|
Plant Physiol, August 2000, Vol. 123, pp. 1449-1458
Ethylene Perception by the ERS1 Protein in
Arabidopsis1
Anne E.
Hall,2
Jennifer L.
Findell,2
G.
Eric
Schaller,
Edward C.
Sisler, and
Anthony B.
Bleecker*
Department of Botany, University of Wisconsin, Madison, Wisconsin
53706 (A.E.H., A.B.B.); Department of Biochemistry and Molecular
Biology, University of New Hampshire, Durham, New Hampshire 03824 (J.L.F., G.E.S.); and Department of Biochemistry, North Carolina State
University, Raleigh, North Carolina 27650 (E.C.S.)
 |
ABSTRACT |
Ethylene perception in Arabidopsis is controlled by a family of
five genes, including ETR1, ERS1
(ethylene response sensor 1), ERS2, ETR2,
and EIN4. ERS1, the most highly conserved
gene with ETR1, encodes a protein with 67% identity to
ETR1. To clarify the role of ERS1 in ethylene sensing,
we biochemically characterized the ERS1 protein by heterologous
expression in yeast. ERS1, like ETR1, forms a membrane-associated,
disulfide-linked dimer. In addition, yeast expressing the ERS1 protein
contains ethylene-binding sites, indicating ERS1 is also an
ethylene-binding protein. This finding supports previous genetic
evidence that isoforms of ETR1 also function in plants as ethylene
receptors. Further, we used the ethylene antagonist
1-methylcyclopropene (1-MCP) to characterize the ethylene-binding sites
of ERS1 and ETR1. We found 1-MCP to be both a potent inhibitor of the
ethylene-induced seedling triple response, as well as ethylene binding
by yeast expressing ETR1 and ERS1. Yeast expressing ETR1 and ERS1
showed nearly identical sensitivity to 1-MCP, suggesting that the
ethylene-binding sites of ETR1 and ERS1 have similar affinities for ethylene.
 |
INTRODUCTION |
Ethylene responses in Arabidopsis
are mediated by a small family of receptors, including ETR1. The
ETR1 gene encodes a His kinase of the two-component class
prevalent in bacterial and some eukaryotic systems (Chang et al.,
1993 ). Four ETR1-like genes have been cloned from
Arabidopsis (for review, see Johnson and Ecker, 1998 ) and cluster into
two subfamilies based on sequence similarity and overall gene
structure. Subfamily I consists of ETR1 and ERS1
(ethylene response sensor 1), whereas subfamily II consists of
ETR2, ERS2, and EIN4 (Hua et al.,
1997 ).
ETR1, the first ethylene receptor gene cloned (Chang et al.,
1993 ), was identified in a screen to identify mutants lacking the
ethylene-mediated "triple response" phenotype (Bleecker et al.,
1988 ). The N-terminal hydrophobic region of the ETR1 protein contains
three putative membrane-spanning subdomains, which form the
ethylene-binding site (Schaller and Bleecker, 1995 ; Rodriguez et al.,
1999 ). Two Cys residues, also in the N terminus of ETR1, mediate
disulfide linkage of ETR1 monomers (Schaller et al., 1995 ). The C
terminus of ETR1 is likely involved in transmitting the ethylene
signal, as this region contains both His kinase and response regulator
domains. Although His kinase activity of ETR1 has been demonstrated
(Gamble et al., 1998 ), the role of kinase activity in signaling is
still unclear. Two hybrid and in vitro binding assays have shown that
C-terminal regions of both ETR1 and ERS1 interact with CTR1 (Clark et
al., 1998 ), a raf-like kinase that negatively regulates ethylene
responses (Kieber et al., 1993 ). Therefore, CTR1 may be directly
modulated by the ethylene receptors.
Biochemical analysis has shown that yeast transformed with the
ETR1 gene contain high-affinity ethylene-binding sites and that binding is saturable (Schaller and Bleecker, 1995 ). A structural model of the ethylene-binding domain of ETR1 predicts that a copper ion, coordinated by amino acids within the N-terminal hydrophobic domain, mediates ethylene binding to ETR1 (Rodriguez et al., 1999 ). Mutant forms of ETR1 have been expressed in yeast and tested
for ethylene-binding activity (Schaller and Bleecker, 1995 ; Hall et al., 1999 ; Rodriguez et al., 1999 ). These studies have shown that some
of the dominant mutations in ETR1 abolish ethylene binding by the receptor, whereas other mutations do not affect ethylene binding
but may affect receptor signaling (Hall et al., 1999 ). Mutational
analysis so far has implicated the first two transmembrane domains in
forming the ethylene-binding site, as all mutations that abolish
ethylene binding are localized to these domains (Schaller and Bleecker,
1995 ; Hall et al., 1999 ).
All mutations that have been isolated in the ETR1 gene
family that cause an ethylene-insensitive phenotype are genetically dominant. Although no dominant ethylene-insensitive mutants of ERS1 or ERS2 have been isolated, mutant forms of
these genes introduced transgenically into plants also confer dominant
ethylene insensitivity (Hua et al., 1995 ; Hua et al., 1998 ). These
experiments, as well as the observation that single loss-of-function
mutants in four of the five ETR1 family members show normal
sensitivity to ethylene, suggest that the ETR1 family
members may at least partially possess overlapping functions in
ethylene perception and signaling (Hua and Meyerowitz, 1998 ). Double
and triple loss-of-function mutants show a constitutive
ethylene-response phenotype, consistent with a model in which the
ethylene receptors are negative regulators of the ethylene-response
pathway (Hua and Meyerowitz, 1998 ).
However, a question remaining unresolved is how each ethylene receptor
isoform contributes to ethylene perception and signaling. Although the
genetic evidence indicates the proteins are functionally redundant,
several lines of evidence suggest the five isoforms may not possess
entirely equivalent activities. For example, the degeneracy of the
kinase domains in ETR2, EIN4, and ERS2
and lack of response regulator domains in ERS1 and
ERS2 indicate that each protein may play a slightly
different role in the plant. Furthermore, the mRNA expression patterns
of the ETR1 family members in Arabidopsis on the whole
overlap, but there are some differences in their mRNA expression
patterns (Hua et al., 1998 ). In addition, mRNA expression levels of
ERS1, ETR2, and ERS2 are up-regulated
by ethylene (Hua et al., 1998 ), but the significance of this
up-regulation is unknown.
In this study we sought to clarify the role of ERS1 in ethylene
signaling through a biochemical characterization of the ERS1 protein.
