|
|
||||||||
|
Plant Physiol, July 2000, Vol. 123, pp. 1173-1184
A Family of at Least Seven
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
During our search for a cDNA encoding
-galactosidase II, a
-galactosidase/exogalactanase (EC 3.2.1.23) present during tomato
(Lycopersicon esculentum Mill.) fruit ripening, a family of seven tomato
-galactosidase (TBG) cDNAs was identified. The shared amino acid sequence identity among the seven TBG clones ranged
from 33% to 79%. All contained the putative active site-containing consensus sequence pattern G-G-P-[LIVM]-x-Q-x-E-N-E-[FY] belonging to glycosyl hydrolase family 35. Six of the seven single-copy genes
were mapped using restriction fragment length polymorphisms of
recombinant inbred lines. RNA gel-blot analysis was used to evaluate
TBG mRNA levels throughout fruit development, in different fruit
tissues, and in various plant tissues. RNA gel-blot analysis was also
used to reveal TBG mRNA levels in fruit of the rin, nor, and Nr tomato mutants. The TBG4-encoded protein, known
to correspond to
-galactosidase II, was expressed in yeast and
exo-galactanase activity was confirmed via a quantified release of
galactosyl residues from cell wall fractions containing
(1
4)-D-galactan purified from tomato fruit.
| |
INTRODUCTION |
|---|
|
|
|---|
-Galactosidases (EC 3.2.1.23), a
widespread family of glycosyl hydrolases, are characterized by their
ability to hydrolyze terminal, non-reducing
-D-galactosyl residues from
-D-galactosides.
-Galactosidases are commonly
associated with the hydrolysis of the milk sugar lactose into Gal and
Glc by mammals and Escherichia coli. Due to the hardy and
easily assayed nature of some
-galactosidases, E. coli
LacZ has become one of the most conspicuous reporter gene systems in
use today (Bayer and Campos-Ortega, 1992
; Young and Hope, 1993
; Cui et
al., 1994
; Timmons et al., 1997
; Lewis et al., 1998
). However, LacZ has
not been used for plant-based reporter gene systems due to high
endogenous
-galactosidase activity in most plant tissues at neutral
pH (Jefferson et al., 1987
). Although the LacZ product can be easily
assayed,
-galactosidases have been shown to function under a variety
of reaction conditions, to have numerous substrate specificities, and
to be located in various subcellular and extracellular locations in
eukaryotes (Gossrau, 1976
; Dey and del Campillo, 1984
; Singh and Knox,
1984
; Kulikova et al., 1990
). It has become clear that
-galactosidases play numerous roles in the metabolism of a multitude
of galactosyl-containing substrates.
Numerous studies have shown that
-galactosidases catalyze the
hydrolysis of terminal galactosyl residues from carbohydrates, glycoproteins, and galactolipids.
-Galactosidase action has been proposed to release stored energy for rapid growth (lactose hydrolysis in mammals and bacteria, xyloglucan mobilization in cotyledons), release free Gal during normal metabolic recycling of galactolipids, glycoproteins, and cell wall components, and degrade cell wall components during senescence (Lo et al., 1979
; Bhalla and Dalling, 1984
; Maley et al., 1989
; Raghothama et al., 1991
; De Veau et al.,
1993
; Ross et al., 1993
; Buckeridge and Reid, 1994
; Hall, 1998
).
Furthermore, many
-galactosidases have specific biosynthetic activities by both transglycosylation and reverse hydrolysis
under favorable thermodynamic in vitro conditions (Bonnin et al., 1995
; Yoon and Ajisaka, 1996
).
The study of the role of
-galactosidases in tomato fruit has
resulted from physiological and biochemical data showing that Gal is
the most dynamic sugar residue of the cell wall during tomato fruit
development. In particular, these physiological studies showed that
there was a significant net loss of galactosyl residues from the wall
throughout fruit development and the rate of galactosyl residue loss
increased during ripening. Also shown was that free Gal levels,
although stable throughout the preripening stages of fruit development,
increased rapidly during ripening (Kim et al., 1991
). Physiological
studies also showed that when free Gal was infiltrated into mature
green fruit at a concentration equivalent to the red ripe stage of
fruit development, ripening was hastened (Gross, 1985
). Furthermore,
the un-conjugated N-glycans,
Man5GlcNAc and
Man3(Xyl)GlcNAc, were able to predictably
promote or delay ripening of excised pericarp discs, but only in the
presence of physiologically relevant levels of free Gal (Yunovitz and
Gross, 1994
).
The purification of three tomato
-galactosidases (TBGs), of which
only
-galactosidase II had exo-galactanase activity, was first
reported by Pressey (1983)
. It was proposed that
-galactosidase II
might be important in the softening of tomato fruit during ripening.
This contention was further supported by demonstrating that, although
total
-galactosidase activity was unchanged during ripening of
wild-type and mutant fruit,
-galactosidase II activity increased
4-fold in wild-type fruit, but did not change during the equivalent
chronological period in the ripening mutants, ripening inhibitor (rin) and non-ripening
(nor) (Carey et al., 1995
). The cDNA corresponding to
-galactosidase II was subsequently cloned (Smith et al., 1998
).
