a mix
of Arabidopsis Exp1 and Exp9 probes.
The three cDNA sequences were compared with the Arabidopsis
Exp1 sequence using the CLUSTAL W algorithm (Thompson et
al., 1994 ). The 949-bp ZeExp1 cDNA represents a partial
sequence lacking a signal peptide of presumably 25 to 28 amino-terminal peptides (Fig. 1), but
contained a 337-bp 3'-untranslated region (UTR). The 1,088-bp
ZeExp2 contained a 5'-UTR of 15 bp, an open reading frame of
738 bp, and a 3'-UTR of 335 bp. The 1,054-bp ZeExp3
contained a 5'-UTR of 23 bp, an open reading frame of 729 bp, and a
3'-UTR of 302 bp. The deduced polypeptides of ZeExp2 and
ZeExp3 were 242 and 245 amino acids, respectively, and each
polypeptide possessed the conserved Cys and Trp residues that are
characteristic of expansins (Shcherban et al., 1995 ). The deduced
mature proteins of zinnia expansins fell into three of the five major
phylogenetic branches for -expansins (Fig.
2). ZeExp1 aligned into a clade
with LeExp18, which is expressed in the meristem (Reinhardt et al.,
1998 ), and LeExp1, whose expression is preferentially induced during
the ripening process in tomato fruit (Rose et al., 1997 ). ZeExp2
aligned with PaExp1 cloned from apricot fruit. ZeExp3 fell into a group
containing AtExp1, which is expressed in guard cells (D.J.
Cosgrove, unpublished data).

View larger version (71K):
[in this window]
[in a new window]
|
Figure 1.
Amino acid sequence alignment of three new zinnia
expansins. The deduced amino acid sequence alignments for zinnia
expansins are compared with the Arabidopsis expansin 1 (AtExp1) using
the CLUSTAL W algorithm (Thompson et al., 1994 ). Identical amino acids
are marked with asterisks. Dashes represent gaps that were used to
facilitate alignment. Eight Cys residues (+) and four Trp residues
( ) conserved among expansins are indicated. Putative signal peptides
are shown in lowercase. Accession numbers for ZeExp1,
ZeExp2, and ZeExp3 are AF230331, AF230332, and
AF230333, respectively.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
Figure 2.
Phylogenetic tree of 32 -expansin protein
sequences. Numbers on the tree indicate bootstrap P values.
Large letters denote the subfamily groupings previously identified
(Link and Cosgrove, 1998 ). This tree was rooted using LeExp3
(Lycopersicon esculentum). Sequences and GenBank accession
numbers: AtExp1 (U30476), AtExp2 (U30481), AtExp3 (AC004684), AtExp4
(AC003674), AtExp5 (U30478), AtExp6 (U30480), AtExp8 (AC002336); LeExp1
(U82123), LeExp2 (AF096776), LeExp3 (AF059487), LeExp4 (AF059488),
LeExp5 (AF059489), and LeExp18 (AJ004997); Nt (Nicotiana
tabacum) Exp1 (AF049350), NtExp2 (AF049351), NtExp3 (AF049352),
NtExp4 (AF049353), and NtExp5 (AF049354); Os (Oryza sativa)
Exp1 (Y07782), OsExp2 (U30477), OsExp3 (U30479), and OsExp4 (U85246);
Ps (Pisum sativa) Exp1 (X85187); Bn (Brassica
napus) Exp1 (AJ000885); Cs (Cucumis sativus) Exp1
(U30382), and CsExp2 (U30460); Pa (Prunus
armeniaca) Exp1 (U93167) and PaExp2 (AF038815). The 21- and
19-amino acid signal peptides were predicted for the ZeExp2
and ZeExp3, respectively, by the method of von Heijne
(1986) . Mature proteins were aligned with the CLUSTAL algorithm, and
-corrected distances between amino acid sequences were used to
construct this tree by nearest-neighboring joining using the MEGA
program (Kumar et al., 1993 ).
|
|
Zinnia expansins belong to a multigene family, as is the case for
other plant species, suggesting that expansin isoforms have either
specialized functions or cell specificity. The complexity of expansin
genes in zinnia was estimated using genomic Southern-blot analysis with
a mixture of full-length ZeExp2 and ZeExp3 cDNA probes. After high-stringency washes, two or three bands were detected
(data not shown). The single major band in each lane represents the
ZeExp3 gene, and two minor bands in each lane represent the
ZeExp2 gene because of known internal EcoRI and
HindIII restriction sites. We conclude that each of these
genes is probably present in the genome as a single copy. After
low-stringency washes, multiple bands were detected, indicating that,
as in all other tested species, expansins form a multigene family in zinnia.
