Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (39)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yan, N.
Right arrow Articles by Vierstra, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yan, N.
Right arrow Articles by Vierstra, R. D.
Agricola
Right arrow Articles by Yan, N.
Right arrow Articles by Vierstra, R. D.

Plant Physiol, December 2000, Vol. 124, pp. 1828-1843

The Ubiquitin-Specific Protease Family from Arabidopsis. AtUBP1 and 2 Are Required for the Resistance to the Amino Acid Analog Canavanine1

Ning Yan,2 Jed H. Doelling, Tanya G. Falbel,3 Adam M. Durski, and Richard D. Vierstra*

Cellular and Molecular Biology Program and the Department of Horticulture, University of Wisconsin, Madison, Wisconsin 53706


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

Ubiquitin-specific proteases (UBPs) are a family of unique hydrolases that specifically remove polypeptides covalently linked via peptide or isopeptide bonds to the C-terminal glycine of ubiquitin. UBPs help regulate the ubiquitin/26S proteolytic pathway by generating free ubiquitin monomers from their initial translational products, recycling ubiquitins during the breakdown of ubiquitin-protein conjugates, and/or by removing ubiquitin from specific targets and thus presumably preventing target degradation. Here, we describe a family of 27 UBP genes from Arabidopsis that contain both the conserved cysteine (Cys) and histidine boxes essential for catalysis. They can be clustered into 14 subfamilies based on sequence similarity, genomic organization, and alignments with their closest relatives from other organisms, with seven subfamilies having two or more members. Recombinant AtUBP2 functions as a bona fide UBP: It can release polypeptides attached to ubiquitins via either alpha - or epsilon -amino linkages by an activity that requires the predicted active-site Cys within the Cys box. From the analysis of T-DNA insertion mutants, we demonstrate that the AtUBP1 and 2 subfamily helps confer resistance to the arginine analog canavanine. This phenotype suggests that the AtUBP1 and 2 enzymes are needed for abnormal protein turnover in Arabidopsis.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

The ubiquitin/26S proteasome proteolytic pathway plays an important role in eukaryotic cell growth, development, stress responses, and environmental adaptation by degrading short-lived and abnormal proteins (Hershko and Ciechanover, 1998; Vierstra, 1996; Callis and Vierstra, 2000). In this pathway, ubiquitin functions as a reusable tag to target specific proteins for breakdown. Via an ATP-dependent reaction cascade involving the sequential action of three classes of enzymes, E1s, E2s, and/or E3s, chains of ubiquitins become attached to proteolytic substrates through an isopeptide bond between the C-terminal Gly-76 of ubiquitin and a Lys residue in the target. These chains then serve as degradation signals for the 26S proteasome, a 2-MDa multisubunit protease that breaks down the protein into small peptides and amino acids but releases the ubiquitins intact.

Both the characterization of ubiquitin/26S proteasome pathway mutants and the analysis of individual substrates indicate that the pathway degrades a wide variety of short-lived proteins (Hershko and Ciechanover, 1998; Callis and Vierstra, 2000). To define how these substrates are chosen, most studies have focused on the E2/E3 enzymes that direct ubiquitin attachment. However, recent data indicate that the steps that release ubiquitins from targets and generate free monomers can also affect the selectivity of the pathway and the half-life of a substrate (Wilkinson, 1997; D'Andrea and Pellman, 1998; Chung and Baek, 1999). These steps are performed by a unique group of deubiquitinating enzymes (DUBs); they are thiol proteases that specifically cleave the peptide bond between the C-terminal Gly of ubiquitin and covalently attached polypeptides. Yeasts and animals contain a number of DUBs that vary substantially in sequence, suggesting that they recognize distinct substrates and/or have discrete functions (Wilkinson, 1997; D'Andrea and Pellman, 1998). Mutant analyses have implicated specific DUBs in numerous cellular processes, including cell growth (Papa and Hochstrasser, 1993; Zhu et al., 1996; Naviglio et al., 1998), cell differentiation (Chung et al., 1998; Lindsey et al., 1998; Liu et al., 1999), eye development (Huang et al., 1995; Taya et al., 1998; Taya et al., 1999), neural function (Wilkinson et al., 1989; Hegde et al., 1997; Leroy et al., 1998), coordinated DNA replication (Singer et al., 1996), gene silencing (Moazed and Johnson, 1996; Kahana and Gottschling, 1999), endocytosis (Galan and Haguenauer-Tsapis, 1997), oncogenesis (Nakamura et al., 1992; Papa and Hochstrasser, 1993; Gray et al., 1995), heat shock (Baxter and Craig, 1998), and the breakdown of abnormal proteins (Papa and Hochstrasser, 1993; Amerik et al., 1997).