In the process of cloning the
-galactosidase II cDNA, six
additional cDNAs were identified that had significant shared amino acid
sequence identity. We report on the characterization of this family of
-galactosidase genes, which may be involved in Gal metabolism during
cell wall turnover, conversion of chloroplasts into chromoplasts, fruit
growth, and senescence.
| |
RESULTS |
|---|
|
|
|---|
There is some contradiction in the literature concerning the
nomenclature of
-galactosidases versus cell wall (or other native substrates) galactosyl-specific hydrolases. To clarify the work presented here, the following terms are used:
-galactosidase, an
enzyme that can hydrolyze a
-galactosyl residue linked to a variety
of aglycones (e.g. lactose,
p-nitrophenyl-
-D-galactopyranoside [PNP-gal], etc.); exogalactanase, an enzyme that is specific for the
non-reducing end of galactan and has no action on PNP-gal or lactose
and whose affinity for the substrate increases the depolymerization of
the substrate; and galactanase, an enzyme that cleaves internal bonds
in galactan. Moreover, an enzyme that can hydrolyze galactose from
PNP-gal and the non-reducing end of galactan is referred to as a
-galactosidase/exogalactanase (B. Henrissat, personal communication;
Henrissat, 1998
).
Sequence Analysis
The open reading frames (ORFs) of seven cDNA clones that had a
significant level of shared amino acid sequence identity to each other
and other published plant
-galactosidases were identified (Fig.
1). All of the TBGs contain the putative
active site-containing consensus sequence pattern
G-G-P-[LIVM]-x-Q-x-E-N-E-[FY] belonging to glycosyl hydrolase
family 35; where amino acids separated by dashes are conserved, amino
acids [LIVM] and [FY] are conserved substitutions and x is any
amino acid (Fig. 2; Henrissat, 1998
). Due to
a number of short amino acid insertions and deletions throughout their
sequences (e.g. Fig. 2, positions 472-491), TBG2, TBG5, and TBG7
shared less than 41% amino acid sequence identity to each other and to
the other
-galactosidases. The deduced amino acid sequence in the
TBG1 ORF is nearly identical to that of a previously described cDNA
(accession no. P48980) from tomato cv Ailsa Craig (Carey et al., 1995
).
Also, the ORFs of TBG1, TBG3, and TBG4 are identical to the cDNA
clones (accession nos. CAA10174, CAA10173, and CAA10175, respectively)
isolated from tomato cv Money Maker. To our knowledge, no data on these
clones has been published. These clones are likely derived from the
same gene, but differ in their non-coding region and nucleotide
sequences due to their varietal origins. The nucleotide sequence
accession numbers for the TBGs are: TBG1, AF023847; TBG2, AF154420; TBG3, AF154421; TBG4, AF020390; TBG5, AF154423; TBG6, AF154424; and
TBG7, AF154422.
|
|
BLAST searches of the non-redundant database at GenBank also indicated
significant shared amino acid sequence identity among domains of the
TBGs and mammalian and fungal
-galactosidases, however, little
shared sequence identity was detected with most bacterial
-galactosidases (data not shown).
All the TBG ORFs were predicted to have a signal sequence (Table I). However, cellular targeting was not fully confirmed using the two prediction programs SignalP and PSORT. Only TBG4, TBG5, and TBG6 were predicted to be secreted by both programs. TBG7 was predicted to be targeted to the chloroplast by PSORT. The deduced amino acid sequences of the seven clones were also subjected to analysis using the program DNASIS (Hitachi, Tokyo) for predicting molecular mass, pI, and potential N-linked glycosylation sites (Table I).
|
Sequence analysis of the full-length TBG and plant
-galactosidases clones showed that the
-galactosidases could
be divided into two distinct groups based on mass and other
characteristics. The first group of proteins (apple, carnation, lupin,
papaya, and TBG4) had a molecular mass range of 80.5 to 82.8 kD and was comprised of 721 to 731 amino acids. The second group (asparagus, TBG1,
TBG2, TBG3, TBG5, TBG6, and TBG7) had a molecular mass range of 89.8 to
99.9 kD and was comprised of 832 to 888 residues. The larger size of
the proteins in the second group was due primarily to an addition of
approximately 100 amino acids at their carboxyl termini. The addition
at the carboxyl terminus was remarkable due to the presence of a number
of highly conserved residues, and in particular, seven conserved
cystines (Fig. 2, shown in bold). It is unknown if the similarity
within or differences between these two groups of
-galactosidases
has any functional significance.