Expression of Expansin Genes during TE Development
The in vitro system we utilize here to address the role of
expansin recapitulates the cellular events of TE differentiation (Seagull and Falconer, 1991 ). Mesophyll cells were mechanically isolated and induced with auxin and cytokinin to differentiate synchronously into TEs in vitro. After a latent period of approximately 24 h, cells elongate and expand for approximately 24 to 48 h, and then begin to synthesize the secondary cell wall beginning at
72 h, as evident by wall thickening (Fig.
3A). After wall synthesis is complete,
developing TEs undergo a programmed cell death (Groover and Jones,
1999 ) that involves further wall changes such as formation of the
perforation plate.

View larger version (50K):
[in this window]
[in a new window]
|
Figure 3.
Expression of three expansin genes during TE
induction in zinnia cell culture compared with cell growth. A, Zinnia
cells induced to differentiate into TEs were photographed at the
indicated times and average lengths ( ) and areas ( ) determined.
The average SE of the mean for cell length and
area were 1.8 µm and 57 µm2, respectively.
SCW, Secondary cell wall. B, Total RNAs were extracted from cells
cultured in TE inductive medium at the indicated times. Total RNA (10 µg) was loaded in each lane and hybridized with gene-specific probes.
Numbers above blots indicate the duration of mesophyll cells in
inductive medium. The same blot was hybridized with Arabidopsis 18S
rRNA probe to check for loading variability.
|
|
Expression of the expansin genes was correlated with primary wall
expansion and elongation during TE development in vitro. The expression
level of all three expansin genes increased after 24 h of
inductive levels of hormones; however, the decay patterns were
different among the three genes (Fig. 3B). The ZeExp1
expression level did not change from 24 h until 48 h, and
decreased moderately at 72 h, a time when secondary cell wall
thickenings are detectable by microscopy (Groover et al., 1997 ; Fig.
3A). ZeExp2 showed a similar expression pattern to that of
ZeExp1 until 48 h, however, the mRNA level decreased to
nearly the basal level after 72 h of induction. ZeExp3
mRNA remained constant.
Expression of Expansin Genes in Planta
Northern analyses revealed that three expansin mRNAs approximately
1,200 nt in length were expressed in stem tissue and barely detectable
in cotyledon and leaf tissues (Fig. 4B).
A significant level of ZeExp1 but not ZeExp2 or
ZeExp3 mRNA was also detected in roots (Fig. 4B).

View larger version (42K):
[in this window]
[in a new window]
|
Figure 4.
Expression of expansin genes in various organs in
zinnia seedlings. A, Ten-day-old zinnia seedling showing the regions
used for northern analysis shown in B. 1, Cotyledons without petioles;
2, leaves; 3, upper part of stems; 4, lower part of stems; 5, roots. B,
ZeExp1, ZeExp2, and ZeExp3 northern
blots showing tissue-specific expression.
|
|
Cell-Specific Expression and Intracellular Localization of
Expansin Transcripts
In situ hybridization was used to identify expansin-expressing
cells in stem tissues (Figs. 5 and
6). Transverse sections probed with sense
control RNAs (Fig. 5B) lacked hybridization signal; however, all three
expansin mRNAs were detected at the same subtissue location by
antisense probes (Fig. 5A, data for ZeExp2 and
ZeExp3 not shown). Expansin mRNA signals were confined to
the developing primary xylem cells, predominantly adjacent to vessel
members, and in cells at the future position of the interfasicular
cambium. Surprisingly, the hybridization signals routinely appeared
punctate (arrows in Fig. 5A). Serial transverse sections revealed that
these punctate signals were at most 16 µm in depth (data not shown),
suggesting that these expansin mRNAs are highly localized at the
specific sites. In situ hybridization of longitudinal sections
confirmed the size and punctate shape of the hybridization signals. The
single flank of elongated cells adjacent to protoxylem or metaxylem
vessels showed strong hybridization of the ZeExp riboprobes
(Fig. 5, C and E), but occasionally nonadjacent cells located 50 to 100 µm from vessel members also showed clear hybridization.

