Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (89)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Estévez, J. M.
Right arrow Articles by León, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Estévez, J. M.
Right arrow Articles by León, P.
Agricola
Right arrow Articles by Estévez, J. M.
Right arrow Articles by León, P.

Plant Physiol, September 2000, Vol. 124, pp. 95-104

Analysis of the Expression of CLA1, a Gene That Encodes the 1-Deoxyxylulose 5-Phosphate Synthase of the 2-C-Methyl-D-Erythritol-4-Phosphate Pathway in Arabidopsis1

Juan M. Estévez, Araceli Cantero, Cynthia Romero, Hiroshi Kawaide, Luis F. Jiménez, Tomohisa Kuzuyama, Haruo Seto, Yuji Kamiya, and Patricia León*

Departamento de Biología Molecular de Plantas, Instituto de Biotecnología, Universidad Nacional Autónoma de México, Avenida Universidad 2001 Chamilpa, Apdo Postal 510-3 Cuernavaca Morelos 62271, México (J.M.E., A.C., C.R., P.L.); Frontier Research Program, Institute of Physical and Chemical Research (RIKEN), Hirosawa 2-1, Wako-shi, Saitama, 351-0198, Japan (H.K., Y.K.); Laboratorio de Microscopía Electrónica, Facultad de Ciencias, Universidad Nacional Autónoma de México, México (L.F.J.); and Institute of Molecular and Cellular Biosciences, University of Tokyo, Bunkyo-ku, Tokyo 113-0032, Japan (T.K., H.S.)


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

The discovery of the 2-C-methyl-D-erythritol-4-phosphate pathway for the biosynthesis of isoprenoids raises the important question of the nature and regulation of the enzymes involved in this pathway. CLA1, a gene previously isolated from Arabidopsis, encodes the first enzyme of the 2-C-methyl-D-erythritol-4-phosphate pathway, 1-deoxy-D-xylulose-5-phosphate synthase. We demonstrate this enzyme activity by complementation of the cla1-1 mutant phenotype and by direct enzymatic assays. Based on mRNA and protein expression patterns this enzyme is expressed mainly in developing photosynthetic and non-photosynthetic tissues. The beta -glucuronidase expression pattern driven from the CLA1 gene regulatory region supports the northern and protein data while also showing that this gene has some level of expression in most tissues of the plant. A mutation in the CLA1 gene interferes with the normal development of chloroplasts and etioplasts, but does not seem to affect amyloplast structure. Microscopic analysis also shows a pleiotropic effect of the CLA1 gene mutation in mesophyll tissue formation.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

In higher plants isoprenoids are derived from isopentenyl diphosphate (IPP) and synthesized in at least two different compartments, the cytoplasm and the chloroplast. For a long time it was assumed that IPP was synthesized exclusively by the mevalonate pathway in all organisms (Spurgeon and Porter, 1981; Goldstein and Brown, 1990). However, independent studies have demonstrated that in eubacteria, green algae, and plants, IPP is also synthesized by a non-mevalonate pathway designated as the 2-C-methyl-D-erythritol-4-P (MEP) pathway (for review, see Rohmer, 1998, 1999; Lichtenthaler, 1999). Thus in plants cytosolic IPP is synthesized by the mevalonate pathway and plastidic IPP is synthesized by the MEP pathway (Lichtenthaler, 1999). In the MEP pathway IPP is synthesized from pyruvate and glyceraldehyde-3-P via novel intermediates (Rohmer et al., 1993; Eisenreich et al., 1996; Schwender et al., 1996; Lichtenthaler et al., 1997). Labeling and nuclear magnetic resonance studies showed that 1-deoxyxylulose 5-P (DXP) is the first intermediate in this pathway (Roh-mer et al., 1996; Arigoni et al., 1997). Genes encoding for the first enzyme in this pathway, DXP synthase, were isolated from several organisms and the enzymatic activity of their encoded proteins has been corroborated (Sprenger et al., 1997; Bouvier et al., 1998; Lange et al., 1998; Lois et al., 1998; Lichtenthaler, 1999). In addition to its role in IPP synthesis the DXP synthase in plants, as in Escherichia coli, seems also to be required for the synthesis of thiamin and pyridoxol (Julliard and Douce, 1991; Hill et al., 1996). The next gene involved in the MEP pathway has been isolated from E. coli, peppermint, and Arabidopsis (Takahashi et al., 1998; Lange and Croteau, 1999; Schwender et al., 1999). It encodes an enzyme that converts DXP to MEP (Takahashi et al., 1998). Finally a third intermediate product has been recently postulated, as 4-(cytidine- 5'-diphospho)-2-C-methyl-D-erythritol. This product is synthesized from MEP by an enzyme encoded by the ygbP gene from E. coli (Rohdich et al., 1999). Independently of this study we have proved that the latter intermediate is essential for the formation of IPP (Kuzuyama et al., 2000a).

The production of specific chloroplastic isoprenoids such as carotenoids and phytol has now been demonstrated to depend on the MEP pathway (Eisenreich et al., 1996; Arigoni et al., 1997; Knöss et al., 1997; Lichtenthaler et al., 1997; Zeidler et al., 1997). Thus the analysis of the regulation of the enzymes in the MEP pathway is important in understanding the biosynthesis and possible manipulation of such terpenoids in plants. The isolation of albino plant mutants in Arabidopsis resulted in the identification of a gene required for the synthesis of both chlorophyll and carotenoids, named CLA1 (Mandel et al., 1996). In the cla1-1 mutant plastid development is impaired at an early stage resulting in almost no thylakoid membrane proliferation; the plastids resemble an early proplastid stage. CLA1 is a single gene in the Arabidopsis genome and its disruption affects the expression of both nuclear- and chloroplast-encoded photosynthetic genes (Mandel et al., 1996). The CLA1 protein sequence has extensive identity with other reported DXP synthases.

In this report we demonstrate that the CLA1 gene encodes a functional DXP synthase. To understand the regulation of this gene, we performed a detailed analysis of the CLA1 gene mRNA expression and protein patterns. We show that the CLA1 gene transcripts and protein preferentially accumulate in young developing tissues. The microscopic analysis of different plastids in the cla1-1 mutant demonstrates that the disruption of the CLA1 gene affects the morphology of chloroplasts and etioplasts and alters the final stages of cellular morphogenesis in mesophyll tissue formation.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

The Albino Phenotype of the cla1-1 Plant Can Be Rescued by the Addition of 1-Deoxy-D-Xylulose (DX)

The extensive amino acid similarity of the CLA1 gene to the published DXP synthases (Sprenger et al., 1997; Bouvier et al., 1998; Lange et al., 1998; Lois et al., 1998; Lichtenthaler, 1999) suggested that the CLA1 gene could encode a DXP synthase. To test whether the CLA1 protein functions as a DXP synthase we took advantage of the albino phenotype in the cla1-1 mutant. Synthetic DX, a non-phosphorylated version of the product of the DXP synthase, was supplemented on the growth medium of cla1-1 plants. This product was used to ensure penetration into the plant cells, as it was demonstrated to be efficiently incorporated into plastidic isoprenoids (Arigoni et al., 1997; Zeidler et al., 1997). As the cla1-1 mutation is lethal on soil, seed stocks are maintained as heterozygotes. Upon selfing, one-quarter of the progeny are albino on medium. After germination, such albino homozygous mutant plants were selected and transferred to plates containing 0.02% (w/v) DX. The development of these plants was assessed by visual inspection and their pigment content was quantified.