DNA Gel-Blot Analysis and Mapping
DNA gel-blot analysis was done using the 3'-untranslated regions of TBG1, TBG2, TBG3, TBG4, and TBG7 and nucleotides 286 to 1,041 and 254 to 1,003 of TBG5 and TBG6, respectively, as probes against restriction enzyme-digested genomic DNA. The genes corresponding to the clones appeared to be present as single copies (data not shown). The same probes were used to map six of the seven genes (Table II) using RFLPs of recombinant inbred lines (J. Giovannoni, personal communication).
|
RNA Gel-Blot Analysis
RNA gel-blot analysis was performed so that the relative TBG hybridization signals within each experiment were approximately comparable. This was accomplished by doing preliminary RNA gel-blot analysis to estimate the signal intensity that each TBG probe produced among all RNA samples (data not presented). Based on these preliminary results, RNA gel-blot analysis was repeated to confirm the previous results and present the data in a comparative manner (Figs. 3-6). Further care was taken on this point by ensuring that probes were synthesized to similar specific activities using TBG cDNA regions that did not cross-hybridize (see "Materials and Methods" for details).
|
|
|
|
Temporal Expression Pattern in Fruit
The temporal expression pattern of the seven genes in fruit tissue was examined using RNA extracted from all fruit tissues except seeds. Transcripts for all seven genes were detected during some stage of fruit development (Fig. 3). TBG1 and TBG3 had similar constitutive expression patterns throughout the breaker to over-ripe stages. TBG2 transcript was detected at a very low level from 30 d post-pollination (dpp) to the over-ripe stage. TBG4 transcript was first detected at the breaker stage, peaked at the turning stage, and declined as fruit ripened fully. Although TBG5 had a similar expression pattern to TBG4 during the ripening stages, TBG5 mRNA was also detected throughout all of the earlier stages of fruit development. TBG6 had a distinctive expression pattern in that the presence of its high abundance transcript was limited to preripening. TBG7 also had a unique expression pattern, being transiently expressed very early and late in fruit development.Spatial Expression Pattern in Fruit
RNA gel-blot analysis was also performed to determine transcript accumulation in specific tissues within immature and maturing fruit (Fig. 4). Within all mature green fruit tissues, both TBG2 and TBG7 transcripts were detected, albeit at a very low level. TBG6 transcript was also detected in all mature green fruit tissues, but at a far more abundant level. TBG1, TBG3, and TBG4 transcripts were detected in all turning stage fruit tissues, although TBG4 transcript, like tomato polygalacturonase (PG), was most abundant in the peel. TBG5 transcript was detected at moderate abundance in the peel and inner and outer pericarp, but similar to PG, was conspicuously absent in locular tissue.Tissue Specificity
RNA gel-blot analysis was performed to reveal whether any of the TGBs were expressed in non-fruit tissues. With the exception of TBG2, transcripts of all other clones were detected in non-fruit tissues (Fig. 5). Although TBG3 transcript may appear to be absent in Figure 5, after 2-fold-longer film exposures, its transcript was detected at very low levels in root and stem tissues (data not shown). Transcripts of TBG1, TBG4, TBG5, and TBG6 were detected in all tissues tested. However, only transcripts from TBG5 and TBG6 were detected at levels approximately as abundant in vegetative tissues as in growing fruit.Expression in Normal versus Mutant Fruit
Gene expression in rin and nor fruit was shown to be impaired for most ripening-related genes via the lack of climacteric ethylene-inducible gene expression (DellaPenna et al., 1989Enzyme Activity
To determine the role of the TBG encoded products, we initiated
experiments to express the cDNA encoded enzymes using heterologous expression systems. A yeast expression system, which secretes a mature
amino-terminal-(FLAG) fusion protein into the culture medium,
was tested. TBG4 expression was attempted first because the
corresponding enzyme
-galactosidase II has been purified from tomato
fruit and characterized in some detail (Carey et al., 1995
; Smith et
al., 1998
). Therefore, the activity of the heterologous system-expressed protein could be compared to the native enzyme purified from tomato. Expression of a FLAG-TBG4-encoded fusion protein
construct resulted in the production of approximately 1 mg of active
enzyme per 50 mL of culture (data not shown). Subsequently, the
FLAG-TBG4 protein was affinity-purified using an anti-FLAG affinity
resin (Fig. 7).
|
The affinity-purified TBG4 enzyme had
(1
4)-D-galactosidase activity by virtue of its
ability to hydrolyze the synthetic substrates PNP-gal (Fig.
8) and
5-bromo-4-chloro-3-indoxyl-
-D-galactopyranoside (X-gal; data not shown). The enzyme was also able to
hydrolyze lactose, albeit poorly (Table
III). Most significantly, the enzyme was
able to release galactosyl residues from a variety of
galactosyl-containing cell wall substrates, and therefore had
exogalactanase activity (Table III). Thus, this enzyme should be termed
a
-galactosidase/exo-galactanase.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
During our search for a cDNA coding for
-galactosidase II, a
total of seven cDNA clones with a significant level of shared sequence
identity were found. All of the genes appear to have a single genomic
copy and six of the seven genes were mapped. The shared sequence
identity of the seven clones to each other and to other plant
-galactosidases and the presence of the glycosyl hydrolase
family 35 consensus sequence (Fig. 2), suggests that they all may have
-galactosidase activity. However, this does not make it possible to
predict their in vivo substrate specificities.