View larger version (144K):
[in this window]
[in a new window]
|
Figure 5.
In situ localization of ZeExp1 and
ZeExp2 mRNA in zinnia stem tissues. A, Cross-section of
the upper stem probed with the antisense (A) and sense (B)
ZeExp1 3'-UTR RNA. Arrows indicate some of the punctate
patterned hybridization signals. Note that the signals are found
exclusively in the vascular bundles (two bundles are highlighted by
asterisks) and in cells near where the interfascicular cambium forms.
Longitudinal sections of the upper stem were probed with the antisense
(C) and sense (D) ZeExp1 3'-UTR RNA and the antisense
ZeExp2 3'-UTR RNA (E). Arrows indicate the apical (C) and
basal (E) location of the punctate hybridization signals. Note that the
indicated flank of cells in (C) and (E) appear to begin tip growth from
the apical corners. Longitudinal sections probed with the zinnia
Ted3 (F) and 18S rRNA (G) antisense probes, respectively, indicate
an even hybridization signal in cells associated with the protoxylem
(F) or all cells (G). A and B, Bars = 100 µm; C to G, bars = 50 µm.
|
|

View larger version (170K):
[in this window]
[in a new window]
|
Figure 6.
Relative location of expansin mRNA signal and the
nucleus in a single cell. Longitudinal section in situ hybridized with
the ZeExp3 antisense probe was stained with DAPI to
visualize the nucleus under UV light (B). The section was observed
under a combination of white and UV light (A) and UV light only (B).
Note that the position of the localized expansin transcript indicated
by arrows does not colocalize with the position of the nucleus
indicated by brackets. Bar = 50 µm.
|
|
In all cases, hybridization signals were exclusively located at the
distal ends of cells (Fig. 5, C and E), but the apical versus basal
location was dependent on the riboprobe used and the tissue. Medial
sections through the base of the cotyledonary petiole revealed
ZeExp1, ZeExp2, and ZeExp3 mRNA at the
cell base. In contrast, at a position just below the apical
meristem where protoxylem differentiates, ZeExp1 and
ZeExp3 mRNAs were found in the apical cytoplasm, while
ZeExp2 mRNA was found in the basal cytoplasm (Table
I; Fig. 5, C and E). More precisely,
hybridization signal was found in a distal corner of the cells flanking
the vessels (Fig. 5E), in each case where intrusive growth appeared to
occur (note carefully the elongated corners of the cells in the
indicated flanks in Fig. 5, C and E).
Several lines of evidence showed that the punctate pattern of
ZeExp mRNA hybridization is not an artifact but, rather, is evidence of the cytoplasmic location of the ZeExp message.
First, only xylem cells hybridized with ZeExp antisense
probes (Fig. 5, A-E), so the pattern was not due to probe aggregation.
Second, an 18S rRNA revealed a relatively diffuse cytoplasmic staining even in the xylem cells, where ZeExp probes hybridize in the
punctate pattern, indicating that fixation artifacts did not cause
cytoplasmic aggregation in these particular cells (Fig. 5G). Third, a
TED3 probe, previously shown to hybridize to xylem cells (Demura and Fukuda, 1994 ), had a hybridization signal that was evenly distributed throughout the cytoplasm (Fig. 5F) in the same cell types in which expansin mRNA hybridization was shown to be punctate. Fourth, the
punctate pattern was not due to nuclear sequestration of the ZeExp message (Fig. 6).
The strongest evidence that the punctate hybridization signals are not
due to fixation artifacts comes from the observation that the
ZeExp1 and ZeExp3 hybridization patterns were
apical, whereas for ZeExp2 they were basal in the same cell
types from the same fixed tissue (Fig. 5, C versus E). Clearly,
fixation or hybridization artifacts cannot explain the sequence
specificity of this opposite localization.
 |
DISCUSSION |
We introduce three new members of a large gene family of
expansins, and indirectly show that they play a specific developmental role in shoot histogenesis. These expansin genes are expressed in
developing TEs in vitro, with kinetics and expression patterns linking
the function to the regulation of primary wall expansion of
xylem-specific cells. In planta, expression of these genes is limited
to a specific set of xylem cells.