Because ERS1 is most highly conserved with ETR1,
we focused on determining if ERS1 is an ethylene-binding protein, and
if so, how its binding characteristics compared with the ETR1 ethylene receptor.
 |
RESULTS |
Analysis of Transgenic Yeast Expressing ERS1
Of the four ETR1-like genes in Arabidopsis,
ERS1 is the most closely related to ETR1. As
shown in Figure 1A, ERS1
shares structural similarities to ETR1, containing an
N-terminal hydrophobic region followed by a His kinase domain, but
lacks a C-terminal response regulator domain. Similar to ETR1, the
amino-terminal region of ERS1 is predicted to contain three
membrane-spanning domains.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 1.
Expression of ETR1 and ERS1 in yeast. A, Structure
of ETR1 and ERS1. Hydrophobic, GAF, His kinase, and response
regulator domains are indicated. Regions used for generating
domain-specific antibodies are also indicated. B, Western blot with
ERS1 antibody. Membrane fractions were isolated from yeast expressing
ETR1, ERS1, or transformed with vector alone. Samples were incubated in
the absence ( ) or presence (+) of 100 mM dithiothreitol
(DTT) for 1 h at 37°C, then subjected to SDS-PAGE. Positions of
the ERS1 monomer and dimer are indicated. C, Western blot with ETR1
antibody. The same membrane fractions used in B were probed with the
ETR1-HRR antibody. Positions of the ETR1 monomer and dimer are
indicated.
|
|
To begin a biochemical characterization of ERS1, a cDNA clone
containing the full-length ERS1 gene was isolated from
Arabidopsis and expressed in yeast under the control of a constitutive
ADH1 promoter. This system has previously been used to biochemically characterize the ethylene-binding site of the ETR1 protein (Schaller and Bleecker, 1995 ; Hall et al., 1999 ). ERS1 protein expression was
then analyzed by western blot. As shown in Figure 1B, a polyclonal antibody generated against an Escherichia coli-expressed
portion of ERS1 (amino acids 133-332) specifically recognizes a
polypeptide in membrane fractions isolated from yeast transformed with
the ERS1 construct. The calculated molecular mass of
the polypeptide identified is 68 kD, consistent with the predicted
size of the ERS1 protein based on amino acid sequence. This polypeptide
is not present in control yeast transformed with vector alone or yeast
transformed with a similar construct containing the ETR1 gene.
We found that the antibodies generated against ERS1 showed some
cross-reactivity with ETR1, detecting a 79-kD protein in extracts prepared from yeast expressing ETR1 (Fig. 1B). The anti-ERS1 antibodies were generated against a region of ERS1 that shows 70% identity with
ETR1. We did not see any cross-reactivity with the anti-ETR1 antibodies
(Fig. 1C) generated against a region of ETR1 that shows 53% identity
with ERS1.
The ERS1 protein migrated on SDS-PAGE gels at two different molecular
masses, depending on treatment with reducing agent (Fig. 1B). In the
presence of the reducing agent DTT, ERS1 migrated at 68 kD, whereas in
the absence of reducing agent, the protein migrated at 130 kD. The
sensitivity of the ERS1 protein to reducing agent is similar to ETR1,
which forms a 147-kD disulfide-linked dimer in both plant and yeast
membranes and can be converted to a 79-kD monomer in the presence of
DTT (Schaller et al., 1995 ). These data indicate that ERS1, like ETR1,
is capable of forming a disulfide-linked dimer.
Yeast Expressing the ERS1 Protein Binds Ethylene
To determine if ERS1 is an ethylene-binding protein, in vivo
[14C]ethylene-binding assays were carried out
with transgenic yeast cells expressing the full-length ERS1 protein. As
shown in Figure 2, ethylene binding was
detected in yeast expressing ERS1. Much of the
[14C]ethylene was displaceable by competition
with unlabeled [12C]ethylene, indicating that
the binding was saturable. Control yeast transformed with vector alone
showed no saturable binding sites for ethylene. The level of ethylene
binding by yeast expressing ERS1 was significantly above background
levels but less than that detected in yeast expressing ETR1. The
finding that both yeast expressing ETR1 and ERS1 bind ethylene
indicates that both ETR1 and ERS1 could serve as ethylene receptors in
Arabidopsis.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 2.
Ethylene binding by yeast expressing ETR1 or ERS1.
Transgenic yeast was incubated with 0.07 µL
L 1 [14C]ethylene (gray
bars), or with 0.07 µL L 1
[14C]ethylene and 1,000 µL
L 1 [12C]ethylene (white
bars). The difference between these two values represents the saturable
binding. Samples were run in triplicate, and SD are shown.
Yeast transformed with empty vector were used as a control.
|
|
Comparison of Protein Expression Levels between Yeast Expressing
ERS1-Glutathione S-Transferase (GST) and
ETR1-GST
Differences in the amount of ethylene binding by yeast expressing
ETR1 and ERS1 (Fig. 2) could reflect either a difference in affinity
for ethylene or different expression levels of the proteins. In order
to distinguish between these possibilities, we examined the expression
levels of ETR1 and ERS1 in the transgenic yeast system. To directly
compare protein expression levels on the same western blots, GST
fusions of both ETR1 and ERS1 were constructed, and anti-GST antibodies
were used for immunodetection. As shown in Figure
3A, the ETR1-GST(1-400)
construct included the first 400 amino acids of ETR1, followed by a
C-terminal GST tag. The ERS1-GST(1-520) construct included
the first 520 amino acids of ERS1 also fused to a C-terminal GST tag.
Constructs encoding a truncation of the ETR1 protein fused to a
C-terminal GST tag have been previously shown to retain the ability to
bind ethylene and localize to yeast membrane fractions, which is
similar to full-length ETR1 (Rodriguez et al., 1999 ).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 3.
Protein expression level comparisons between
ETR1-GST(1-400) and ERS1-GST(1-520). A, Domain structure of the
ETR1-GST(1-400) and ERS1-GST(1-520) constructs. Black boxes represent
transmembrane domains; gray triangles represent the GAF domain; light
gray boxes represent the kinase domain; and dark circles represent the
GST protein. B, Transgenic yeast was incubated with 0.07 µL
L 1 [14C]ethylene (gray
bars), or with 0.07 µL L 1
[14C]ethylene and 1,000 µL
L 1 [12C]ethylene (white
bars). The difference between these two values represents the saturable
binding. Samples were run in triplicate and SD are shown.