As shown in Figure 1, the first true leaves of the cla1-1 plants grown in germination media (GM) media developed the albino phenotype characteristic of this mutant (Fig. 1, A, right side and D). In contrast, cla1-1 plants grown on the same media supplemented with DX turned green (Fig. 1, A [middle plant] and C). For comparison, a Wassilewskija (WS) wild-type plant grown in GM media is shown in the left side of Figure 1, A and B. This green phenotype correlates with a substantial increase in chlorophyll and carotenoid content of the cla1-1 plants supplemented with DX compared with the ones grown in GM media (Table I). Greening observed in the leaves of the cla1-1 plants supplemented with DX is specific for this mutant, as other unrelated albino plants such as alb1-1 and alb2-1 (van der Veen and Blankenstijn de Vries, 1973; Relichova, 1976) remain albino (data not shown). The cla1-1 cotyledons have the capacity to respond to DX, but only upon direct exposure to this chemical during seed imbibition. We noticed however that DX at the concentration used in these experiments (0.02%) has a toxic effect in the early stages of development, as we detected yellowish seedlings in cla1-1 and wild-type plants when this compound was present during germination (data not shown).



View larger version (127K):
[in this window]
[in a new window]
 
Figure 1.   In vivo complementation of the albino phenotype in the cla1-1 seedlings by DX. A, Phenotypic analysis of 10-d-old seedlings of wild type grown on GM medium (left); cla1-1 grown on GM medium supplemented with 0.02% (w/v) of DX (center); and cla1-1 grown on GM medium (right). The arrow indicates the first pair of leaves on the DX supplemented mutant plant, where a green phenotype is clearly visible. An upper view is shown for a wild-type plant grown on GM medium (B), a 15-d-old cla1-1 seedling grown on GM medium supplemented with 0.02% (w/v) DX (C) in which the two pairs of true leaves can be seen, and a 15-d-old cla1-1 seedling grown on GM medium (D).


                              
View this table:
[in this window]
[in a new window]
 
Table I.   Pigment quantification

Pigments were extracted from 15-d-old plants grown in GM or GM supplemented during 10 d with 0.02% DX.

The biochemical function of the recombinant CLA1 protein was also examined in vitro. The GST-CLA1 fusion protein expressed in E. coli was used to test for DXP synthase activity. The product obtained after incubation of pyruvate and glyceraldehyde-3-P with the CLA1 protein was treated with alkaline phosphatase and its identity was analyzed by gas chromatography-mass spectrometry (GC-MS) as the trimethylsilylated derivative. As shown in Table II the product obtained from this reaction were determined to be DX and are in agreement with the previously reported for peppermint DXP synthase (Lange et al., 1998).


                              
View this table:
[in this window]
[in a new window]
 
Table II.   Identification of DX obtained by incubation of pyruvate/glyceraldehyde-3-P with CLA1 protein

Tissue- and Organ-Specific Expression of the CLA1 Gene in Arabidopsis

Although considerable information has been accumulated recently on the MEP pathway in plants, the expression pattern and regulation of the enzymes participating in this pathway are presently unknown. We decided to study the CLA1 gene expression pattern at the mRNA and protein levels. The RNA-blot hybridization data presented in Figure 2A demonstrate that the CLA1 mRNA is detected in all tissues examined, including non-photosynthetic tissues such as roots. CLA1 gene transcripts are especially abundant in seedlings (Fig. 2A, lanes 1 and 7) and in flower buds compared with the other organs analyzed (Fig. 2A, lane 5).



View larger version (55K):
[in this window]
[in a new window]
 
Figure 2.   Analysis of CLA1 gene transcript and protein accumulation in Arabidopsis plants. A, RNA-blot analysis of the CLA1 transcript. Five micrograms of total RNA was purified from 15-d-old wild-type seedlings (lane 1), cla1-1 plants (lane 2), and different tissues of wild-type plants including mature leaves (lane 3), cauline leaves (lane 4), buds (lane 5), roots (lane 6), and 5-d-old seedlings (lane 7). The probes used were CLA1 and RBCS, as well as rRNA as an RNA-loading control as indicated in the left side of the panel. B, CLA1 protein accumulation in different tissues. Western-blot analyses were performed using total protein extracts obtained from 15-d-old cla1-1 seedlings (lane 1), 15-d-old wild-type seedlings (lane 2), young rosette leaves (lane 3), mature rosette leaves (lane 4), roots (lane 5), 24-h-imbibed seeds (lane 6), flowers (lane 7), and immature siliques (lane 8). Fifteen micrograms of total protein extracts was loaded in each lane except for roots and seeds, where 30 and 45 µg was used, respectively. C, CLA1 protein developmental expression. Western-blot analysis shows CLA1 protein accumulation in 15-d-old cla1-1 seedlings (lane 1), 5-d-old (lane 2), 8-d-old (lane 3), 15-d-old (lane 4), 20-d-old (lane 5), and 25-d-old (lane 6) wild-type seedlings. In each lane, 15 µg of total protein was loaded.

To obtain more insight into the participation of this gene in Arabidopsis development we investigated its expression pattern using a beta -glucuronidase (GUS) reporter gene construct. A 1.4-kb upstream region from the CLA1 gene initiation codon was used to generate a translational fusion with the GUS reporter gene uidA. Eight independent transgenic plants from the T2 generation were analyzed for GUS expression. Although some variation in the intensity of staining was observed among the lines carrying this construct, all of them showed the same GUS staining pattern. According to the pattern observed the CLA1 gene is expressed very early in germinating seeds. As shown in Figure 3A, GUS activity was detected in the protruding root (with the exception of the root cap) 48 h after water imbibition. In 3-d-old seedlings (Fig. 3B), GUS is detected primarily in the hypocotyl and in the emerging cotyledons with faint staining in the root. In 5-d-old seedlings, GUS activity is detected in most of the plant, the cotyledons, the hypocotyl, and the root (Fig. 3C). In older seedlings, GUS staining is especially strong in the expanding leaves, including vascular tissue and trichomes (Fig. 3D), but a faint staining in the hypocotyl and root is also present. A transverse section of the inflorescence showed GUS activity in most of the cells: in the epidermis, including the trichomes, and in the cortex, vascular tissue, and pith (Fig. 3F). In the silique, GUS staining is observed in the locules and in the funiculus, but there is no expression detected in immature seeds (Fig. 3E). In the flower, GUS staining is intense in the sepals and the stamens (Fig. 3G), whereas in the petals, GUS activity is faint. Within carpels, staining is mostly restricted to the upper part of the stigma and in the stigmatic papillae (Fig. 3, G and H).