Several xylem cell types elongate by intrusive growth (Bannan, 1956 ;
Roberts and Uhnak, 1998 ), whereby wall matrix slips and wall precursors
are delivered to these localized regions of the wall by direct
secretion through the endomembrane system. However, loosening of the
existing wall at the localized site must precede or accompany wall
deposition before intrusive growth can ensue. Given what is known about
the biochemical properties of expansins, it is reasonable to presume
that this loosening is accomplished by the action of expansins. In situ
hybridization clearly indicates that expansin mRNA is located
exclusively at the end of the cytoplasm in a cell type that appears
poised to elongate by intrusive growth. We propose that these expansin
mRNAs are subcellularly localized to the site of future growth so as to
provide restricted wall loosening by expansins produced there.
The identity and fate of the flanking cells showing localized expansin
mRNA is not known with certainty. While their morphology points to
their being fully differentiated xylem parenchyma and not precursors to
vessel members, their tissue location and signs of intrusive growth
(Fig. 5E) suggest they may transdifferentiate into fibers.
Asymmetric RNA localization is well documented in animal cells and
invertebrates (Bashirullah et al., 1998 ), where this mechanism accounts
for asymmetric distribution of proteins in polarized somatic cells and
embryos. Fewer cases are found in lower organisms, although there is
one example each for localized mRNA in yeast (Takizawa et al., 1997 )
and a brown algae (Bouget et al., 1996 ). However, the work here
presents the first evidence, to our knowledge, for mRNA localization in
land plants (Embryophyta).
RNA localization requires an intact cytoskeleton (Oleynikov and Singer,
1998 ), and 3'-UTR of localized mRNA plays an important role in RNA
localization (Kimberly et al., 1992 ; Goldspink et al., 1997 ). It has
been reported that almost one-tenth of randomly collected
Drosophila ovarian mRNA shows asymmetric localization (Dubowy and Macdonald, 1998 ). The function of RNA localization may
prevent random movement of RNA within the cytoplasm and bring it into
contact with regulatory factors (Bassell and Singer, 1997 ). In the case
of mRNA encoding co-translated proteins such as the expansins described
here, targeting message to specific microdomains on the endoplasmic
reticulum may be involved in directed trafficking of the secreted
protein (Weeks and Melton, 1987 ).
Longitudinally oriented microtubules may direct expansin mRNA to a
specific intracellular location, where expansin mRNA is translated and
secreted to the growing or neighboring cell wall to cause localized
cell wall loosening, although expansin protein was not localized in the
present study. A previous notion was that microtubules direct
transverse deposition of cellulose microfibrils (Fukuda, 1996 ), but
this is not supported by the recent evidence that cortical microtubules
are actually oriented parallel to the long axis of elongating cells
during TE differentiation, and that overall cell elongation is caused
by localized intrusive growth of cells (Roberts and Uhnak, 1998 ).
Parallel orientation of microtubules in these cells is consistent with
a role of apical trafficking of mRNA and wall precursors. In light of
the current evidence for tip-localized expansin mRNA and the known role
for microtubules in mRNA trafficking (Bassell and Singer, 1997 ), we
propose that the seemingly paradoxical longitudinal distribution of
microtubules in elongating TE occurs to direct growth-limiting
expansins to the cell tip rather than to direct cellulose deposition.
 |
MATERIALS AND METHODS |
Plant Material and Culture Media
Zinnia (Zinnia elegans L. cv Envy) was purchased
from Stokes Seed (Buffalo, NY). Plants were grown in a growth chamber
at 25°C with 14 h of light (110 µmol photons m 2
s 2) and 60% relative humidity. Mesophyll cells of 8- to
16-d-old seedlings were isolated and cultured as described in Groover
et al. (1997) . Cells were cultured in inductive medium as described by
Fukuda and Komamine (1980) with 0.1 mg/L -naphthalene-acetic acid
and 0.2 mg/L 6-benzylamino-purine.
Isolation and Sequencing of cDNA Clones
The zinnia cDNA library, provided by Dr. Z-H Ye (University of
Georgia), was constructed from leaf mesophyll cells cultured for
48 h in TE induction medium (Ye and Varner, 1993 ). The library was
screened with a mixture of 32P-labeled full-length
AtExp1 and AtExp9 cDNAs at 60°C,
followed by two 60°C 1× SSC washes. Three independent cDNA phage
clones were subcloned into pBluescript II KS+ phagemid vectors
(Stratagene, La Jolla, CA), and sequenced by the Automated DNA
Sequencing Facility at The University of North Carolina at Chapel Hill.