Yeast expressing a mutant form of the ETR1 gene
(etr1-1-GST[1-400]) was used as a control. Equal amounts of yeast
membranes from yeast used in the binding assays were analyzed by
western blots probed with anti-GST antibodies. Protein levels were
quantified by chemifluorescence imaging on a Storm system and are
reported as relative levels compared with the ERS1-GST(1-520) protein
level. NA, Not applicable.
|
|
As shown in Figure 3B, yeast expressing ERS1-GST(1-520) bound ethylene
at levels similar to yeast expressing the full-length ERS1 protein.
Control yeast expressing ETR1-GST(1-400) with a mutation equivalent to
etr1-1(C65Y) showed no ethylene binding above background,
confirming that the presence of the GST tag did not affect
ethylene-binding levels.
Membranes isolated from yeast used in the ethylene-binding assays were
analyzed by western blot. Western blots probed with anti-GST antibodies
and quantified with chemifluorescent imaging indicated that the
ETR1-GST(1-400) protein was expressed at levels approximately six times
that of ERS1-GST(1-520). The ERS1-GST(1-520) protein migrated as a
doublet, possibly due to proteolysis, and both bands were included in
the quantification. These data indicate that ERS1-GST(1-520) is
expressed at lower levels than ETR1-GST(1-400) and may account for the
lower levels of ethylene binding detected in yeast expressing ERS1 protein.
Effect of 1-Methylcyclopropene (1-MCP) on Ethylene
Perception
After determining that yeast expressing ETR1 and ERS1 bind
ethylene, we sought to obtain preliminary evidence comparing their relative affinities for ethylene. To do so, we examined the effects of
the competitive inhibitor 1-MCP upon ethylene binding to yeast expressing ETR1 and ERS1 and upon ethylene-induced changes in Arabidopsis growth. Recently, 1-MCP has been shown to act at very low
concentrations to inhibit ethylene-induced ripening and senescence. Its
effectiveness as a competitive inhibitor is at least an order of
magnitude better than that of other unsaturated cyclic olefins, such as
trans-cyclooctene and 2,5-norbornadiene (Sisler et al., 1996a , 1996b ;
Sisler and Serek, 1999 ).
To test the effect of 1-MCP upon ethylene responses in Arabidopsis we
analyzed the ability of 1-MCP to reverse the triple response of
seedlings to ethylene. The ethylene-mediated triple response is
characterized by an inhibition of hypocotyl and root elongation, radial
swelling, and the formation of an exaggerated apical hook. As shown in
Figure 4A, ethylene at a concentration of
1 µL L 1 induces the triple response in
dark-grown Arabidopsis seedlings. Seedlings grown in the presence of 1 µL L 1 ethylene were treated with various
concentrations of 1-MCP (Fig. 4). At a concentration of 2.2 nL
L 1 the effect of 1-MCP upon ethylene responses
first becomes apparent, with complete reversal of ethylene effects at
220 nL L 1 1-MCP. The effect of 1-MCP on the
seedling-growth response was fit to the Hill equation to determine the
concentration of inhibitor required to reduce growth response to 50%
of its value in the absence of inhibitor (IC50).
This analysis yielded an IC50 of 10.6 nL
L 1 for the effect of 1-MCP. Given that the
apparent dissociation constant (Kr) of
ethylene for the hypocotyl-growth response is 0.11 µL
L 1 (Chen and Bleecker, 1995 ), the apparent
inhibition constant (KI) of 1-MCP for the
hypocotyl-growth response is 1.05 nL L 1.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 4.
1-MCP as an antagonist of ethylene responses in
dark-grown Arabidopsis seedlings. A, Effect of 1-MCP on the triple
response to ethylene. Representative seedlings are shown following
growth in air or 1 µL L 1 ethylene. Seedlings
labeled a through e were treated with 0, 0.22, 2.2, 22, and 220 nL
L 1 1-MCP, respectively. B, Effect of 1-MCP on
hypocotyl growth. Seedlings for wild-type ( ), etr1-1
( ), and ctr1-2 ( ) mutants, were grown in 1 µL
L 1 ethylene with the indicated amounts of
1-MCP. The mean hypocotyl length at each 1-MCP concentration is shown.
At least 20 seedlings were used for measurements at each data point,
and SD are shown.
|
|
Wild-type seedlings grown in the presence of 1-MCP look very much like
seedlings grown in air, indicating 1-MCP does not appear to have
deleterious effects upon the seedlings at the concentrations tested.
The effect of 1-MCP was also tested upon Arabidopsis seedlings carrying
the ctr1-2 mutation, which leads to a constitutive ethylene response in the presence or absence of ethylene. 1-MCP was not able to
reverse the effects of the ctr1-2 mutation (Fig. 4B); ctr1-2 plants still showed the triple response phenotype at
concentrations of 1-MCP that reversed the ethylene effects upon
wild-type plants. This result is consistent with a model in which the
effects of 1-MCP occur upstream of ctr1-2 in the ethylene
signal transduction pathway with a direct effect upon the receptor.
We examined the effects of 1-MCP upon
[14C]ethylene binding to transgenic yeast
expressing either the ETR1 or the ERS1 genes. As
shown in Figure 5, 1-MCP proved to be an
effective inhibitor of ethylene binding in both cases with maximal
inhibition of ethylene binding reached at 220 nL
L 1. Yeast expressing either ETR1 or ERS1
demonstrated almost identical kinetics for inhibition of ethylene
binding by 1-MCP with an IC50 of 31.6 nL
L 1 and 37.9 nL L 1,
respectively. The dissociation constant
(Kd) for binding of ethylene to transgenic
yeast expressing the ETR1 gene is 0.036 µL
L 1 (Schaller and Bleecker, 1995 ). Thus, 1-MCP
has a KI of 10.7 nL L 1 in the ethylene-binding assay with ETR1. A
Kd value for binding of ethylene to
transgenic yeast expressing ERS1 could not be determined due to the low
level of ethylene binding.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 5.
1-MCP as an antagonist of ethylene binding in
yeast expressing ETR1 or ERS1. Saturable ethylene binding of yeast
expressing ETR1 or ERS1 was determined at 0.07 µL
L 1 [14C]ethylene in the
presence of the indicated levels of 1-MCP. In the absence of 1-MCP, the
ETR1 sample bound 3,028 dpm/g yeast, and the ERS1 sample bound 341 dpm/g yeast. Samples were run in triplicate, and SD are
shown.
|
|
 |
DISCUSSION |
Studies of ethylene signaling in Arabidopsis indicate that
receptor gene families in plants may function similar to many of their
animal counterparts, increasing their flexibility at responding to
complex environments. In Arabidopsis, genetic evidence initially suggested that ethylene responses were mediated by a gene family. Dominant point mutations in at least three genes resulted in
ethylene-insensitive plants all showing similar phenotypes although to
different degrees. Subsequent cloning of ETR1 (Chang et al.,
1993 ), ETR2 (Sakai et al., 1998 ), and EIN4 (Hua
et al., 1998 ) confirmed that these genes constituted a gene family
similar to prokaryotic two-component His kinase regulators.