The expression patterns of the TBGs varied widely. Only TBG2 mRNA was found to be potentially fruit specific by RNA gel-blot analysis, however, more sensitive mRNA quantification assays are required to conclusively determine TBG2's expression pattern. The wide range of expression patterns among the TBGs suggests that the substrates for most of the TBG-encoded enzymes are distributed throughout the tomato plant. The prediction, by both PSORT and Signal P, that the signal sequences of TBG2, TBG4, TBG5, and TBG6 may target these proteins outside the cell suggests that they may all be involved in cell wall galactosyl modification (Table I). Although PSORT predicted that TBG1 and TBG3 proteins are targeted to the endoplasmic reticulum, the program SignalP predicted that TBG1 and TBG3 are secreted. Therefore, it is conceivable that these enzymes are involved in cell wall galactosyl modification as well (Table I).
The idea that six of the seven TBG proteins may be involved in cell
wall galactosyl modifications is plausible based on the increasing
number of reports on the substrate specificities of
-galactosidase/exogalactanases involved in xyloglucan mobilization in cotyledons of several species. One recent example of the specificity that various
-galactosidase/exogalactanases can have was reported by
de Alcantara et al. (1999)
. They showed that a
-galactosidase/exogalactanase purified from Copaifera
langsdorffii cotyledons could only hydrolyze terminal galactosyl
residues if linked to a xylosyl residue adjacent to the non-reducing
end glucosyl residue of an endo-
-glucanase-derived xyloglucan
oligomer, and that this enzyme was unable to hydrolyze a galactosyl
residue linked to a xylosyl residue adjacent to a reducing end glucosyl
residue. Moreover, the removal of this terminal galactosyl residue by
-galactosidase/exogalactanase was implicated to be a prerequisite
for the hydrolysis of the reducing end glucosyl residue by
-glucosidase.
One interesting finding in the present study was that TBG5 mRNA
was present at relatively high levels during early fruit development, dropped throughout the immature and mature green stages, rose at the
onset of ripening, and fell again throughout the later stages of
ripening (Fig. 3). It is possible that the TBG5-encoded enzyme, if
targeted to the cell wall, is needed for rapid expansion and again
during the disassembly of the wall during ripening. The pattern
of TBG5 mRNA accumulation throughout normal fruit development was
similar to that of the tomato endo-
-glucanase genes Cel1
and Cel2 (Gonzalez-Bosch et al., 1996
). The overlapping expression pattern of the endo-
-glucanase and exo-
-galactanase genes may indicate that a coordinated effort of these enzymes is
necessary for hemicellulosic modifications that occur during cell
division, cell growth and fruit ripening.
TBG7 mRNA is present at maximum levels at 10 dpp and in over-ripe
fruit and at relatively low levels throughout the other stages of fruit
development. The TBG7-encoded enzyme is predicted to be targeted
to the chloroplast, and, therefore, it may be involved in
galactolipid turnover/degradation, which occurs in chloroplasts and chromoplasts during tomato fruit development
(Güçlü et al., 1989
; Whitaker, 1992
). However, not
enough is known about galactolipid metabolism throughout fruit
development to predict what, if any, relationship TBG7's expression
pattern has with galactolipid metabolism.
The rin, nor, and Nr ripening-impaired
mutants are distinguished by multiple aberrant fruit ripening
phenotypes (Tigchelaar et al., 1979
). Rin and nor
fruit are characterized by a lack of climacteric ethylene and cannot be
ripened by the application of exogenous ethylene (Tigchelaar et al.,
1979
). Because ethylene-regulated gene expression is attenuated
(DellaPenna et al., 1989
; Knapp et al., 1989
; Harriman et al., 1991
;
Picton et al., 1993
), ethylene-regulated gene expression can be induced
by exogenous ethylene (Lincoln and Fischer, 1988
; Giovannoni et al.,
1989
; Gray et al., 1992
), and expression of several developmentally
regulated genes (e.g. PG, E8, and 1-aminocyclopropane-1-carboxylic acid
synthase) is attenuated (DellaPenna et al., 1989
; Theologis et al.,
1993
), rin and nor are believed to be lesions in
a developmentally regulated pathway of fruit ripening. The
Nr mutation results in a block of a wide range of ethylene
responses (Lanahan et al., 1994
). The Nr gene has been cloned and is
believed to be involved in ethylene perception and signal transduction
(Wilkinson et al., 1995
). Of particular interest to this study is that
rin, nor, and Nr fruit soften little
when compared to ripening wild-type fruit at the equivalent
chronological stage (Tigchelaar et al., 1979
). Therefore, experiments
were done to compare the accumulation of TBG mRNA in wild-type versus
ripening-impaired mutant fruit. TBG1, TBG2, TBG3, and TBG5 transcripts
are present in rin, nor, and Nr fruit
in a chronological (dpp) pattern similar to that of wild-type
accumulation (Fig. 6). Therefore, it is unlikely that these TBGs could
be solely responsible for cell wall modifications that result in fruit
softening during ripening. It is also unlikely that the increase in
mRNA of these genes during ripening is regulated solely by ethylene. In
contrast, the abundance of TBG4 and TBG6 transcripts differed in
the mutant versus wild-type fruit. TBG4 transcript accumulation is
significantly impaired in all three mutants relative to wild-type
accumulation. This observation implies that the TBG4-encoded
-galactosidase II may be involved in cell wall modifications that
lead to fruit softening and TBG4 transcription may be up-regulated by ethylene.