Genomic DNA Extraction and Southern-Blot Analyses
Genomic DNA was isolated from 10-d-old seedlings as
described previously (Dellaporta et al., 1983 ). Ten micrograms of
genomic DNA was digested with EcoRI and
HindIII and fractionated in a 0.6% (w/v) agarose
gel, followed by a Southern transfer to a Nytran membrane (Schleicher & Schuell, Keene, NH). The blots were hybridized with a mixture of
full-length ZeExp2 and ZeExp3 cDNA probes
in 50 mM PIPES (1,4-piperazinediethanesulfonic acid) (pH
6.5), 100 mM NaCl, 50 mM sodium phosphate, 1 mM EDTA, and 5% (w/v) SDS solution for 16 h at
65°C, and then washed. The first two washes in 5× SSC/5%
(w/v) SDS at 65°C were followed by two more washes in 2× SSC/5% (w/v) SDS for low stringency and 0.2× SSC/5%
(w/v) SDS for high stringency, respectively.
Northern Analyses
Ten-day-old green seedlings were dissected into cotyledon, leaf,
upper stem half, lower stem half, and root (Fig. 4A). Total RNA was
isolated from each organ and cells in culture as described previously
(Wadsworth et al., 1988 ). RNA (10 µg) was fractionated on 1.2%
(w/v) agarose gels in the presence of 3% (w/v)
formaldehyde and transferred to Nytran membrane. Hybridization and
washing were as described in Southern-blot analyses, with final washes in 0.2× SSC/5% (w/v) SDS. Gene-specific DNA fragments were
prepared by PCR amplification from cDNA clones. For the
ZeExp1-specific probe, the 340 bp of 3'-UTR was PCR
amplified using oligonucleotides 5'CCCGGGAATTCGAGTGTAAAACATGAT3' and
5'TTTTTTTGGATCCAAAATCAATCCATT3' as forward and reverse primers,
respectively. For the ZeExp2-specific probe, the 293-bp
3' end was subcloned into EcoRI site of pBS KS phagemid
and subsequently PCR amplified using SK and KS primers. For the
ZeExp3-specific probe, the 293-bp 3' region was PCR
amplified with forward primer (5'AAGCACATCTATGTTCT3') and reverse
primer (SK). Probes were prepared by 32P labeling using a
random primer kit (Boehringer Mannheim/Roche, Basel).
In Situ Hybridization
In situ hybridization was performed as described previously (Cho
and Kende, 1998 ) except higher concentrations of RNaseA (5-10 µg/mL)
were used. Hybridization of the riboprobes was detected with
anti-digoxigenin antibodies conjugated to alkaline phosphatase, and
visualized by color development according to the manufacturer's instructions (Boehringer Mannheim/Roche). Sense and antisense ZeExp1- and ZeExp2-specific riboprobes
were generated by in vitro transcription of the subcloned 3'-UTR using
a digoxigenin labeling kit (Boehringer Mannheim/Roche). The antisense
ZeExp3-specific, 300-bp riboprobe was prepared by
transcription of a Nar1 restriction of the full-length
ZeExp3 clone. All probes were prepared from 3'-UTR
except the ZeExp3 sense probe, which was generated from the full-length cDNA. Probes were hydrolyzed to 100 nt by alkaline hydrolysis prior to hybridization. Each hybridization with a specific sense or antisense probe was performed at least four times, with the
same results. To stain nuclei, 4', 6-diamidino-2-phenyl-indole diacetate (DAPI) was dissolved in water at 1 mg/mL and used at a
working concentration of 0.05 mg/mL.
 |
ACKNOWLEDGMENTS |
We thank Sabine Hardenack for helpful discussion on in situ
hybridization, Jheng-Hua Ye for the cDNA library, Andrew Groover for
technical assistance, W. Soh, W.C. Dickison, and J. Romberger for
discussions on primary xylem, and Susan Whitfield for help with
figures. Daniel M. Durachko assisted with preliminary experiments.
 |
FOOTNOTES |
Received November 17, 1999; accepted February 11, 2000.
1
This work was supported by the Department of
Energy (grant no. DE-FG02-93ER13179 to D.J.C.), by the National
Science Foundation (grant no. IBN-9807801 to A.M.J.), and by the U.S.
Department of Agriculture.