The observation that loss-of-function mutants of ETR1,
ETR2, EIN4, and ERS2 show
normal ethylene responsiveness has provided further genetic
evidence that the ETR1 receptor family possess at least partially
overlapping functions (Hua and Meyerowitz, 1998 ). A
constitutive ethylene-response phenotype at the seedling stage only
emerges in the double mutants and is accentuated in triple and
quadruple mutants. This phenotype is consistent with a model for
ethylene signaling in which the ethylene receptors in an unbound state
are negative regulators of the ethylene response pathway, and ethylene
binding relieves this repression (Hua and Meyerowitz, 1998 ). However,
not all double mutant combinations show the same alterations in
ethylene responses, suggesting that the five receptor isoforms may
differ qualitatively or quantitatively in their contribution to the
seedling triple response.
In this paper we have begun to define the biochemical characteristics
of the ERS1 protein to understand its specific role in ethylene
signaling and identify biochemical similarities and differences between
the ethylene receptor isoforms. Using a yeast expression system and in
vivo ethylene-binding assays we have shown that ERS1, like
ETR1, encodes an ethylene-binding protein. This is
consistent with the high amino acid conservation between the proteins,
including all residues known to be essential for ethylene binding to
ETR1. It will be interesting to determine if the members of subfamily
II (ETR2, ERS2, and EIN4) also are able to bind ethylene and if they do
so with similar kinetics to ETR1 and ERS1. The subfamily II genes
contain a fourth hydrophobic segment at their N termini, and it is
unclear if this hydrophobic stretch of amino acids serves as a signal
sequence or a fourth transmembrane domain, which could have
implications for altering the ethylene-binding site.
In addition we have shown that the ERS1 protein forms a
membrane-associated disulfide-linked dimer, which is another
characteristic shared with ETR1. ETR1 forms a dimer in both plant and
yeast membranes, and this linkage is mediated by two Cys residues in
the extreme N terminus of the protein (Cys-4 and Cys-6) (Schaller et
al., 1995 ). These two cysteines are conserved in ERS1, as
well as in the other three ETR1-like genes. However,
neighboring residues are not conserved, further suggesting these two
cysteines play an important role in receptor structure or function. The
finding that both ETR1 and ERS1 form dimers is significant because this indicates that they may function similarly to the bacterial sensor proteins in which the kinase domain of one monomer phosphorylates a
conserved His residue in trans on the other monomer (Parkinson, 1993 ).
In addition since both ERS1 and ETR1 form homodimers, the possibility
exists that they might form heterodimers as well. Heterodimerization is
a means by which other receptors, such as growth factor receptors,
fine-tune signaling.
In the case of ETR1 and ERS1 several lines of data are consistent with
the two proteins containing ethylene-binding sites with similar
affinities for ethylene. Ethylene-binding assays carried out near the
Kd for ethylene binding to ETR1 (Schaller and Bleecker, 1995 ) indicated a similar stoichiometry of ethylene binding per unit expressed protein. The virtually identical sensitivity of yeast expressing ERS1 and ETR1 to the competitive inhibitor 1-MCP
also provides evidence that the two receptor isoforms have similar
binding affinities for ethylene.
The inhibitory effects of a compound on ethylene binding and action can
be quantified by the determination of an apparent KI (Sisler et al., 1990 ; Sisler, 1991 ;
Abeles et al., 1992 ). We determined an apparent
KI for 1-MCP for its effects on the
ethylene-growth response (KI = 1.05 nL
L 1, gas) and for its effects on ethylene
binding to ETR1 in transgenic yeast (KI = 10.7 nL L 1, gas). The
KI values calculated for 1-MCP in this or
any study must be viewed with caution, given that they are based on
estimated dissociation constants for ethylene that were obtained using
in vivo assays. For example, synthesis and turnover of receptor protein over the course of the assays could have a direct influence on the
Kd values obtained in both the plant and
yeast systems. The apparent dissociation constant for the response
(Kr) obtained from seedling dose-response
analysis is even more subject to deviation from the true
Kd for ethylene at the receptor due to the
number of possible rate-limiting steps between ethylene perception and physiological response (for discussion, see Chen and Bleecker, 1995 ).
Incorrect estimates of the Kd for ethylene
would lead to incorrect values for the KI
for 1-MCP.
These caveats notwithstanding, the 10-fold lower apparent
KI for 1-MCP in the ethylene-mediated
growth response, relative to the KI value
calculated for 1-MCP in the ethylene binding to yeast expressing ETR1,
indicates that 1-MCP is a much more effective inhibitor of ethylene
responses than is predicted by its inhibitory effect on ethylene
binding to the receptor. The greater sensitivity of the plant response
to inhibition by 1-MCP is consistent with the effects of dominant
mutations in the ethylene receptors on ethylene responses. According to
the inverse agonist model for ethylene action, dominant point mutations
in any one of the ethylene receptor genes are apparently sufficient to
keep enough receptors consitutively active to completely repress
ethylene responses. If the mechanism of inhibition by 1-MCP worked in a
similar manner, binding of 1-MCP to a subset of receptors would be
sufficient to constitutively activate enough receptors to keep the
system repressed and ethylene responses off.
Although our data indicate ETR1 and ERS1 share similar biochemical
properties at the level of signal perception, they do have important
structural differences that may result in quantitative differences in
signaling. ERS1 is lacking the response regulator domain
found in ETR1, ETR2, and EIN4. This
structural difference may certainly have consequences on signaling to
downstream effectors, since the response regulator domain is often
involved in phosphate transfer in other well-characterized signaling
pathways. Whereas yeast two hybrid experiments have shown that
the kinase domain of ERS1 interacts with CTR1, it does so with less
affinity than ETR1 (Clark et al., 1998 ). This difference may also have
implications on downstream signaling, for example, by altering the
kinetics of signaling.
Another difference between ERS1 and ETR1 is that
mRNA expression of ERS1 is ethylene inducible, whereas
ETR1 mRNA expression is not (Hua et al., 1998 ).