View larger version (93K):
[in this window]
[in a new window]
 
Figure 3.   Histochemical analyses of GUS activity in Arabidopsis plants expressing the GUS gene under the control of the CLA1 gene promoter. A, Water-imbibed (48-h) germinating seeds; B, 3-d-old seedlings; C, 5-d-old seedlings; D, 15-d-old seedlings; E, immature seeds and siliques from Arabidopsis; F, transverse section of the inflorescence; G, fully developed Arabidopsis flower; and H, individual stigma and anthers from a fully developed Arabidopsis flower.

Based on these two analyses we can conclude that the CLA1 gene is widely expressed throughout the Arabidopsis plant and that higher expression levels are found in the young tissues of the plant.

Characterization of the CLA1 Protein

To characterize the CLA1 gene product we performed western-blot analysis using polyclonal antibodies raised against a fusion protein between an E. coli glutathione S-transferase (GST) and most of the CLA1 protein. We detected a 70-kD protein in total extracts of 15-d-old wild-type seedlings (Fig. 2B, lane 2) that is not detected in extracts from cla1-1 plants (Fig. 2B, lane 1). The accumulation pattern of the CLA1 protein was analyzed in total protein extracts from different Arabidopsis tissues. As shown in Figure 2B, the CLA1 protein is detected in most plant tissues except in 24-h-water-imbibed seeds (Fig. 2B, lane 6). CLA1 is particularly abundant in young leaves, in buds, and in immature siliques, but barely detectable in roots. These results contrast with the northern and transgenic plant analyses in which the CLA1 gene is expressed at similar levels in both roots and mature leaves (Fig. 2A, lanes 3 and 6). The CLA1 protein accumulates most predominately in the young tissues of the plant (Fig. 2B, lanes 3 versus 4). When we compared the levels of CLA1 protein in extracts from seedlings of different ages we found that this protein increases as organs mature, reaching a maximum in 15-d-old plantlets as shown in Figure 2C, lane 4. After this stage the amount of CLA1 protein decreases in relation to the age of the plant (Fig. 2C).

Organelle and Tissue Morphology in the cla1-1 Plant

Our initial analysis demonstrated that the CLA1 protein in Arabidopsis is required for normal chloroplast differentiation (Mandel et al., 1996). Based on the CLA1 function and its mRNA and protein expression patterns we decided to re-analyze the structure of other plastid types in cla1-1 plants. Using transmission electron microscopy the morphology of etioplasts from the cotyledons of dark-adapted cla1-1 seedlings was analyzed. As cla1-1 seed stocks are heterozygous, seeds were initially germinated on Murashige and Skoog basal salt mixture media with light for 6 d and the albino homozygous mutant plants were transferred and kept in the dark during an additional 8 d. The same treatment was followed with wild-type plants to be used as controls. As shown in Figure 4B, the ultrastructure of the dark-adapted etioplasts in cla1-1 plant is altered in comparison with wild-type plastids (Fig. 4A). The prolamellar body in these organelles is absent and vesicles are present which seem to be associated with internal membranes. We also investigated the amyloplast structure in 10-d-old roots of the cla1-1 plant. It is interesting that as shown in Figure 4D, the morphology of this organelle does not seem to be altered compared with wild-type plants. Normal starch granules, characteristic of this plastid type, can be detected in the plastids of both wild-type and mutant plants.



View larger version (128K):
[in this window]
[in a new window]
 
Figure 4.   Microscopic analysis of the plastids and mesophyll tissue of the cla1-1 mutant. Transmission electron microscopic examination of plastids of wild-type (A and C) and cla1-1 (B and D) seedlings. Etioplasts were analyzed from cotyledons of seedlings that were dark-adapted for 4 d of wild type (A) and homozygous (B) cla1-1 mutants. Amyloplasts were analyzed from 10-d-old root seedlings of wild type (C) and cla1-1 (D) mutant. Transverse sections of the 10-d-old first leaf from plants of wild type (E), cla1-1 (F), and cla1-1 (G) mutant supplemented with 0.02% (w/v) DX.

A well-known event during leaf differentiation in dicot plants is the coordination with chloroplast development (Chory, 1992). Mutants have been isolated that partially uncouple such coordination, demonstrating that these processes can be separable (Mochizuki et al., 1996). We therefore asked if mutations in CLA1 have an effect on leaf cellular morphology. As shown in Figure 4F, the transverse leaf section of the cla1-1 plant shows an anomalous development of the mesophyll tissue compared with similar sectors from a wild-type plant (Fig. 4E). The proportion of air space compared with the mesophyll tissue is larger in the cla1-1 mutant than in the wild-type plant. Also for the cla1-1 mutant, the cells of the mesophyll tissue remain round and small; few palisade cells are present. This phenotype is unlikely to be the result of carbon or vitamin (thiamin or pyridoxol) deficiency as these are supplemented in the medium. The morphological abnormalities are reversible as soon as the plastid proceeds through its differentiation pathway. When cla1-1 plants are grown on Murashige and Skoog basal salt mixture media supplemented with DX they show a seminormal morphology of the mesophyll tissue including the presence of palisade cells (Fig. 4G).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

In this report we demonstrate that the CLA1 gene encodes the previously reported DXP synthase (Sprenger et al., 1997; Bouvier et al., 1998; Disch et al., 1998; Lange et al., 1998; Lois et al., 1998; Lichtenthaler, 1999). Early work by Arigioni and coworkers (1997) showed that DX is an effective compound for phytol and carotenoid production in culture cells of Catharantus roseus. We also observed that DX has a striking capacity to restore pigment biosynthesis in the cla1-1 albino mutant. DX was efficiently absorbed by the root and transported into the leaves. It is still an open question whether DX is phosphorylated before it is converted to MEP.

The existence of two biosynthetic pathways for IPP production raises questions about the participation of each pathway in the synthesis of specific isoprenoid compounds and inter-pathway communication. Some exchange between the cytoplasmic and chloroplastic IPP pools has been suggested (Bach and Lichtenthaler, 1982; Arigoni et al., 1997; Nabeta et al., 1997). It is interesting that despite the albino phenotype of cla1-1 plants, low chlorophyll and carotenoid levels are detectable in this mutant (Table I). As this seems to be a null mutation, our interpretation is that cytosolic IPP probably moves into the plastids, resulting in limited pigment levels. However, this supply of cytosolic IPP is far too small to fulfill normal pigment biosynthesis requirements. Whether the supply of cytosolic IPP could be sufficient for the biosynthesis of other chloroplastic isoprenoids under specific physiological or developmental conditions needs to be defined.