2
This paper is dedicated to and in memory of
Prof. William C. Dickison.
*
Corresponding author; e-mail alan-jones{at}unc.edu; fax
919-962-1625.
 |
LITERATURE CITED |
-
Bannan MW
(1956)
Some aspect of the elongation of fusiform cambial cells in Thuza occidentalis.
Can J Bot
34: 175-196
-
Bashirullah A, Cooperstock RL, Lipshitz HD
(1998)
RNA localization in development.
Annu Rev Biochem
67: 335-394
[CrossRef][Web of Science][Medline]
-
Bassell G, Singer RH
(1997)
mRNA and cytoskeletal filaments.
Curr Opin Cell Biol
9: 109-115
[CrossRef][Web of Science][Medline]
-
Bouget F, Gerttula S, Shaw SL, Quatrano RS
(1996)
Localization of actin mRNA during the establishment of cell polarity and early cell division in Fucus embryo.
Plant Cell
8: 189-201
[Abstract]
-
Cho HT, Kende H
(1998)
Tissue localization of expansins in deepwater rice.
Plant J
15: 805-812
[CrossRef][Web of Science][Medline]
-
Cosgrove DJ
(1993)
Wall extensibility: its nature, measurement, and relationship to plant cell growth.
New Phytol
124: 1-23
[CrossRef][Web of Science][Medline]
-
Cosgrove DJ
(1998)
Cell wall loosening by expansins.
Plant Physiol
118: 333-339
[Free Full Text]
-
Cosgrove DJ
(1999)
Enzymes and other agents that enhance cell wall extensibility.
Annu Rev Plant Physiol Plant Mol Biol
50: 391-417
[CrossRef][Web of Science][Medline]
-
Dellaporta SL, Wood J, Hicks JB
(1983)
A plant DNA mini preparation: version II.
Plant Mol Biol Rep
1: 19-21
-
Demura T, Fukuda H
(1994)
Novel vascular cell-specific genes whose expression is regulated temporally and spatially during vascular system development.
Plant Cell
6: 967-981
[Abstract]
-
Dubowy J, Macdonald PM
(1998)
Localization of mRNAs to the oocyte is common in Drosophila ovaries.
Mech Dev
70: 193-195
[CrossRef][Medline]
-
Fleming AJ, McQueen-Mason SJ, Mandel T, Kuhlemeier C
(1997)
Induction of leaf primordia by the cell wall protein expansin.
Science
276: 1415-1418
[Abstract/Free Full Text]
-
Fukuda H
(1996)
Xylogenesis: initiation, progression, and cell death.
Annu Rev Plant Physiol Plant Mol Biol
47: 299-325
[CrossRef][Web of Science]
-
Fukuda H, Komamine A
(1980)
Establishment of an experimental system for the tracheary elements differentiation from single cells isolated from the mesophyll of Zinnia elegans.
Plant Physiol
52: 57-60
-
Goldspink P, Sharp W, Russell B
(1997)
Localization of cardiac (alpha)-myosin heavy chain mRNA is regulated by its 3' untranslated region via mechanical activity and translational block.
J Cell Sci
110: 2969-2978
[Abstract]
-
Groover A, DeWitt N, Heidel A, Jones AM
(1997)
Programmed cell death of plant tracheary elements differentiating in vitro.
Protoplasma
196: 197-211
[CrossRef]
-
Groover A, Jones AM
(1999)
Tracheary element differentiation uses a novel mechanism coordinating programmed cell death and secondary cell wall synthesis.
Plant Physiol
119: 375-384
[Abstract/Free Full Text]
-
Kimberly L, Melton M, Melton D
(1992)
Vegetal messenger RNA localization directed by a 340-nt RNA sequence element in Xenopus oocytes.
Science
255: 991-994
[Abstract/Free Full Text]
-
Kumar S, Koichiro T, Nei M
(1993)
MEGA: Molecular Evolutionary Genetics Analysis System Version 1.01. The Pennsylvania State University, University Park
-
Link BM, Cosgrove DJ
(1998)
Acid-growth response and
-expansins in suspension cultures of Bright Yellow 2 tobacco.
Plant Physiol
118: 907-916
[Abstract/Free Full Text] -
McQueen-Mason SJ
(1995)
Expansins and cell wall expansion.