Accumulation of TBG6 mRNA persisted up to 50 dpp in the fruit of all
three mutants (Fig. 6), whereas it was not detected in wild-type fruit
after 43 dpp (Figs. 3 and 6). It is consequently unlikely that the
TBG6-encoded gene product plays a crucial role in cell wall degradation
leading to fruit softening during ripening. The activities of most
-galactosidases/exogalactanases are believed to result in
degradation of the cell wall, although it is known that numerous
-galactosidases have specific biosynthetic activities by both
transglycosylation and reverse hydrolysis under favorable thermodynamic
in vitro conditions (Bonnin et al., 1995
; Yoon and Ajisaka, 1996
).
Therefore, it is interesting to speculate that the persistence of the
TBG6-encoded gene product in mutant fruit tissues results in increased
fruit firmness via some type of biosynthetic (cell wall strengthening)
activity. It is unfortunate that we do not know of any example that
demonstrates biosynthetic activity by a plant
-galactosidase under
in vivo conditions to support this hypothesis.
The significance of TBG expression patterns will be more fully
understood after cellular localization and substrate specificities of
their encoded enzymes is known. We and others have attempted to make
antibodies to various plant
-galactosidases, but have been unable to
produce satisfactory results (data not shown; G. Seymour, personal
communication). This has unfortunately made cellular localization of
the various
-galactosidases difficult, and reporter gene or epitope
fusions with the various mature forms of
-galactosidases may be
needed to elucidate their cellular localization using transgenic plants.
Cloning and characterization of the TBG4 cDNA was previously described
by Smith et al. (1998)
and was included here for comparison to the
other TBG clones. Here, use of a yeast expression system enabled us to
produce enough enzyme to test for exogalactanase activity on a variety
of substrates. TBG4 codes for
-galactosidase II, as described by
Pressey (1983)
and Carey et al. (1995)
. Our yeast-expressed protein has
similar attributes to the fruit-purified enzyme, in that its molecular
mass using SDS-PAGE is 75 kD, the pH optimum is 4.0, and it has both
-galactosidase and exo-galactanase activity on a variety of natural
substrates containing
-1,4-linked galactans. It is not surprising
that the TBG4-encoded enzyme is most active on alkali-soluble pectin
(Table III), since there is a correlation between increasing
-galactosidase II activity and decreasing galactosyl content of
alkali-soluble, but not chelator-soluble, pectin during tomato fruit
ripening (Carrington and Pressey, 1996
).
The analysis of an increasing number of cloned plant
-galactosidases and native
-galactosidases is resulting in a much
better understanding of their wide range of in vitro substrate
specificities. However, the precise role of the individual
-galactosidases in plant development remains speculative. Therefore,
we will take a molecular genetic approach to elucidate the consequences
of modifying expression of the TBGs. Both antisense and over-expression studies of TBGs in transgenic tomato plants are being conducted to
further evaluate the functional consequences of altering TBG gene expression.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plant Material
Tomato (Lycopersicon esculentum Mill. cv Rutgers)
plants were grown in a greenhouse using standard cultural practices.
The ripening mutants rin, nor and
Nr (Tigchelaar et al., 1978
), were all in the cv Rutgers
background. Flowers were tagged at anthesis and fruit was harvested
according to the number of dpp, or based on surface color using the
ripeness stages previously described by Mitcham et al. (1989)
. For gene
expression studies, only mature green fruit (40-42 dpp) at the MG4
stage were used for RNA extractions. The MG4 stage was confirmed by
cutting fruit open and observing entirely liquefied locular gel and no
cut seeds. Leaf, flower, and stem tissues were harvested from
greenhouse-grown plants. Roots were harvested from seedlings grown in
liquid culture medium consisting of the salts and vitamins described by
Murashige and Skoog (1962)
and 1% (w/v) Suc for 4 weeks.