This work is the first detailed characterization of DXP synthase expression patterns in plants. The CLA1 gene is widely expressed in photosynthetic and non-photosynthetic tissues and its expression is clearly modulated throughout plant development. The maximum mRNA levels of CLA1 correlate with the maturation stage of the leaves when there are massive requirements for chlorophylls and carotenoids. In non-photosynthetic tissues the CLA1 expression pattern supports the participation of the MEP pathway in the production of a variety of isoprenoids. It is interesting to note that even though substantial CLA1 mRNA levels were detected in roots by northern analysis and GUS staining of transgenic plants, the CLA1 protein levels in roots extracts were barely detectable. A potential post-transcriptional regulation mechanism for the CLA1 transcript might be operating in roots.

We demonstrated previously that CLA1 is required for proper chloroplast development (Mandel et al., 1996). The data presented here further substantiate the requirement for CLA1 to ensure development of etioplasts, but CLA1 does not seem to be required for amyloplast differentiation. It is apparent that expression of the CLA1 gene is not required for starch accumulation because the size and number of starch granules in the amyloplasts is similar in cla1-1 and wild-type plants. We have observed that the mesophyll tissue of cla1-1 is altered in comparison with wild-type plants. Similar phenotypes have been reported in other mutants that affect chloroplast development at an early stage such as Dcl-m and GHOST in tomato, Dag in Antirrhinum (Scolnik et al., 1987; Chatterjee et al., 1996; Keddie et al., 1996), and PAC and ATD in Arabidopsis (Reiter et al., 1994; van der Graaff, 1997). The common denominator in all is that the plastids are arrested early in development. One possibility is that early arrest interferes with production of a chloroplast signal to the cytoplasm and nucleus that directly influences the last stages of mesophyll differentiation (Susek and Chory, 1992; León et al., 1998).


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

Plant Material and Growth Conditions

Arabidopsis ecotypes Columbia or WS seeds were grown in Metromix 200 (Grace Sierra, Milpitas, CA) in controlled growth chambers at 24°C using a 16-h light/8-h dark photoperiod with cool-white illumination (20 µE m-2 s-1) for 3 to 4 weeks. Plants under sterile conditions were grown in Murashige and Skoog basal salt mixture supplemented with Gamborg's vitamins, 0.5% (w/v) MES [2-(N-morpholino)ethanesulfonic acid], 1% (w/v) Suc (GM media), and 0.7% (w/v) of phytoagar in the case of solid medium. Determination of total carotenoids and chlorophylls was conducted following the protocol reported by Lichtenthaler and Wellburn (1983).

In Vivo Complementation of the cla1-1 Albino Phenotype

The recessive albino cla1-1 mutant is lethal on soil (Mandel et al., 1996), thus seed stocks are maintained as heterozygotes. The cla1-1 heterozygous plants were germinated in GM media for 6 d. Homozygous albino cla1-1 plants were transferred to GM medium or GM supplemented with 0.02% (w/v) DX. As a control, WS wild-type plants were incubated in the same type of media.

Molecular Biology Techniques

Total RNA was isolated from different plant tissues using the procedure of Logemann et al. (1987) with minor modifications. For northern blots, RNA was fractionated by electrophoresis in 1.2% (w/v) agarose gels and transferred onto Hybond N+ nylon membranes (Amersham Corporation, Arlington Heights, IL). Hybridizations and washes were done at high stringency conditions according to standard procedures using 32P-radiolabeled probes (Church and Gilbert, 1984).

Production of the GST-CLA1 Fusion Protein and Antibody Preparation

To generate a fusion protein containing the CLA1 gene, a 2-Kb SspI-EcoRI fragment of the CLA1 cDNA was cloned downstream of the GST from the pGEX1 vector (Amersham Pharmacia Biotech, Buckinghamshire, UK). This fragment contains most of the CLA1 coding region with the exception of 197 bp of the putative chloroplast transit peptide. The generated plasmid, pGEX-CLA1, codes for the GST-CLA1 fusion protein without the putative chloroplast transit peptide. The integrity of the chimeric gene was verified by direct sequencing. The isopropylthio-beta -D-galactoside-induced GST-CLA1 fusion protein was produced in Escherichia coli and purified by affinity chromatography using Glutathione Sepharose 4B resin (Amersham Pharmacia Biotech) according to the protocol published (Ausubel et al., 1989). For polyclonal antibody generation, purified GST-CLA1 protein (10 µg in 20 µL of phosphate-buffered saline) and complete Freund's adjuvant was injected intraperitoneal as 1:9 emulsion in a BALB/c mice (Harlow and Lane, 1988). Three additional injections (10 µg each), were administrated every 8 d starting 14 d after the initial injection. The ascites was collected 8 d later and titer was determined. In addition to recognizing the 70-kD CLA1 protein, this ascites fluid recognizes one abundant protein that is also present in the cla1-1 mutant plant.

Functional Assay of CLA1 Protein

DXP synthase activity was measured using 50 µg of the purified GST-CLA1 fusion protein. The reaction was done according to Kuzuyama et al. (2000b), in 100 mM Tris [tris(hydroxymethyl)aminomethane]-HCL (pH 8.0), 1 mM MgCl2, 2 mM dithiothreitol, 0.075 mM thiamine diphosphate, 20 mM glyceraldehyde-3-P, and 10 mM pyruvate at 37°C for 1 h and terminated by heating. Denatured proteins were removed by centrifugation at 15,000 rpm for 10 min. The supernatant was treated with 1 unit of bacterial alkaline phosphatase at 50°C for 1 h. The reaction mixture was treated with activated charcoal power and filtered. The filtrate was subject to HPLC-connected Shodex SUGAR KS-801 column (8 × 300 mm, SHOWA DENKO, Tokyo) heated at 80°C. The flow rate of water was 1 mL min-1. DX was detected at 8.6 min of refractive index detector. For comparison, authentic DX was detected at 8.5 min under the same condition consistent with that previously reported by Lange, et al. (1998).

To determine the product generated by the GST-CLA1 fusion protein, eluates after HPLC separation were collected, dried, and then derivatized with N,O bis(trimethylsilyl) acetamide:trimethylchlorosilane:N-trimethylsilyimidazole (2:3:2, v/v) in pyridine at 80°C for 20 min. GC-MS analysis was performed by using Finnigan MAT GCQ ion-trap GC-MS system (Thermoquest, San Jose, CA) equipped with a 30-m × 0.25-mm diameter fused silica capillary column coated with 0.25-µm film thickness of DB-5MS (J&W Scientific, Folson, CA). The oven temperature was programmed from 90°C (2-min hold) at 20°C min-1 to 150°C, at 10°C min-1 to 250°C, and then at 30°C min-1 to 300°C with a constant velocity at 40 cm min-1 He.