J Exp Bot
46: 1639-1650
[Abstract/Free Full Text]
-
McQueen-Mason SJ, Cosgrove DJ
(1994)
Disruption of hydrogen bonding between plant cell wall polymers by proteins that induce wall extension.
Proc Natl Acad Sci USA
91: 6574-6578
[Abstract/Free Full Text]
-
Oleynikov Y, Singer RH
(1998)
RNA localization: different zipcodes, same postman?
Trends Cell Biol
8: 381-383
[CrossRef][Web of Science][Medline]
-
Reinhardt D, Wittwer F, Mandel T, Kuhlemeier C
(1998)
Localized upregulation of a new expansin gene predicts the site of leaf formation in the tomato meristem.
Plant Cell
10: 1427-1437
[Abstract/Free Full Text]
-
Roberts A, Uhnak KS
(1998)
Tip growth in xylogenic suspension cultures of Zinnia elegans: implication for the relationship between cell shape and secondary cell wall pattern in tracheary elements.
Protoplasma
204: 103-113
-
Rose JKC, Lee HH, Bennett AB
(1997)
Expression of a divergent expansin gene is fruit-specific and ripening-regulated.
Proc Natl Acad Sci USA
94: 5955-5960
[Abstract/Free Full Text]
-
Seagull RW, Falconer MM
(1991)
In vitro xylogenesis.
In
CW Lloyd, ed, The Cytoskeletal Basis of Plant Growth and Form. Academic Press, London, pp 183-194
-
Shcherban TY, Shi J, Durachko DM, Guiltinan MJ, McQueen-Mason SJ, Shieh M, Cosgrove DJ
(1995)
Molecular cloning and sequence analysis of expansins: a highly conserved multi-gene family of proteins that mediate cell wall expansion in plants.
Proc Natl Acad Sci USA
92: 9245-9249
[Abstract/Free Full Text]
-
Shininger TL
(1979)
The control of vascular development.
Annu Rev Plant Physiol
30: 313-337
-
Takizawa PA, Sil A, Swedlow JR, Herskowitz I, Vale RD
(1997)
Actin-dependent localization of an RNA encoding a cell-fate determinant in yeast.
Nature
389: 90-93
[CrossRef][Medline]
-
Thompson JD, Higgins DG, Gibson TJ
(1994)
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence waiting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res
22: 4673-4680
[Abstract/Free Full Text]
-
von Heijne G
(1986)
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res
14: 4683-4690
[Abstract/Free Full Text]
-
Wadsworth GJ, Redinbaugh MG, Scandalios JG
(1988)
A procedure for the small scale isolation of plant RNA suitable for RNA blot analysis.
Anal Biochem
172: 279-283
[CrossRef][Web of Science][Medline]
-
Weeks DL, Melton DA
(1987)
A maternal mRNA localized to the vegetal hemisphere in Xenopus eggs codes for a growth factor related to TGF-beta.
Cell
51: 861-867
[CrossRef][Web of Science][Medline]
-
Ye ZH, Varner JE
(1993)
Gene expression patterns associated with in vitro tracheary element formation in isolated single mesophyll cell of Zinnia elegans.
Plant Physiol
103: 805-814
[Abstract]
© 2000 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
B. Muller, G. Bourdais, B. Reidy, C. Bencivenni, A. Massonneau, P. Condamine, G. Rolland, G. Conejero, P. Rogowsky, and F. Tardieu
Association of Specific Expansins with Growth in Maize Leaves Is Maintained under Environmental, Genetic, and Developmental Sources of Variation
Plant Physiology,
January 1, 2007;
143(1):
278 - 290.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Pesquet, P. Ranocha, S. Legay, C. Digonnet, O. Barbier, M. Pichon, and D. Goffner
Novel Markers of Xylogenesis in Zinnia Are Differentially Regulated by Auxin and Cytokinin
Plant Physiology,
December 1, 2005;
139(4):
1821 - 1839.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Dahiya, D. Milioni, B. Wells, N. Stacey, K. Roberts, and M. C. McCann
A RING Domain Gene Is Expressed in Different Cell Types of Leaf Trace, Stem, and Juvenile Bundles in the Stem Vascular System of Zinnia
Plant Physiology,
July 1, 2005;
138(3):
1383 - 1395.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Belfield, B. Ruperti, J. A. Roberts, and S. McQueen-Mason
Changes in expansin activity and gene expression during ethylene-promoted leaflet abscission in Sambucus nigra
J. Exp. Bot.,
March 1, 2005;
56(413):
817 - 823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Washida, A. Sugino, J. Messing, A. Esen, and T. W. Okita
Asymmetric Localization of Seed Storage Protein RNAs to Distinct Subdomains of the Endoplasmic Reticulum in Developing Maize Endosperm Cells
Plant Cell Physiol.,
December 15, 2004;
45(12):
1830 - 1837.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Gray-Mitsumune, E. J. Mellerowicz, H. Abe, J. Schrader, A. Winzell, F. Sterky, K. Blomqvist, S. McQueen-Mason, T. T. Teeri, and B. Sundberg
Expansins Abundant in Secondary Xylem Belong to Subgroup A of the {alpha}-Expansin Gene Family
Plant Physiology,
July 1, 2004;
135(3):
1552 - 1564.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Zenoni, L. Reale, G. B. Tornielli, L. Lanfaloni, A. Porceddu, A. Ferrarini, C. Moretti, A. Zamboni, A. Speghini, F. Ferranti, et al.