RNA Extraction
Fruits were processed immediately after harvest by chilling on
ice, excising the various tissues, and freezing them in liquid nitrogen. Tissue samples were ground using a mortar and pestle and
stored at
80°C. RNA was extracted using the method described by
Verwoerd et al. (1989)
, except that a second chloroform extraction was performed.
cDNA Isolation
Reverse transcriptase-PCR, cDNA library construction, library
screening, and sequencing were done exactly as described in Smith et
al. (1998)
. The 5'-cDNA ends of TBG2, TBG5, and TBG6 were isolated
using the 5' system for RACE (Gibco-BRL, Cleveland). The gene-specific
primers used for 5' RACE were DS251 (ggaccgaatgagctttcaaca), DS252
(gagcgactcagatatcataaga), and DS253 (tgagatccgactagctttgc) for TBG2;
DS245 (cgagactcaatatcaccattg), DS246 (tgtgaatcgcttcatttctgc), and DS247
(agctctctccaccaacttca) for TBG5; and DS248 (ctccaagtaccttggcttga), DS249 (agcataccctttcattgcgtt), and DS250 (gccctgctttctgaatcgtt) for
TBG6. A 3'-RACE kit was used to amplify the 3'-cDNA ends of TBG5 and
TBG6. The gene-specific primers used for 3' RACE were DS262
(agtctcgttatggtcctcgt), DS263 (aacacccaagatgtggactg), and DS264
(gaagacatcgctttcgctgt) for TBG5, and DS265 (tcaagccaaggtacttggag), DS266 (ctgcaatttggactgaagct), and DS267 (aggatttggcatttgctgttg) for
TBG6. 5' and 3' RACE were performed following the manufacturer's instructions and Platinum Taq (Gibco-BRL) was used for
PCR. Full-length TBG5 and TBG6 cDNAs were amplified by PCR using
Platinum Pfx DNA polymerase (Gibco/BRL), the 3'-RACE products described
above as templates, and the primers DS282
(tttttttctagaagttgatcggaaaattgaaga) and DS283
(tattgaagctagttttcttttatta) for TBG5, and DS277
(aaagagtctagaagggaggtggaatcatggag) and DS273 (gatgcaaattacacttttccattg)
for TBG6. The TBG5 and TBG6 PCR products were digested with
XbaI and were ligated into XbaI plus
SmaI digested pBluescript II KS (Stratagene, La Jolla,
CA). Both strands of the cDNAs were sequenced by primer walking.
Sequence Analysis
Nucleotide and deduced amino acid sequence comparisons against
the databases were done using BLAST searches (Altschul et al., 1990
).
Sequence data were analyzed and aligned using MacDNAsis (Hitachi, San
Bruno, CA) software. Protein classification was performed using the
interactive web site Protomap (Yona et al., 1998
). Signal sequence
predictions were conducted using the interactive web sites PSORT (Nakai
and Kanehisa, 1992
) and SignalP (Nielsen et al., 1997
).
RNA Gel-Blot Analysis
Total RNA (20 µg per lane) was separated in a
formaldehyde/MOPS [3-(N-morpholino)-propanesulfonic
acid] agarose gel, transferred to Hybond-N+ nylon membrane
(Amersham, Arlington Heights, IL), fixed by incubating for 2 h at
80°C, hybridized overnight in a hybridization incubator using a
buffer described by Church and Gilbert (1984)
, washed to a final
stringency of 0.1× SSC with 0.2% (w/v) SDS at 65°C, and
autoradiographed. An RNA ladder standard was used to estimate the
length of the mRNAs. Probes were synthesized using a Random Primed DNA
Labeling Kit (Roche Molecular Biochemicals, Indianapolis) with
[32P]dATP (3,000 Ci/mmol) as the label. Probes were
synthesized using DNA fragments derived from PCR-amplification of the
3'-untranslated regions of TBG1, TBG2, TBG3, TBG4, and TBG7 and
nucleotides 286 to 1,041 and 254 to 1,003 of TBG5 and TBG6,
respectively. Probes were used only when the 32P
incorporation level was between 70% and 85% and adjusted to 106 dpm/mL for hybridization. For all RNA gel-blot
experiments, the TBG blots were exposed to X-Omat (Eastman Kodak,
Rochester, NY) film using an intensifying screen for 4 d at
80°C. As a loading control, RNA blots were stripped and reprobed at
a reduced hybridization and washing stringency using a soybean 26S rDNA
fragment (Turano et al., 1997
). Blots hybridized with the rDNA and PG
probes were exposed for 4 and 16 h respectively.
Expression in Yeast, Protein-Blot Analysis, and Enzyme Activity
TBG proteins were expressed using a the FLAG Yeast N-Terminal Expression System (Sigma-Aldrich, St. Louis). The ORF of TBG4 was PCR-amplified using the oligonucleotides DS214 (agtgagatctagtgtttcttatgatgacaga) and DS218 (tcgagtgtcgactcttgatctcctgactagaga) so that the signal peptide (aa 1-23) was removed and a BglII and SalI restriction site was created at the 5' and 3' end of the ORF, respectively. The 2.183-kb fragment was cloned into a BglII plus SalI digested YEpFLAG1 vector to produce an extracellular N-terminal FLAG fusion protein when expressed. The vector was transformed into the Saccharomyces cerevisiae host strain BJ3505. Yeast cells transformed with the YEpFLAG1 vector were used as a negative control. Cultures were grown and protein harvesting was done as described by the manufacturer, except that the cells were grown at room temperature for maximal expression.