Western-Blot Analysis

Protein samples were quantified with Bradford reagent (Bio-Rad, Hercules, CA). Samples were separated by PAGE. To verify equal protein loading a parallel gel was run and stained with Coomassie Brilliant Blue R-250. The proteins were transferred onto nitrocellulose (Hybond C, Amersham Pharmacia Biotech) by electroblotting for 1 h at 200 mA in 25 mM Tris, 0.2 M Gly, and 20% (w/v) methanol. Immunodetection was done using a 1:1,000 dilution of the GST-CLA1 fusion protein polyclonal antibody. An antimouse immunoglobulin horseradish peroxidase-conjugate was used as a secondary antibody (Amersham Pharmacia Biotech), and detection was done with an enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech).

Plasmid Construction

A CLA1-GUS translational fusion was constructed using a 1.4-kb fragment of the CLA1 5'-regulatory region (contained in the ESSA I FCA contig fragment no. 4, accession no. Z97339). Initially, a fragment of approximately 9 kb capable of complementing the cla1-1 mutant phenotype (Mandel et al., 1996) was subcloned into the pBluescript II vector and subjected to Exonuclease III/Mung Bean deletions. One of such deletions, containing approximately 1.4 kb upstream of the ATG codon from the CLA1 gene was PCR-amplified and used for expression analysis. The primers used for the PCR were: ATG-Nco (5'GCAGAAGAAGCCATGGGAGGTAC3') that includes the CLA1 ATG codon, and BS-Hind (5'GGCCAAGCTTACGCCAAGCGCGCAAT3') fromthe flanking vector sequence, plus a HindIII site at its end. The PCR fragment generated was first cloned as a translational fusion into a vector derived from pBluescript II KS(-) plasmids (Stratagene, La Jolla, CA) containing the uidA (GUS) gene followed by the nopaline synthase 3' terminator from the pBin19 plasmid (Bevan, 1984), termed pBlueGUS. The entire fragment (CLA1 promoter:GUS and nopaline synthase-3') was subcloned into the binary vector pBin19 (Bevan, 1984) generating the pBin/1458-G plasmid that was used for transformation into Arabidopsis.

Plant Transformation and Histochemical Analysis

Transgenic lines (Columbia) were constructed using Agrobacterium tumefaciens-mediated transformation by the vacuum infiltration method (Bechtold et al., 1993). Transgenic plants were identified by their capacity to develop roots and maintain green leaves in the presence of 50 µg mL-1 of kanamycin. They were then transferred to soil to get the transgenic seed and the following generations. GUS histochemical analysis was carried out according to a protocol previously described (Jefferson, 1987). The tissue was incubated at 37°C overnight (12 h). Destaining was accomplished by 30 min incubations with 3:1 (v/v) acetone:methanol solution. Whole tissues or sections were observed under bright-field microscopy (Type 104, Nikon, Tokyo).

Microscopy Techniques

For transmission electron microscopy, tissues were fixed with 6% (w/v) glutaraldehyde in phosphate-buffered saline (pH 7.2) for 10 h and post-fixed in 1% (w/v) osmium tetroxide in the same buffer for several hours. After dehydration in a graded series of ethanol and propylene oxide, samples were embedded in Epoxy resin. For electron microscopy, 60-nm thin sections were obtained and mounted on formvar-coated copper grids (Electron Microscopy Science, Fort Washington, PA). For contrast, 3% (w/v) uranyl acetate and 0.3% (w/v) lead citrate were used. Grids were observed with a transmission electron microscope (EM-10, Carl Zeiss, Jena, Germany) operating at 80 kV. For light microscopy, samples were treated as described above and 0.5-µm semi-thin sections were obtained. The sections were stained with 1% (w/v) toluidine blue and observed in bright field with a light microscope (Standard, Carl Zeiss).


    ACKNOWLEDGMENTS

We want to thank Elizabeth Mata and Carlos González for their help in raising antibody and Paul Gaitan and Eugenio López for the synthesis of oligos. We thank Drs. Virginia Walbot, Analilia Arroyo, Helena Porta, Marcela Treviño, and Stuart Reichler for helpful comments on the manuscript.

    FOOTNOTES

Received January 5, 2000; accepted May 9, 2000.

1 This work was funded by Consejo Nacional de Ciencia y Tecnologia and Dirección General de Asuntos para el Personal Académico (grant nos. 110P-N9506 and IN205697) and by the Pew Charitable Trust.

* Corresponding author; e-mail patricia{at}ibt.unam.mx; fax 52-73-139988.