Enzymatic analyses indicate that DUBs have three general roles in the ubiquitin/26S proteasome pathway, each of which can profoundly influence the overall activity and/or specificity of the pathway (Fig. 1). One role is to generate ubiquitin monomers from the initial translation products of ubiquitin genes (Callis and Vierstra, 1989; Eytan et al., 1993; Baek et al., 1998). Ubiquitin is unusual in that it is naturally synthesized as a translational fusion. These fusions contain either a single ubiquitin fused to the N terminus of an unrelated protein (ubiquitin extension) or tandem repeats of ubiquitin linked head-to-tail and capped at the C terminus with one or more additional amino acids (polyubiquitin). DUBs are essential for releasing ubiquitin monomers from these fusions by cleaving the alpha -amino peptide bond after each ubiquitin moiety. The second role of DUBs is to regenerate free ubiquitin monomers during the breakdown of ubiquitin-protein conjugates by the 26S proteosome. In this case, DUBs remove peptide fragments that remain attached following hydrolysis of the target and disassemble the multiubiquitin chain (Hadari et al., 1992; Papa and Hochstrasser, 1993; Amerik et al., 1997). The third role is to deubiquitinate conjugates; in this case both the target and the attached ubiquitins are released intact (Chung et al., 1998; Taya et al., 1998; Taya et al., 1999). The last two roles are accomplished by cleaving isopeptide bonds in which the C-terminal Gly of ubiquitin is attached to lysyl epsilon -amino groups.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1.   Possible functions of DUBs in the ubiquitin/26S proteasome proteolytic pathway. A, Generating free ubiquitin monomers from the translation products of polyubiquitin and ubiquitin-extension genes by cleaving the alpha -amino peptide bonds following each ubiquitin moiety. XY represent additional amino acids appended to the C-terminal Gly of the last ubiquitin repeat. B, Cleaving ubiquitin linked either to itself or to other proteins through epsilon -amino isopeptide bonds. Two routes are possible. DUBs could remove multiubiquitin chains bound to proteins, releasing both intact, and then the free ubiquitin chains would be disassembled into free ubiquitin monomers. During or following degradation of the target, free multiubiquitin chains could be released from peptide fragments of the target and then would be disassembled into free ubiquitin monomers. White arrowheads indicate the various bonds cleaved by DUBs.

Substrate recognition by all DUBs is highly dependent on the ubiquitin moiety, especially the C-terminal Gly (Wilkinson, 1997). However, UBPs are remarkably non-specific with respect to the appended polypeptide. For those cleaving isopeptide bonds, all attached polypeptides appear to be acceptable. For those cleaving peptide bonds, all translational fusions can be tolerated with the exceptions of appended sequences beginning with Pro, which are often resistant to cleavage. DUBs are divided into two general groups based on their amino acid sequence and substrate specificity (Wilkinson, 1997). One group called ubiquitin C-terminal hydrolases (UCHs) is composed of relatively small proteins (20-30 kD) that are structurally defined by the presence of a catalytic triad consisting of a positionally conserved Cys, His, and Asp (Johnston et al., 1997). In vitro, UCHs can remove small molecules (e.g. ester adducts and lysines) and peptides (Wilkinson, 1997), some of which attach non-specifically by reacting with activated ubiquitin during its conjugation cascade. UCHs can also process short multiubiquitin chains (Lam et al., 1997) and ubiquitin precursors (Pickart and Rose, 1985), suggesting a role in the production of free ubiquitin monomers.

The second group of DUBs, called ubiquitin-specific proteases (UBPs), cleaves ubiquitins linked to larger proteins by either peptide or isopeptide bonds. Enzymes in this group vary greatly in size but can be easily identified by the presence of two conserved catalytic motifs; one contains an essential Cys (Cys box) and the other contains two essential histidines (His box; Huang et al., 1995; Wilkinson et al., 1995; Wilkinson, 1997). Outside of these domains, their amino acid sequences diverge, possibly reflecting specific targets and/or cellular functions. Large families of UBPs have been identified in a variety of organisms. For example, whereas yeast (Saccharomyces cerevisae) has a single UCH, it contains 16 different UBPs (Wilkinson, 1997).