ERS1 orthologs in tomato (NR; Wilkinson et al., 1997 ) and
Rumex (RP-ERS1; Vriezen et al., 1997 ) are also ethylene inducible,
whereas the corresponding ETR1 orthologs are not. In Rumex
and tomato, the increase in ERS1 mRNA parallels increasing tissue
sensitivity to ethylene, and in melon it parallels fruit enlargement
(Sato-Nara et al., 1999 ). The negative regulator model of ethylene
receptor function leads to the prediction that up-regulation of ERS1
mRNA expression by ethylene would down-regulate ethylene responses.
Given that the half-life for release of ethylene bound to yeast
expressing ETR1 is 11 h (Schaller and Bleecker, 1995 ), new
receptor synthesis may be a means to reactivate CTR1 and thus attenuate
ethylene responses when ethylene levels decrease.
Many questions still remain to be answered to fully understand how
ethylene responses are coordinately controlled by the five ethylene
receptor isoforms. The isolation of an ERS1 loss-of-function mutant will help clarify the role of ERS1 in ethylene
signaling and will be useful in determining if ERS1 has any
ethylene-independent functions in Arabidopsis. In addition it will be
interesting to determine if ERS1 is indeed an active His kinase, how
this activity contributes to its function, and the consequences a lack
of a response regulator has on ERS1 activity.
 |
MATERIALS AND METHODS |
Plasmid Constructions
To obtain a cDNA clone of ERS1, a probe was
generated by PCR using Arabidopsis genomic DNA as template and primers
specific for the first exon of ERS1. The 5' primer was
GAGACGCATGTGAATCAAGATGA and the 3' primer was GAGGTATGTGCATAGCTTGAG. A
cDNA clone containing the complete coding sequence for
ERS1 (cERS1-6A) was isolated from an
Arabidopsis cDNA library in Lambda ZAP II (Stratagene, La Jolla, CA;
Kieber et al., 1993 ). This was converted into the pBluescript
SK+ (Stratagene) plasmid and used for subsequent
ERS1 constructs.
For expression in yeast, the vector pYcDE-2 was used (Hadfield et al.,
1986 ). This vector has a constitutive ADH1 promoter, an
EcoRI cloning site, and allows for Trp selection in
yeast. A variant of the pYcDE-2 vector was prepared by addition of a 10-mer NotI linker to the end-filled
EcoRI site, effectively replacing the
EcoRI site with a NotI cloning site. To
remove the 5'-non-coding sequence of ERS1, PCR was
performed using the cERS1-6A clone as template, with a 5' primer containing a NotI site at the
end (GAGCGGCCGCAATGGAGTCATGCGATTGTTTT) and M13-reverse primer. The PCR
product for ERS1 was digested with NotI
and cloned into pYcDE-2. Cloning of ETR1 into pYcDE-2 has been
previously described (Schaller and Bleecker, 1995 ).
For construction of the ERS1(1-520)-GST fusion protein, the GST gene
(Smith and Johnson, 1988 ) was amplified using PCR from the
PGEX-4T1 vector (Amersham-Pharmacia Biotech, Uppsala), introducing an
EcoRI site in the 5' primer
(GGGAATTCTATTCATGTCCCCTATACTAGG). A stop codon was included in the 3'
primer, followed by an EcoRI site
(GGGACTTAAGGAGTTCCACGCGGAACCGG). The GST fragment was digested with
EcoRI and cloned into the EcoRI site of
the ERS1 gene within the pYcDE-2 yeast shuttle vector.
For construction of the ETR1-GST(1-400) fusion protein, the
GST gene was PCR amplified from PGEX-4T2
(Amersham-Pharmacia Biotech), introducing an BglII site
at the 5' end and EcoRI and BamHI sites
at the 3' end. The PCR product was digested with BglII and BamHI and cloned into the BglII site
of the ETR1 gene (cETR1-5.2; Schaller and Bleecker,
1995 ). The resulting construct was digested with EcoRI,
and the 1.9-kb fusion of ETR1(1-400) with the
GST gene was gel purified and cloned into the
EcoRI site of pYcDE-2 for yeast expression.
For expression of a 6-His-tagged ERS1 fusion protein in
Escherichia coli, the vector pET-15b (Novagen, Madison,
WI) was used. PCR was carried out using the ERS1 cDNA
clone as template, a 5' primer with an NdeI site
(TAGATAGACATATGGGTCTTATTTTAA) and a 3' primer with a
BamHI site (GCCTCTTGAGGATCCTTGTCTAAAGC). The PCR product
was digested with NdeI and BamHI and
cloned into pET-15b. The cloned portion of ERS1
represents amino acids 133 to 332 of the protein.
Yeast Transformation and Growth
Constructs were transformed into yeast Saccharomyces
cerevisiae (Schiestl and Gietz, 1989 ), strain LRB520
(MAT his3leu2trp1 ura3-52yck2-1::HIS3), and
standard media and procedures used for growth (Ausubel et al.,
1994 ).
Arabidopsis Growth
Arabidopsis seedlings were grown on agar plates containing 0.5×
Murashige and Skoog basal salt mixture, pH 5.7 (Murashige and Skoog,
1962 ), 0.8% (w/v) agar, and B5 vitamins consisting of 100 mg/mL
inositol, 1 mg/mL nicotinic acid, 1 mg/mL pyridoxin HCl, and 10 mg/mL
thiamine HCl. Seeds were stratified for 4 d at 4°C, then moved
to 22°C (time 0). For light-grown seedlings, plates were kept under
continuous fluorescent light. For dark-grown seedlings, plates were
light-treated for 12 h before being moved to the dark.
Protein Isolation
For yeast membrane protein isolation, 3.0-g aliquots of yeast
were resuspended in 3.0 mL of extraction buffer (50 mM Tris [tris(hydroxymethyl)aminomethane], pH 7.5, 100 mM NaCl,
10% [v/v] glycerol, and 1% [v/v] dimethyl sulfoxide; Ausubel et
al., 1994 ). Three volumes of chilled glass beads were added to the
yeast cells. Cells were vortexed seven times (30-s intervals) with
1-min intervals on ice between vortexing. The supernatant was spun at
10,000g for 10 min at 4°C to remove cellular debris.
Membranes were pelleted at 30,000g for 30 min and
resuspended with a homogenizer (Wheaton, Millville, NJ ) in
1.2-mL assay buffer (10 mM MES
[2-(N-morpholino)-ethanesulfonic acid], pH 5.5, 20% [w/v] Suc, and 1% [v/v] dimethyl sulfoxide). This extract was
then directly added to 2× SDS-PAGE sample buffer. Protein
concentrations were determined by the Bradford method (Bradford,
1976 ), using bovine serum albumin as a standard.