    LITERATURE CITED
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

  • Arigoni D, Sagner S, Latzel C, Eisenreich W, Bacher A, Zenk MH (1997) Terpenoid biosynthesis from 1-deoxy-D-xylulose in higher plants by intramolecular skeletal rearrangement. Proc Natl Acad Sci USA 94: 10600-10605 [Abstract/Free Full Text]
  • Ausubel FM, Brent R, Kingston RE, Moore DD, Siedman JG, Smith JA, Struhl K (1989) Current Protocols in Molecular Biology. John Wiley & Sons, New York
  • Bach TJ, Lichtenthaler HK (1982) Inhibition of mevalonate biosynthesis and plant growth by the fungal metabolite mevinolin. In JFGM Wintermanns, PJC Kuiper, eds, Biochemistry and Metabolism of Plant Lipids. Elsevier, Amsterdam, pp 515-521
  • Bechtold N, Ellis J, Pelletier G (1993) In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CR Acad Sci Ser III Sci Vie 316: 1194-1199
  • Bevan M (1984) Binary Agrobacterium vectors for plant transformation. Nucleic Acid Res 12: 8711-8721 [Abstract/Free Full Text]
  • Bouvier F, d'Harlingue A, Suire C, Backhaus RA, Camara B (1998) Dedicated roles of plastid transketolases during the early onset of isoprenoid biogenesis in pepper fruits. Plant Physiol 117: 1423-1431 [Abstract/Free Full Text]
  • Chatterjee M, Sparvoli S, Edmunds C, Garosi P, Findlay K, Martin C (1996) DAG, a gene required for chloroplast differentiation and palisade development in Antirrhinum majus. EMBO J 15: 4194-4207 [Web of Science][Medline]
  • Chory J (1992) A genetic model for light-regulated seedling development in Arabidopsis. Development 115: 337-354 [Abstract]
  • Church GM, Gilbert W (1984) Genomic sequencing. Proc Natl Acad Sci USA 81: 1991-1995 [Abstract/Free Full Text]
  • Disch A, Schwender J, Müller C, Lichtenthaler HK, Rohmer M (1998) Distribution of the mevalonate and glyceraldehyde phosphate/pyruvate pathways for isoprenoid biosynthesis in unicellular algae and the cyanobacterium Synechocystis PCC 6714. Biochem J 333: 381-388
  • Eisenreich W, Menhard B, Hylands P, Zenk MH, Bacher A (1996) Studies on the biosynthesis of taxol: the taxane carbon skeleton is not of mevalonoid origin. Proc Natl Acad Sci USA 93: 6431-6436 [Abstract/Free Full Text]
  • Goldstein JL, Brown MS (1990) Regulation of the mevalonate pathway. Nature 343: 425-430 [CrossRef][Medline]
  • Harlow E, Lane D (1988) Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 53-138
  • Hill RE, Himmeldrik K, Kennedy IA, Paulosky RM, Sayer BG, Wolf E, Spenser ID (1996) The biogenetic anatomy of vitamin B6: a 13C NMR investigation of the biosynthesis of pyridoxol in Escherichia coli. J Biol Chem 271: 30426-30435 [Abstract/Free Full Text]
  • Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Report 5: 387-405 [CrossRef]
  • Julliard JH, Douce R (1991) Biosynthesis of the thiazole moitey of thiamin (vitamin B1) in higher plant chloroplasts. Proc Natl Acad Sci USA 88: 2042-2045 [Abstract/Free Full Text]
  • Keddie JS, Carroll B, Jones JDG, Gruissem W (1996) The DCL gene of tomato is required for chloroplast development and palisade cell morphogenesis in leaves. EMBO J 15: 4208-4217 [Web of Science][Medline]
  • Knöss W, Reuter B, Zapp J (1997) Biosynthesis of the labdane diterpene marrubium in Marrubium vulgare via a non-mevalonate pathway. Biochem J 326: 449-454
  • Kuzuyama T, Takagi M, Kaneda K, Dairi T, Seto H (2000a) Formation of 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol from 2-C-methyl-D-erythritol 4-phosphate by 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase, a new enzyme in the nonmevalonate pathway. Tetrahedron Lett 41: 703-706 [CrossRef]
  • Kuzuyama T, Takagi M, Takahashi S, Seto H (2000b) Cloning and characterization of 1-deoxy-D-xylulose 5-phosphate synthase from Streptomyces sp. strain CL190, which uses both the mevalonate and nonmevalonate pathways for isopentenyl diphosphate biosynthesis. J Bacteriol 182: 891-897 [Abstract/Free Full Text]
  • Lange BM, Croteau R (1999) Isoprenoid biosynthesis via a mevalonate-independent pathway in plants: cloning and heterologous expression of 1-deoxy-D-xylulose-5-phos-phatereductoisomerase from peppermint. Arch Biochem Biophys 365: 170-174 [CrossRef][Medline]
  • Lange BM, Wildung MR, McCaskill D, Croteau R (1998) A family of transketolases that directs isoprenoid biosynthesis via a mevalonate-independent pathway. Proc Natl Acad Sci USA 95: 2100-2104 [Abstract/Free Full Text]
  • León P, Arroyo A, Mackenzie S (1998) Nuclear control of plastid and mitochondrial development in higher plants. Annu Rev Plant Physiol Plant Mol Biol 49: 453-480 [CrossRef][Web of Science]
  • Lichtenthaler HK (1999) The 1-deoxy-D-xylulose-5-phosphate pathway of isoprenoid biosynthesis in plants. Annu Rev Plant Physiol Plant Mol Biol 50: 47-65 [CrossRef][Web of Science]
  • Lichtenthaler HK, Schwender J, Disch A, Rohmer M (1997) Biosynthesis of isoprenoids in higher plant chloroplasts proceeds via a mevalonate-independent pathway. FEBS Lett 400: 271-274 [CrossRef][Web of Science][Medline]
  • Lichtenthaler HK, Wellburn AR (1983) Determination of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Biochem Soc Trans 11: 591-592