Samples of yeast culture medium or affinity-purified TBG4 protein were subjected to SDS-PAGE and transferred to nitrocellulose. Blots were subjected to protein-blot analysis using M1 anti-FLAG primary antibody, rabbit anti-mouse secondary antibody conjugated to alkaline phosphatase, and colorimetric detection using Sigma-Fast substrate following the manufacturer's recommendations.
The yeast culture medium from YEpFLAG1 and YEpFLAGTBG4 transformed
cells was concentrated and desalted using Centriprep30 columns
(Millipore, Bedford, MA). Enzyme assays were performed using the
desalted medium and were repeated using column-purified TBG4 enzyme to
confirm the specificity of TBG4 enzyme's activity.
-Galactosidase
activity was assayed as described by Pressey (1983)
using 10 µL of
affinity-column-purified enzyme per reaction and PNP-gal as substrate;
1 unit of activity was defined as the amount of enzyme that liberated 1 µmol PNP min
1 at 37°C. Exo-galactanase activity was
determined by incubating cell wall material with the enzyme samples
essentially as described by Carey et al. (1995)
. One-milliliter
assays consisted of 2 mg of substrate, 0.005 unit of enzyme, 0.1%
(w/v) bovine serum albumin, and 50 mM sodium acetate buffer
at pH 4. Cell wall material was purified from mature green tomato fruit
using the methods described by Gross (1984)
. A lupin galactan,
pretreated with
-L-arabinofuranosidase, was obtained
from Megazyme (Wicklow, Ireland). Free Gal was identified and
quantified by gas chromotography/mass spectrometry-selected ion
monitoring of the galactitol acetate derivative prepared from the
released Gal product in reaction mixtures using the method of Gross and
Acosta (1991)
.
| |
ACKNOWLEDGMENTS |
|---|
The authors wish to thank Heather Torlina, Karen Green, and Norman Livsey for excellent technical assistance, Dr. Graham Seymour for helpful comments and critical review of the manuscript, and Dr. James Giovannoni and Stephanie Miller for mapping the TBGs.
| |
FOOTNOTES |
|---|
Received February 4, 2000; accepted March 26, 2000.
* Corresponding author; e-mail grossk{at}ba.ars.usda.gov; fax 301-504-5107.
| |
LITERATURE CITED |
|---|
|
|
|---|
-galactosidase associated with the stroma of chloroplasts prepared from mesophyll protoplasts of the primary leaf of wheat.
Plant Physiol
76: 92-95
-(1,4)-galac-tanase with transferase activity.
Int J Biol Macromol
17: 345-351
[CrossRef][Web of Science][Medline]
-galactosidase or exo-(1
4)-
-D-galactanase from the cotyledons of germinated Lupinus angustifolius L. seeds.
Planta
192: 502-511
[CrossRef][Web of Science][Medline]
(1
4)-D-galactanase: isolation, changes during ripening in normal and mutant tomato fruit, and characterization of a related cDNA clone.
Plant Physiol
108: 1099-1107
[Abstract]
-Galactosidase II activity in relation to changes in cell wall galactosyl composition during tomato ripening.
J Am Hortic Soc
121: 132-136
-galactosidase from cotyledons of Copaifera langsdorffii.
Plant Physiol Biochem
37: 653-663
[CrossRef]
-galacto-sidases purified from avocado mesocarp.
Physiol Plant
87: 279-285
[CrossRef]
-glucanase genes in pericarp and locules of wild-type and mutant tomato fruit.
Plant Physiol
111: 1313-1319
[Abstract]
-glucuronidase as a sensitive and versatile gene fusion marker in higher plants.
EMBO J
6: 3901-3907
[Web of Science][Medline]
-Galactosidases of lower eukaryotes.
Appl Biochem Microbiol
25: 621-632
-galactosidase from human placenta.
J Biol Chem
254: 6710-6715
-Galactosidases in ripening tomatoes.
Plant Physiol
71: 132-135
-galactosidase: isolation and activity against specific fruit cell-wall polysaccharides.
Planta
189: 499-506
-galactosidase in normal and enzyme deficient (gal) pollen of Brassica campestris: application of the indogenic method.
Histochem J
16: 1273-1296
[Medline]
-galactosidase II is expressed during fruit ripening.
Plant Physiol
117: 417-423
-galactosidase double reporters for visualizing Drosophila gene expression patterns.
Dev Genet
20: 338-347
[CrossRef][Medline]
-galactosidases of different origins.