Downregulation of the Petunia hybrida {alpha}-Expansin Gene PhEXP1 Reduces the Amount of Crystalline Cellulose in Cell Walls and Leads to Phenotypic Changes in Petal Limbs
PLANT CELL,
February 1, 2004;
16(2):
295 - 308.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Cosgrove, L. C. Li, H.-T. Cho, S. Hoffmann-Benning, R. C. Moore, and D. Blecker
The Growing World of Expansins
Plant Cell Physiol.,
December 15, 2002;
43(12):
1436 - 1444.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Nakanomyo, B. Kost, N.-H. Chua, and H. Fukuda
Preferential and Asymmetrical Accumulation of a Rac Small GTPase mRNA in Differentiating Xylem Cells of Zinnia elegans
Plant Cell Physiol.,
December 15, 2002;
43(12):
1484 - 1492.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Milioni, P.-E. Sado, N. J. Stacey, K. Roberts, and M. C. McCann
Early Gene Expression Associated with the Commitment and Differentiation of a Plant Tracheary Element Is Revealed by cDNA-Amplified Fragment Length Polymorphism Analysis
PLANT CELL,
November 1, 2002;
14(11):
2813 - 2824.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Goda, Y. Shimada, T. Asami, S. Fujioka, and S. Yoshida
Microarray Analysis of Brassinosteroid-Regulated Genes in Arabidopsis
Plant Physiology,
November 1, 2002;
130(3):
1319 - 1334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Aharoni, L. C.P. Keizer, H. C. Van Den Broeck, R. Blanco-Portales, J. Munoz-Blanco, G. Bois, P. Smit, R. C.H. De Vos, and A. P. O'Connell
Novel Insight into Vascular, Stress, and Auxin-Dependent and -Independent Gene Expression Programs in Strawberry, a Non-Climacteric Fruit
Plant Physiology,
July 1, 2002;
129(3):
1019 - 1031.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. McCann, N. J. Stacey, P. Dahiya, D. Milioni, P.-E. Sado, and K. Roberts
Zinnia. Everybody Needs Good Neighbors
Plant Physiology,
December 1, 2001;
127(4):
1380 - 1382.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Okamoto-Nakazato, K. Takahashi, R. Katoh-Semba, and K. Katou
Distribution of Yieldin, a Regulatory Protein of the Cell Wall Yield Threshold, in Etiolated Cowpea Seedlings
Plant Cell Physiol.,
September 1, 2001;
42(9):
952 - 958.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Beach and K. Bloom
ASH1 mRNA Localization in Three Acts
Mol. Biol. Cell,
September 1, 2001;
12(9):
2567 - 2577.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wu, E. T. Thorne, R. E. Sharp, and D. J. Cosgrove
Modification of Expansin Transcript Levels in the Maize Primary Root at Low Water Potentials
Plant Physiology,
August 1, 2001;
126(4):
1471 - 1479.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wu, R. B. Meeley, and D. J. Cosgrove
Analysis and Expression of the {alpha}-Expansin and {beta}-Expansin Gene Families in Maize
Plant Physiology,
May 1, 2001;
126(1):
222 - 232.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
N. Zhang and K. H. Hasenstein
Distribution of Expansins in Graviresponding Maize Roots
Plant Cell Physiol.,
December 1, 2000;
41(12):
1305 - 1312.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|