  • Logemann J, Schell J, Willmitzer L (1987) Improved method for the isolation of RNA from plant tissues. Anal Biochem 163: 16-20 [CrossRef][Web of Science][Medline]
  • Lois LM, Campos N, Rosa Putra S, Danielsen K, Rohmer M, Boronat A (1998) Cloning and characterization of a gene from Escherichia coli encoding a transketolase-like enzyme that catalyzes the synthesis of D-1-deoxyxylulose 5-phosphate, a common precursor for isoprenoid, thiamin, and pyridoxol biosynthesis. Proc Natl Acad Sci USA 95: 2105-2110 [Abstract/Free Full Text]
  • Mandel MA, Feldmann KA, Herrera-Estrella L, Rocha-Sosa M, León P (1996) CLA1, a novel gene required for chloroplast development, is highly conserved in evolution. Plant J 9: 649-658 [CrossRef][Web of Science][Medline]
  • Mochizuki N, Susek R, Chory J (1996) An intracellular signal transduction pathway between the chloroplast and nucleus is involved in de-etiolation. Plant Physiol 112: 1465-1469 [Abstract]
  • Nabeta K, Kawae T, Saitoh T, Kikuchi T (1997) Synthesis of chlorophyll alpha  and beta -carotene from 2H and 13C-labeled mevalonates and 13C-labeled glycin in cultured cells of liverworts Heteroscyphus planus and Lophocolea heterophylla. J Chem Soc Perkin Trans 1: 261-267
  • Reiter RS, Coomber SA, Bourett TM, Bartley GE, Scolnik PA (1994) Control of leaf and chloroplast development by the Arabidopsis gene pale cress. Plant Cell 6: 1253-1264 [Abstract]
  • Relichova J (1976) Some new mutants. Arab Inf Serv 13: 25-28
  • Rohdich F, Wungsintaweekul J, Fellermeier M, Sagner S, Herz S, Kis K, Eisenreich W, Bacher A, Zenk M (1999) Cytidine 5'-triphosphate-dependent biosynthesis of isoprenoids: YgbP protein of Escherichia coli catalyzes the formation of 4-diphosphocytidyl-2-C-methylerythritol. Proc Natl Acad Sci USA 96: 11758-11763 [Abstract/Free Full Text]
  • Rohmer M (1998) Isoprenoid biosynthesis via the mevalonate-independent route, a novel target for antibacterial drugs? In E Jucker, ed, Progress in Drug Research, Vol. 50. Birkhäuser Verlag, Basel, pp 135-154
  • Rohmer M (1999) A mevalonate-independent route to isopentenyl diphosphate. In D Cane, ed, Comprehensive Natural Product Chemistry, Isoprenoids including Steroids and Carotenoids, Vol. 2. Pergamon Press, Oxford, pp 45-68
  • Rohmer M, Knani M, Simonin P, Sutter B, Sahm H (1993) Isoprenoid biosynthesis in bacteria: a novel pathway for the early steps leading to isopentenyl diphosphate. Biochem J 295: 517-524
  • Rohmer M, Seemann M, Horbach S, Bringer-Meyer S, Sahm H (1996) Glyceraldehyde 3-phosphate and pyruvate as precursors of isoprenic units in an alternative non-mevalonate pathway for terpenoid biosynthesis. J Am Chem Soc 118: 2564-2566 [CrossRef]
  • Schwender J, Müller C, Zeidler J, Lichtenthaler HK (1999) Cloning and heterologous expression of a cDNA encoding 1-deoxy-D-xylulose-5-phosphate reductoisomerase of Arabidopsis thaliana. FEBS Lett 455: 140-144 [CrossRef][Web of Science][Medline]
  • Schwender J, Seemann M, Lichtenthaler HK, Rohmer M (1996) Biosynthesis of isoprenoids (carotenoids, sterols, prenyl side-chains of chlorophylls and plastoquinone) via a novel pyruvate/glyceraldehyde 3-phosphate non-mevalonate pathway in the green alga Scenedesmus obliquus. Biochem J 316: 73-80
  • Scolnik PA, Hinton P, Greenblatt IM, Giuliano G, Delanoy MR, Spector DL, Pollock D (1987) Somatic instability of carotenoid biosynthesis in the tomato ghost mutant and its effect on plastid development. Planta 171: 11-18
  • Sprenger GA, Schörken U, Wiegert T, Grolle S, de Graaf AA, Taylor SV, Begley TP, Bringer-Meyer S, Sahm H (1997) Identification of a thiamin-dependent synthase in Escherichia coli required for the formation of the 1-deoxy-D-xylulose 5-phosphate precursor to isoprenoids, thiamin, and pyridoxol. Proc Natl Acad Sci USA 94: 12857-12862 [Abstract/Free Full Text]
  • Spurgeon SL, Porter JW (1981) Introduction. In JW Porter, SL Spurgeon, eds, Biosynthesis of Isoprenoid Compounds. John Wiley & Sons, New York, pp 1-46
  • Susek R, Chory J (1992) A tale of two genomes: role of a chloroplast signal in coordinating nuclear and plastid genome expression. Aust J Plant Physiol 19: 387-399 [Web of Science]
  • Takahashi S, Kuzuyama T, Watanabe H, Seto H (1998) A 1-deoxy-D-xylulose 5-phosphate reductoisomerase catalyzing the formation of 2-C-methyl-D-erythritol 4-phos-phatein an alternative nonmevalonate pathway for terpenoid biosynthesis. Proc Natl Acad Sci USA 95: 9879-9884 [Abstract/Free Full Text]
  • van der Graaff E (1997) Developmental mutants of Arabidopsis thaliana obtained after T-DNA transformation. PhD thesis. Leiden University, The Netherlands
  • van der Veen JH, Blankenstijn de Vries H (1973) Double reduction in tetraploid Arabidopsis thaliana, studied by means of chlorophyll mutant with a distinct simplex phenotype. Arab Inf Serv 10: 11-12
  • Zeidler JG, Lichtenthaler HK, May HU, Lichtenthaler FW (1997) Is isoprene emitted by plants synthesized via novel isopentenyl pyrophosphate pathway? Z Naturforsch 52c: 15-23
© 2000 American Society of Plant Physiologists