Antibody Production
The ERS1-6-His fusion protein was expressed in E.
coli from the pET-15b vector according to the manufacturer
(Novagen). Inclusion bodies were purified by SDS-PAGE on 12%
(w/v) polyacrylamide gels. The protein band was excised,
electroeluted, and concentrated with Centricon 10 microconcentrators
(Amicon, Beverly, MA). Antisera were prepared from recombinant protein
by the University of Wisconsin Medical Facility, and cleared against
yeast proteins as described (Chang et al., 1992 ). Preparation of the
ETR1-HRR antibody was described previously (Schaller and Bleecker,
1995 ).
SDS-PAGE and Western Blotting
Protein samples were mixed with SDS-PAGE loading buffer (125 mM Tris, pH 6.8, 20% [v/v] glycerol, 4%
[w/v] SDS, and 0.01% [w/v] bromphenol blue) in the
presence or absence of 100 mM DTT as indicated. Samples
were incubated at 37°C for 1 h and then subjected to SDS-PAGE
using 8% (w/v) gels. Proteins were electrotransferred (12 V, 30 min) from gels to Immobilon membrane (Millipore, Milford, MA), and the
membrane was then blocked with non-fat dry milk.
For western blotting, the anti-ERS1 antibody was used at a 1:5,000
dilution, the anti-ETR1(HRR) antibody was used at a 1:5,000 dilution,
and the anti-GST (Sigma, St. Louis) antibody used at a 1:5,000
dilution. Immunodecorated proteins were visualized by chemiluminescence
according to the manufacturer's instructions (Kirkegaard and Perry,
Gaithersburg, MD). For protein quantification experiments,
immunodecorated proteins were visualized by chemifluorescence according
to the manufacturer's instructions (Amersham-Pharmacia Biotech).
Protein bands were quantified using the ImageQuant software on a STORM
Phosphorimager (Molecular Dynamics, Sunnyvale, CA).
Ethylene Binding to Transgenic Yeast
Ethylene binding experiments were performed as previously
described (Schaller and Bleecker, 1995 ; Hall et al., 1999 ), using a
modification of the method originally described by Sisler (1979) . Curve-fitting was performed using SIGMAPLOT. IC50 values
were determined by fitting data to the Hill equation using SIGMAPLOT. KI values were determined from the equation
KI = IC50/(1 + [S]/Kd).
Ethylene Treatment of Arabidopsis
For the experiment shown in Figure 4, 1-L gas-tight jars were
used. Ethylene (final concentration = 1 µL L 1) and
1-MCP (final concentrations as indicated) were introduced through an
injection port. Seedlings were grown in the dark on vertically oriented
plates and removed after 4 d of growth. Hypocotyl length was
determined using the program NIH Image (version 1.6) after first
scanning the plates using Adobe Photoshop (version 5.5) and a LaCie
scanner. Dose response data were fitted to the Hill equation (Weyers et
al., 1987 ) using SIGMAPLOT. Ethylene concentration was
determined by gas chromatography using a column of Carboxen 1000, 45/60
mesh size (Supelco, Bellefonte, PA), with ethylene as the calibration standard.
Preparation and Use of 1-MCP
1-MCP was prepared (Magid et al., 1971 ) and stored in the gas
phase in a container with saturated
(NH4)2SO4 as a seal. Concentration was determined by gas chromatography using a column of Carbopak B
(80/120 mesh size), 3% (v/v) SP1500 (Supelco) with butane as the calibration standard.
 |
ACKNOWLEDGMENTS |
We thank the University of Wisconsin-Madison Pathology
department for the use of their Storm system and Magdaly Cintron for assistance making the 6-His-tagged ERS1 construct. We thank Anita Klein
and the Bleecker laboratory for comments on the manuscript and Rick
Cote for assistance with SIGMAPLOT.
 |
FOOTNOTES |
Received December 20, 1999; accepted April 5, 2000.
1
This work was supported by the National Science
Foundation (grant nos. MCB-9603679 to G.E.S. and MCB-9513463 to
A.B.B.), by the HATCH/U.S. Department of Agriculture project
(grant no. 386 to G.E.S.), by the U.S. Department of Energy (grant no.
DE-FG02-91ER20029 to A.B.B.), and by the U.S. Department of
Energy-National Science Foundation-U.S. Department of Agriculture
Collaborative Research in Plant Biology Program (grant no. BIR92-20311
to A.E.H.).
2
These authors contributed equally to the paper.
*
Corresponding author; e-mail bleecker{at}facstaff.wisc.edu; fax
608-262-7509.
 |
LITERATURE CITED |
-
Abeles FB, Morgan PW, Salveit ME
(1992)
Ethylene in Plant Biology. Academic Press, San Diego
-
Ausubel FM, Brent R, Kingston R, Moore DD, Seidman JG, Smith JA, Strohl K
(1994)
Current Protocols in Molecular Biology. John Wiley & Sons, New York
-
Bleecker AB, Estelle MA, Somerville C, Kende H
(1988)
Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana.
Science
241: 1086-1089
[Abstract/Free Full Text]
-
Bradford MM
(1976)
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72: 248-254
[CrossRef][Web of Science][Medline]
-
Chang C, Kwok SF, Bleecker AB, Meyerowitz EM
(1993)
Arabidopsis ethylene-response gene ETR1: similarity of product to two-component regulators.
Science
262: 539-544
[Abstract/Free Full Text]
-
Chang C, Schaller GE, Patterson SE, Kwok SF, Meyerowitz E, Bleecker AB
(1992)
The TMK1 gene from Arabidopsis codes for a protein with structural and biochemical characteristics of a receptor protein kinase.
Plant Cell
4: 1263-1271
[Abstract/Free Full Text]
-
Chen QG, Bleecker AB
(1995)
Analysis of ethylene signal transduction kinetics associated with seedling-growth responses and chitinase induction in wild-type and mutant Arabidopsis.
Plant Physiol
108: 597-607
[Abstract]
-
Clark KL, Larsen PB, Wang X, Chang C
(1998)
Association of the Arabidopsis CTR1 Raf-like kinase with the ETR1 and ERS ethylene receptors.
Proc Natl Acad Sci USA
95: 5401-5406
[Abstract/Free Full Text]
-
Gamble RL, Coonfield ML, Schaller GE
(1998)
Histidine kinase activity of the ETR1 ethylene receptor from Arabidopsis.