Despite their potential importance, little is known about UBPs in plants. Prior to this study, only three have been described, AtUBP3, 4, and 5 from Arabidopsis (Chandler et al., 1997; Rao-Naik et al., 2000), and no UBP mutants had been reported. Using the conserved Cys and His boxes as queries, we have identified 24 additional UBP genes in the near finished Arabidopsis genome. Protein sequence comparisons cluster the complete gene collection into 14 possible AtUBP subfamilies, with seven having two or more members. Substantial diversity among the subfamilies suggests that each may have unique roles in Arabidopsis physiology, growth, and development. Analysis of a subfamily encoded by AtUBP1 and 2 indicates that these proteins are bona fide UBP enzymes, capable of cleaving ubiquitin linked via peptide or isopeptide bonds. T-DNA insertion mutants of AtUBP1 and 2 are phenotypically normal under standard growth conditions. However, the single and double homozygous plants are hypersensitive to the amino acid analog canavanine (CAN), supporting a role for these UBPs in particular, and the ubiquitin/26S proteasome pathway in general in aberrant protein turnover in plants.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

Identification of UBPs in Arabidopsis

Sullivan et al. (1990) first reported that plants have UBP-like activities capable of cleaving ubiquitin attached to other proteins via peptide or isopeptide linkages. To identify the responsible enzymes, we used the sequence of yeast UBP4 (Papa and Hochstrasser, 1993) as the query to search the Arabidopsis expressed sequence tag (EST) database for related proteins. Various yeast and Arabidopsis UBP sequences subsequently were used to examine the Arabidopsis bacteria artificial chromosome (BAC) and EST databases for additional candidate genes. This extensive search (last completed on September 26, 2000) ultimately identified 27 distinct genes that encode proteins with both the Cys- and His-box signature motifs (Wilkinson, 1997). Three of these Arabidopsis genes (AtUBP3-5) have been described recently (Chandler et al., 1997; Rao-Naik et al., 2000). Partial or complete cDNAs have been identified for 21 of the additional 24 genes (the exceptions being AtUBP11, 18, and 19), indicating that most AtUBP family members (at least 24 of the 27) are actively expressed. By comparing the genomic sequences with their corresponding cDNAs, or by deducing intron/exon boundaries using alignments with possible paralogs, the complete coding regions were predicted for all 27 (Chandler et al., 1997; Rao-Naik et al., 2000; data not shown). In many cases, these coding sequences disagreed with those annotated in the AGI database.

Figure 2 shows the organization of the AtUBP protein family and the relationship of some members to possible orthologs from other species. As found in other organisms, Arabidopsis UBPs vary considerably in size with lengths ranging from 365 to 1,116 amino acids. As expected, each contains the Cys and His boxes essential for catalysis. Within these boxes are the positionally conserved Cys and His residues that comprise parts of the active-site (Fig. 3). The Cys boxes of the AtUBP family show high conservation both in sequence (60%-100% similarity) and length (all are 18 residues). In contrast, the His boxes are more diverse in sequence (40%-100% similarity) and show substantial differences in length (55-100 residues) as a result of several insertions/extensions (Fig. 3). In addition, the collection of AtUBPs contains several less conserved motifs common among UBPs (Wilkinson, 1999); these include the Q, G, L, and F boxes, defined by the presence of one or more of these amino acids in their respective domains (Fig. 2). The function(s) of these domains are unknown at present.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 2.   Structure of the members of the Arabidopsis UBP family. Locations of the Cys, Q, G, L, F, and His boxes are indicated. AtUBP proteins with similar structures are grouped by brackets. Predicted amino acid lengths are shown on the right. Potential orthologs in yeast and animals are indicated if available. Amino acid sequence alignments of the Cys and His boxes are shown in Figure 3. AtUBP3, 4, and 5 were recently described by Chandler and Callis (1997) and Rao-Naik et al. (2000). Accession number for the other AtUBP sequences are: AtUBP1 (AF302658), AtUBP2 (AF302659), AtUBP6 (AF302660), AtUBP7 (AF302661), AtUBP8 (AF302662), AtUBP12 (AF302663), AtUBP14 (AF302664), AtUBP15 (AF302665), AtUBP16 (AF302666), AtUBP17 (AF302667), AtUBP20 (AF302668), AtUBP21 (AF302669), AtUBP22 (AF302670), AtUBP23 (AF302671), AtUBP24 (AF302672), AtUBP25 (AF302673), AtUBP26 (AF302674), and AtUBP27 (AF302675). The remaining AtUBP proteins can be located in various BAC clones annotated in the AGI database: AtUBP9 (AF118222), AtUBP10 (AF118222), AtUBP11 (AC006424), AtUBP13 (AC0016795), AtUBP18 (AL031004), and AtUBP19 (AC006954). black-diamond , Indicates the presence of potential zinc finger; , indicates the ubiquitin-like domains; open circle , indicates the MATH domains; triangle , indicates the UBA domains.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 3.   Alignment of the Cys and His boxes from the members of the Arabidopsis UBP family. Black and white arrowheads indicate the positions of the essential Cys and His residues, respectively. Reverse type and gray boxes denote identical and similar amino acids, respectively. Dots indicate gaps. Comparisons were made with the University of Wisconsin-Genetics Computer Group program Pileup and displayed by MacBoxshade 2.7.