This article has been cited by other articles:


Home page
J Exp BotHome page
E. Cordoba, M. Salmi, and P. Leon
Unravelling the regulatory mechanisms that modulate the MEP pathway in higher plants
J. Exp. Bot., July 1, 2009; 60(10): 2933 - 2943.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
M. Suzuki, S. Nakagawa, Y. Kamide, K. Kobayashi, K. Ohyama, H. Hashinokuchi, R. Kiuchi, K. Saito, T. Muranaka, and N. Nagata
Complete blockage of the mevalonate pathway results in male gametophyte lethality
J. Exp. Bot., May 1, 2009; 60(7): 2055 - 2064.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
K. Besser, A. Harper, N. Welsby, I. Schauvinhold, S. Slocombe, Y. Li, R. A. Dixon, and P. Broun
Divergent Regulation of Terpenoid Metabolism in the Trichomes of Wild and Cultivated Tomato Species
Plant Physiology, January 1, 2009; 149(1): 499 - 514.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
K. Okada, H. Kasahara, S. Yamaguchi, H. Kawaide, Y. Kamiya, H. Nojiri, and H. Yamane
Genetic Evidence for the Role of Isopentenyl Diphosphate Isomerases in the Mevalonate Pathway and Plant Development in Arabidopsis
Plant Cell Physiol., April 1, 2008; 49(4): 604 - 616.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. A. Phillips, J. C. D'Auria, J. Gershenzon, and E. Pichersky
The Arabidopsis thaliana Type I Isopentenyl Diphosphate Isomerases Are Targeted to Multiple Subcellular Compartments and Have Overlapping Functions in Isoprenoid Biosynthesis
PLANT CELL, March 1, 2008; 20(3): 677 - 696.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
K. Sasaki, T. Saito, M. Lamsa, K.-M. Oksman-Caldentey, M. Suzuki, K. Ohyama, T. Muranaka, K. Ohara, and K. Yazaki
Plants Utilize Isoprene Emission as a Thermotolerance Mechanism
Plant Cell Physiol., September 1, 2007; 48(9): 1254 - 1262.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
K. Kobayashi, M. Suzuki, J. Tang, N. Nagata, K. Ohyama, H. Seki, R. Kiuchi, Y. Kaneko, M. Nakazawa, M. Matsui, et al.
LOVASTATIN INSENSITIVE 1, a Novel Pentatricopeptide Repeat Protein, is a Potential Regulatory Factor of Isoprenoid Biosynthesis in Arabidopsis
Plant Cell Physiol., February 1, 2007; 48(2): 322 - 331.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
E. Lopez-Juez
Plastid biogenesis, between light and shadows
J. Exp. Bot., January 1, 2007; 58(1): 11 - 26.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Hemmerlin, D. Tritsch, M. Hartmann, K. Pacaud, J.-F. Hoeffler, A. van Dorsselaer, M. Rohmer, and T. J. Bach
A Cytosolic Arabidopsis D-Xylulose Kinase Catalyzes the Phosphorylation of 1-Deoxy-D-Xylulose into a Precursor of the Plastidial Isoprenoid Pathway
Plant Physiology, October 1, 2006; 142(2): 441 - 457.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
W. L. Morris, L. J. M. Ducreux, P. Hedden, S. Millam, and M. A. Taylor
Overexpression of a bacterial 1-deoxy-D-xylulose 5-phosphate synthase gene in potato tubers perturbs the isoprenoid metabolic network: implications for the control of the tuber life cycle
J. Exp. Bot., September 1, 2006; 57(12): 3007 - 3018.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Hricova, V. Quesada, and J. L. Micol
The SCABRA3 Nuclear Gene Encodes the Plastid RpoTp RNA Polymerase, Which Is Required for Chloroplast Biogenesis and Mesophyll Cell Proliferation in Arabidopsis
Plant Physiology, July 1, 2006; 141(3): 942 - 956.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
C. Raines and M. Paul
Products of leaf primary carbon metabolism modulate the developmental programme determining plant morphology
J. Exp. Bot., June 1, 2006; 57(9): 1857 - 1862.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. Sauret-Gueto, P. Botella-Pavia, U. Flores-Perez, J. F. Martinez-Garcia, C. San Roman, P. Leon, A. Boronat, and M. Rodriguez-Concepcion
Plastid Cues Posttranscriptionally Regulate the Accumulation of Key Enzymes of the Methylerythritol Phosphate Pathway in Arabidopsis
Plant Physiology, May 1, 2006; 141(1): 75 - 84.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Tambasco-Studart, O. Titiz, T. Raschle, G. Forster, N. Amrhein, and T. B. Fitzpatrick
Vitamin B6 biosynthesis in higher plants
PNAS, September 20, 2005; 102(38): 13687 - 13692.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M.-H. Hsieh and H. M. Goodman
The Arabidopsis IspH Homolog Is Involved in the Plastid Nonmevalonate Pathway of Isoprenoid Biosynthesis
Plant Physiology, June 1, 2005; 138(2): 641 - 653.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
A. Guevara-Garcia, C. San Roman, A. Arroyo, M. E. Cortes, M. de la Luz Gutierrez-Nava, and P. Leon
Characterization of the Arabidopsis clb6 Mutant Illustrates the Importance of Posttranscriptional Regulation of the Methyl-D-Erythritol 4-Phosphate Pathway
PLANT CELL, February 1, 2005; 17(2): 628 - 643.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. d. l. L. Gutierrez-Nava, C. S. Gillmor, L. F. Jimenez, A. Guevara-Garcia, and P. Leon
CHLOROPLAST BIOGENESIS Genes Act Cell and Noncell Autonomously in Early Chloroplast Development
Plant Physiology, May 1, 2004; 135(1): 471 - 482.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Kasahara, K. Takei, N. Ueda, S. Hishiyama, T. Yamaya, Y. Kamiya, S. Yamaguchi, and H. Sakakibara
Distinct Isoprenoid Origins of cis- and trans-Zeatin Biosyntheses in Arabidopsis
J. Biol. Chem., April 2, 2004; 279(14): 14049 - 14054.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
J. E. Page, G. Hause, M. Raschke, W. Gao, J. Schmidt, M. H. Zenk, and T. M. Kutchan
Functional Analysis of the Final Steps of the 1-Deoxy-D-xylulose 5-phosphate (DXP) Pathway to Isoprenoids in Plants Using Virus-Induced Gene Silencing
Plant Physiology, April 1, 2004; 134(4): 1401 - 1413.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. Rodriguez-Concepcion, O. Fores, J. F. Martinez-Garcia, V. Gonzalez, M. A. Phillips, A. Ferrer, and A. Boronat
Distinct Light-Mediated Pathways Regulate the Biosynthesis and Exchange of Isoprenoid Precursors during Arabidopsis Seedling Development
PLANT CELL, January 1, 2004; 16(1): 144 - 156.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
O. Laule, A. Furholz, H.-S. Chang, T. Zhu, X. Wang, P. B. Heifetz, W. Gruissem, and M. Lange
Crosstalk between cytosolic and plastidial pathways of isoprenoid biosynthesis in Arabidopsis thaliana
PNAS, May 27, 2003; 100(11): 6866 - 6871.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
Y. Miyazawa, H. Kato, T. Muranaka, and S. Yoshida
Amyloplast Formation in Cultured Tobacco BY-2 Cells Requires a High Cytokinin Content
Plant Cell Physiol., December 15, 2002; 43(12): 1534 - 1541.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
A. M. Bailey, S. Mahapatra, P. J. Brennan, and D. C. Crick
Identification, cloning, purification, and enzymatic characterization of Mycobacterium tuberculosis 1-deoxy-D-xylulose 5-phosphate synthase
Glycobiology, December 1, 2002; 12(12): 813 - 820.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Kasahara, A. Hanada, T. Kuzuyama, M. Takagi, Y. Kamiya, and S. Yamaguchi
Contribution of the Mevalonate and Methylerythritol Phosphate Pathways to the Biosynthesis of Gibberellins in Arabidopsis
J. Biol. Chem., November 15, 2002; 277(47): 45188 - 45194.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. Rodriguez-Concepcion and A. Boronat
Elucidation of the Methylerythritol Phosphate Pathway for Isoprenoid Biosynthesis in Bacteria and Plastids. A Metabolic Milestone Achieved through Genomics
Plant Physiology, November 1, 2002; 130(3): 1079 - 1089.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
S. Lu, R. Xu, J.-W. Jia, J. Pang, S. P.T. Matsuda, and X.-Y. Chen
Cloning and Functional Characterization of a beta -Pinene Synthase from Artemisia annua That Shows a Circadian Pattern of Expression
Plant Physiology, September 1, 2002; 130(1): 477 - 486.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
L. Carretero-Paulet, I. Ahumada, N. Cunillera, M. Rodriguez-Concepcion, A. Ferrer, A. Boronat, and N. Campos
Expression and Molecular Analysis of the Arabidopsis DXR Gene Encoding 1-Deoxy-D-Xylulose 5-Phosphate Reductoisomerase, the First Committed Enzyme of the 2-C-Methyl-D-Erythritol 4-Phosphate Pathway
Plant Physiology, August 1, 2002; 129(4): 1581 - 1591.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. R. Aluru, H. Bae, D. Wu, and S. R. Rodermel
The Arabidopsis immutans Mutation Affects Plastid Differentiation and the Morphogenesis of White and Green Sectors in Variegated Plants
Plant Physiology, September 1, 2001; 127(1): 67 - 77.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Broun and C. Somerville
Progress in plant metabolic engineering
PNAS, July 31, 2001; 98(16): 8925 - 8927.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. S. Mahmoud and R. B. Croteau
Metabolic engineering of essential oil yield and composition in mint by altering expression of deoxyxylulose phosphate reductoisomerase and menthofuran synthase
PNAS, June 20, 2001; (2001) 141237298.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Estevez, A. Cantero, A. Reindl, S. Reichler, and P. Leon
1-Deoxy-D-xylulose-5-phosphate Synthase, a Limiting Enzyme for Plastidic Isoprenoid Biosynthesis in Plants
J. Biol. Chem., June 15, 2001; 276(25): 22901 - 22909.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. S. Mahmoud and R. B. Croteau
From the Cover: Metabolic engineering of essential oil yield and composition in mint by altering expression of deoxyxylulose phosphate reductoisomerase and menthofuran synthase
PNAS, July 17, 2001; 98(15): 8915 - 8920.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (89)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Estévez, J. M.
Right arrow Articles by León, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Estévez, J. M.
Right arrow Articles by León, P.
Agricola
Right arrow Articles by Estévez, J. M.
Right arrow Articles by León, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2000 by the American Society of Plant Biologists