Proc Natl Acad Sci USA
95: 7825-7829
[Abstract/Free Full Text]
-
Hadfield C, Cashmore AM, Meacock PA
(1986)
An efficient chloramphenicol-resistance marker for Saccharomyces cerevisiae and Escherichia coli.
Gene
45: 149-158
[CrossRef][Web of Science][Medline]
-
Hall AE, Chen QG, Findell JL, Schaller GE
(1999)
The relationship between ethylene binding and dominant insensitivity conferred by mutant forms of the ETR1 ethylene receptor.
Plant Physiol
121: 291-300
[Abstract/Free Full Text]
-
Hua J, Chang C, Sun Q, Meyerowitz EM
(1995)
Ethylene insensitivity conferred by Arabidopsis ERS gene.
Science
269: 1712-1714
[Abstract/Free Full Text]
-
Hua J, Meyerowitz EM
(1998)
Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana.
Cell
94: 261-271
[CrossRef][Web of Science][Medline]
-
Hua J, Sakai H, Meyerowitz EM
(1997)
The ethylene receptor family in Arabidopsis.
In
K Kanellis, H Kende, D Grierson, eds, Biology and Biotechnology of the Plant Hormone Ethylene. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 71-76
-
Hua J, Sakai H, Nourizadeh S, Chen QG, Bleecker AB, Ecker JR, Meyerowitz EM
(1998)
EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis.
Plant Cell
10: 1321-1332
[Abstract/Free Full Text]
-
Johnson PR, Ecker JR
(1998)
The ethylene gas signal transduction pathway: a molecular perspective.
Annu Rev Genet
32: 227-254
[CrossRef][Web of Science][Medline]
-
Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR
(1993)
CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases.
Cell
72: 427-441
[CrossRef][Web of Science][Medline]
-
Magid RM, Clarke TC, Duncan DD
(1971)
An efficient and convenient synthesis of 1-methylcyclopropene.
J Org Chem
36: 1320-1321
-
Murashige T, Skoog F
(1962)
A revised medium for rapid growth and bioassays with tobacco tissue culture.
Physiol Plant
15: 473-497
[CrossRef]
-
Parkinson JS
(1993)
Signal transduction schemes of bacteria.
Cell
73: 857-871
[CrossRef][Web of Science][Medline]
-
Rodriguez FI, Esch JJ, Hall AE, Binder BM, Schaller GE, Bleecker AB
(1999)
A copper cofactor for the ethylene receptor ETR1 from Arabidopsis.
Science
283: 996-998
[Abstract/Free Full Text]
-
Sakai H, Hua J, Chen QG, Chang C, Medrano LJ, Bleecker AB, Meyerowitz EM
(1998)
ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis.
Proc Natl Acad Sci USA
95: 5812-5817
[Abstract/Free Full Text]
-
Sato-Nara K, Yuhashi K-I, Higashi K, Hosoya K, Mitsuru K, Ezura H
(1999)
Stage- and tissue-specific expression of ethylene receptor homolog genes during fruit development in Muskmelon.
Plant Physiol
119: 321-329
[Abstract/Free Full Text]
-
Schaller GE, Bleecker AB
(1995)
Ethylene-binding sites generated in yeast expressing the Arabidopsis ETR1 gene.
Science
270: 1809-1811
[Abstract/Free Full Text]
-
Schaller GE, Ladd AN, Lanahan MB, Spanbauer JM, Bleecker AB
(1995)
The ethylene response mediator ETR1 from Arabidopsis forms a disulfide-linked dimer.
J Biol Chem
270: 12526-12530
[Abstract/Free Full Text]
-
Schiestl RH, Gietz RD
(1989)
High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier.
Curr Genet
16: 339-346
[CrossRef][Web of Science][Medline]
-
Sisler EC
(1979)
Measurement of ethylene binding in plant tissue.
Plant Physiol
64: 538-542
[Abstract/Free Full Text]
-
Sisler EC
(1991)
Ethylene-binding components in plants.
In
JC Suttle, ed, The Plant Hormone Ethylene. CRC Press, Boca Raton, FL, pp 81-99
-
Sisler EC, Blankenship SM, Guest M
(1990)
Competition of cyclooctenes for ethylene binding activity in plants.
Plant Growth Regul
12: 125-132
-
Sisler EC, Dupille E, Serek M
(1996a)
Effect of 1-methylcyclopropene and methylenecyclopropane on ethylene binding and ethylene action on cut carnations.
Plant Growth Regul
18: 79-86
-
Sisler EC, Serek M
(1999)
Compounds controlling the ethylene receptor.
Bot Bull Acad Sin
40: 1-7
-
Sisler EC, Serek M, Dupille E
(1996b)
Comparison of cyclopropene, 1-methylcyclopropene, and 3,3-dimethyl-cyclopropene as ethylene antagonists in plants.
Plant Growth Regul
18: 169-174
-
Smith DB, Johnson KS
(1988)
Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase.
Gene
67: 31-40
[CrossRef][Web of Science][Medline]
-
Vriezen WH, van Rijn CP, Voesenek LA, Mariani C
(1997)
A homolog of the Arabidopsis thaliana ERS gene is actively regulated in Rumex palustris upon flooding.
Plant J
11: 1265-1271
[CrossRef][Web of Science][Medline]
-
Weyers JDB, Paterson NW, Brook A
(1987)
Towards a quantitative definition of plant hormone sensitivity.
Plant Cell Environ
14: 1-12
-
Wilkinson JQ, Lanahan MB, Clark DG, Bleecker AB, Chang C, Meyerowitz EM, Klee HJ
(1997)
A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants.