Carbohydr Res
292: 153-163
[Web of Science][Medline]This article has been cited by other articles:
![]() |
J. J. Ordaz-Ortiz, S. E. Marcus, and J. Paul Knox Cell Wall Microstructure Analysis Implicates Hemicellulose Polysaccharides in Cell Adhesion in Tomato Fruit Pericarp Parenchyma Mol Plant, September 1, 2009; 2(5): 910 - 921. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Martinelli, S. L. Uratsu, R. L. Reagan, Y. Chen, D. Tricoli, O. Fiehn, D. M. Rocke, C. S. Gasser, and A. M. Dandekar Gene regulation in parthenocarpic tomato fruit J. Exp. Bot., September 1, 2009; 60(13): 3873 - 3890. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Brandao, L. E. V. Del Bem, M. Vincentz, and M. S. Buckeridge Expression pattern of four storage xyloglucan mobilization-related genes during seedling development of the rain forest tree Hymenaea courbaril L. J. Exp. Bot., March 1, 2009; 60(4): 1191 - 1206. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-X. Zhong, J.-Y. Chen, H.-L. Feng, J.-F. Kuang, R. Xiao, M. Ou, H. Xie, W.-J. Lu, Y.-M. Jiang, and H.-T. Lin Expansin and XET Genes Are Differentially Expressed During Aril Breakdown in Harvested Longan Fruit J. Amer. Soc. Hort. Sci., May 1, 2008; 133(3): 462 - 467. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nishiyama, M. Guis, J. K. C. Rose, Y. Kubo, K. A. Bennett, L. Wangjin, K. Kato, K. Ushijima, R. Nakano, A. Inaba, et al. Ethylene regulation of fruit softening and cell wall disassembly in Charentais melon J. Exp. Bot., April 1, 2007; 58(6): 1281 - 1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.-J. Lee, Y. Matsumura, K. Soga, T. Hoson, and N. Koizumi Glycosyl Hydrolases of Cell Wall are Induced by Sugar Starvation in Arabidopsis Plant Cell Physiol., March 1, 2007; 48(3): 405 - 413. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Carrari and A. R. Fernie Metabolic regulation underlying tomato fruit development J. Exp. Bot., June 1, 2006; 57(9): 1883 - 1897. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fonseca, L. Monteiro, M. G. Barreiro, and M. S. Pais Expression of genes encoding cell wall modifying enzymes is induced by cold storage and reflects changes in pear fruit texture J. Exp. Bot., August 1, 2005; 56(418): 2029 - 2036. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kotake, S. Dina, T. Konishi, S. Kaneko, K. Igarashi, M. Samejima, Y. Watanabe, K. Kimura, and Y. Tsumuraya Molecular Cloning of a {beta}-Galactosidase from Radish That Specifically Hydrolyzes {beta}-(1->3)- and {beta}-(1->6)-Galactosyl Residues of Arabinogalactan Protein Plant Physiology, July 1, 2005; 138(3): 1563 - 1576. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Aspeborg, J. Schrader, P. M. Coutinho, M. Stam, A. Kallas, S. Djerbi, P. Nilsson, S. Denman, B. Amini, F. Sterky, et al. Carbohydrate-Active Enzymes Involved in the Secondary Cell Wall Biogenesis in Hybrid Aspen Plant Physiology, March 1, 2005; 137(3): 983 - 997. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wu and J. K. Burns A {beta}-galactosidase gene is expressed during mature fruit abscission of 'Valencia' orange (Citrus sinensis) J. Exp. Bot., July 1, 2004; 55(402): 1483 - 1490. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Moctezuma, D. L. Smith, and K. C. Gross Antisense suppression of a {beta}-galactosidase gene (TB G6) in tomato increases fruit cracking J. Exp. Bot., September 1, 2003; 54(390): 2025 - 2033. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Esteban, B. Dopico, F. J. Munoz, S. Romo, I. Martin, and E. Labrador Cloning of a Cicer arietinum {beta}-Galactosidase with Pectin-Degrading Function Plant Cell Physiol., July 1, 2003; 44(7): 718 - 725. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Alexander and D. Grierson Ethylene biosynthesis and action in tomato: a model for climacteric fruit ripening J. Exp. Bot., October 1, 2002; 53(377): 2039 - 2055. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Smith, J. A. Abbott, and K. C. Gross Down-Regulation of Tomato beta -Galactosidase 4 Results in Decreased Fruit Softening Plant Physiology, August 1, 2002; 129(4): 1755 - 1762. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. O. Sozzi, L. C. Greve, G. A. Prody, and J. M. Labavitch Gibberellic Acid, Synthetic Auxins, and Ethylene Differentially Modulate alpha -L-Arabinofuranosidase Activities in Antisense 1-Aminocyclopropane-1-Carboxylic Acid Synthase Tomato Pericarp Discs Plant Physiology, July 1, 2002; 129(3): 1330 - 1340. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Trainotti, R. Spinello, A. Piovan, S. Spolaore, and G. Casadoro {beta}-Galactosidases with a lectin-like domain are expressed in strawberry J. Exp. Bot., August 1, 2001; 52(361): 1635 - 1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Carey, D. L. Smith, E. Harrison, C. R. Bird, K. C. Gross, G. B. Seymour, and G. A. Tucker Down-regulation of a ripening-related {beta}-galactosidase gene (TBG1) in transgenic tomato fruits J. Exp. Bot., April 15, 2001; 52(357): 663 - 668. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|