Nat Biotechnol
15: 444-447
[CrossRef][Web of Science][Medline]
© 2000 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
Z. Lin, C.-W. Ho, and D. Grierson
AtTRP1 encodes a novel TPR protein that interacts with the ethylene receptor ERS1 and modulates development in Arabidopsis
J. Exp. Bot.,
June 30, 2009;
(2009)
erp209v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Gao, C.-K. Wen, B. M. Binder, Y.-F. Chen, J. Chang, Y.-H. Chiang, R. J. Kerris III, C. Chang, and G. E. Schaller
Heteromeric Interactions among Ethylene Receptors Mediate Signaling in Arabidopsis
J. Biol. Chem.,
August 29, 2008;
283(35):
23801 - 23810.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Voet-van-Vormizeele and G. Groth
Ethylene Controls Autophosphorylation of the Histidine Kinase Domain in Ethylene Receptor ETR1
Mol Plant,
March 1, 2008;
1(2):
380 - 387.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang and P. P. Kumar
Characterization of two ethylene receptors PhERS1 and PhETR2 from petunia: PhETR2 regulates timing of anther dehiscence
J. Exp. Bot.,
February 1, 2007;
58(3):
533 - 544.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-H. Cao, J. Liu, X.-J. He, R.-L. Mu, H.-L. Zhou, S.-Y. Chen, and J.-S. Zhang
Modulation of Ethylene Responses Affects Plant Salt-Stress Responses
Plant Physiology,
February 1, 2007;
143(2):
707 - 719.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Wang, J. J. Esch, S.-H. Shiu, H. Agula, B. M. Binder, C. Chang, S. E. Patterson, and A. B. Bleecker
Identification of Important Regions for Ethylene Binding and Signaling in the Transmembrane Domain of the ETR1 Ethylene Receptor of Arabidopsis
PLANT CELL,
December 1, 2006;
18(12):
3429 - 3442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bishopp, A. P. Mahonen, and Y. Helariutta
Signs of change: hormone receptors that regulate plant development.
Development,
May 1, 2006;
133(10):
1857 - 1869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-F. CHEN, N. ETHERIDGE, and G. E. SCHALLER
Ethylene Signal Transduction
Ann. Bot.,
May 1, 2005;
95(6):
901 - 915.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. F. Millenaar, M. C.H. Cox, Y. E.M. d. J. van Berkel, R. A.M. Welschen, R. Pierik, L. A.J.C. Voesenek, and A. J.M. Peeters
Ethylene-Induced Differential Growth of Petioles in Arabidopsis. Analyzing Natural Variation, Response Kinetics, and Regulation
Plant Physiology,
March 1, 2005;
137(3):
998 - 1008.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Chang and A. B. Bleecker
Ethylene Biology. More Than a Gas
Plant Physiology,
October 1, 2004;
136(2):
2895 - 2899.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Binder, L. A. Mortimore, A. N. Stepanova, J. R. Ecker, and A. B. Bleecker
Short-Term Growth Responses to Ethylene in Arabidopsis Seedlings Are EIN3/EIL1 Independent
Plant Physiology,
October 1, 2004;
136(2):
2921 - 2927.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Binder, R. C. O'Malley, W. Wang, J. M. Moore, B. M. Parks, E. P. Spalding, and A. B. Bleecker
Arabidopsis Seedling Growth Response and Recovery to Ethylene. A Kinetic Analysis
Plant Physiology,
October 1, 2004;
136(2):
2913 - 2920.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-G. Zhang, H.-L. Zhou, T. Chen, Y. Gong, W.-H. Cao, Y.-J. Wang, J.-S. Zhang, and S.-Y. Chen
Evidence for Serine/Threonine and Histidine Kinase Activity in the Tobacco Ethylene Receptor Protein NTHK2
Plant Physiology,
October 1, 2004;
136(2):
2971 - 2981.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. E. Hall and A. B. Bleecker
Analysis of Combinatorial Loss-of-Function Mutants in the Arabidopsis Ethylene Receptors Reveals That the ers1 etr1 Double Mutant Has Severe Developmental Defects That Are EIN2 Dependent
PLANT CELL,
September 1, 2003;
15(9):
2032 - 2041.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q.-H. Ma and X.-M. Wang
Characterization of an ethylene receptor homologue from wheat and its expression during leaf senescence
J. Exp. Bot.,
May 1, 2003;
54(386):
1489 - 1490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Wang, A. E. Hall, R. O'Malley, and A. B. Bleecker
Canonical histidine kinase activity of the transmitter domain of the ETR1 ethylene receptor from Arabidopsis is not required for signal transmission
PNAS,
January 7, 2003;
100(1):
352 - 357.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. C. J. VOESENEK, J. J. BENSCHOP, J. BOU, M. C. H. COX, H. W. GROENEVELD, F. F. MILLENAAR, R. A. M. VREEBURG, and A. J. M. PEETERS
Interactions Between Plant Hormones Regulate Submergence-induced Shoot Elongation in the Flooding-tolerant Dicot Rumex palustris
Ann. Bot.,
January 2, 2003;
91(2):
205 - 211.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-C. Zhao, X. Qu, D. E. Mathews, and G. E. Schaller
Effect of Ethylene Pathway Mutations upon Expression of the Ethylene Receptor ETR1 from Arabidopsis
Plant Physiology,
December 1, 2002;
130(4):
1983 - 1991.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-T. Cho and D. J. Cosgrove
Regulation of Root Hair Initiation and Expansin Gene Expression in Arabidopsis
PLANT CELL,
December 1, 2002;
14(12):
3237 - 3253.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-W. Park, C. B. Lawrence, J. C. Linden, and J. M. Vivanco
Isolation and Characterization of a Novel Ribosome-Inactivating Protein from Root Cultures of Pokeweed and Its Mechanism of Secretion from Roots
Plant Physiology,
September 1, 2002;
130(1):
164 - 178.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Cancel and P. B. Larsen
Loss-of-Function Mutations in the Ethylene Receptor ETR1 Cause Enhanced Sensitivity and Exaggerated Response to Ethylene in Arabidopsis
Plant Physiology,
August 1, 2002;
129(4):
1557 - 1567.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Xie, Z.-G. Zhang, J.-S. Zhang, X.-J. He, W.-H. Cao, S.-J. He, and S.-Y. Chen
Spatial Expression and Characterization of a Putative Ethylene Receptor Protein NTHK1 in Tobacco
Plant Cell Physiol.,
July 15, 2002;
43(7):
810 - 815.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Hwang, H.-C. Chen, and J. Sheen
Two-Component Signal Transduction Pathways in Arabidopsis
Plant Physiology,
June 1, 2002;
129(2):
500 - 515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L.-C. Wang, H. Li, and J. R. Ecker
Ethylene Biosynthesis and Signaling Networks
PLANT CELL,
May 1, 2002;
14(90001):
S131 - 151.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Takahashi, T. Kobayashi, K. Sato-Nara, K.-o Tomita, and H. Ezura
Detection of ethylene receptor protein Cm-ERS1 during fruit development in melon (Cucumis melo L.)
J. Exp. Bot.,
March 1, 2002;
53(368):
415 - 422.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. B. Larsen and C. Chang
The Arabidopsis eer1 Mutant Has Enhanced Ethylene Responses in the Hypocotyl and Stem
Plant Physiology,
February 1, 2001;
125(2):
1061 - 1073.
[Abstract]
[Full Text]
|
 |
|
|
|