Using overall amino acid sequence homology, the positions of the Cys, His, Q, G, L, and F boxes, the presence of additional protein sequence motifs, and the positions of known or predicted introns/exons, the family of AtUBP genes was tentatively clustered into 14 subfamilies. In all cases, these four criteria were in agreement, supporting our subfamily classification (Figs. 2 and 3; data not shown). Percent amino acid sequence similarity among members of the predicted subfamilies ranged from 95% (for the AtUBP3 and 4 subfamily) to 55% (for the AtUBP20 and 21 subfamily) but dropped to <40% when non-family members were compared. As can be seen in Figure 2, discriminating features of each subfamily include the presence of N- and/or C-terminal extensions beyond the Cys and His boxes and insertions that often separate the G and L motifs. Seven of the subfamilies have two or more members, including the AtUBP5, 8-11 subfamily, and the AtUBP15-19 subfamily that contain five members each. The remaining seven subfamilies contain only a single gene (AtUBP14 and 22-27). Outside of the six conserved regions, the AtUBP proteins display little similarity outside of their subfamilies, suggesting that most if not all subfamilies have unique functions and/or recognize distinct substrates.

A number of the UBP subfamilies are predicted to contain additional sequence motifs, including zinc fingers, MATH, ubiquitin-like, and ubiquitin-associated (UBA) domains that may insinuate function (Fig. 2). Potential zinc fingers were found near the N terminus of the AtUBP1-2, AtUBP14, and the AtUBP15-19 subfamilies. These fingers often mediate direct protein-protein interactions following chelation of a zinc ion by positionally conserved Cys and His residues (Freemont, 1993; Takatsuji, 1998; Tyers and Jorgensen, 2000). The AtUBP12-13 subfamily contains a MATH domain common among a number of proteins, including TRAF-related proteins and the meprin family of metalloproteases, and may be involved in dimerization or protein-protein interactions (Uren and Vaux, 1996). Ubiquitin-like domains were detected in AtUBP6-7 and AtUBP26. Similar to their yeast ortholog ScUBP6 (Wyndham et al., 1999), this domain is near the N terminus of AtUBP6 and 7. However for AtUBP26, the ubiquitin-like domain is near its C terminus. The ubiquitin-like domain could help these UBPs bind to ubiquitin-interacting proteins; for ScUBP6, it is dispensable for catalytic activity (Wyndham et al., 1999). Two consensus UBA domains are located near the C terminus of AtUBP14. UBA domains have been found in a number of proteins related to ubiquitin metabolism, including E2s, E3s, and other UBPs (Amerik et al., 1997; Bates and Vierstra, 1999; Hofmann and Pickart, 1999). It has been proposed that this motif binds ubiquitin non-covalently but its function is unknown (Hofmann and Pickart, 1999).

AtUBP1 and 2 Subfamily

To further define the functions of the Arabidopsis UBPs, we continued an in-depth characterization of the AtUBP 1 and 2 subfamily. To confirm that these two genes represent the entire subfamily, genomic DNA from the ecotype Wassilewskija (WS) of Arabidopsis was subjected to DNA gel-blot analysis using either AtUBP1 or 2 as the probe. As can be seen in Figure 4, only AtUBP1- and 2-derived fragments could be detected following either high- or low-stringency washes after digestion of the genomic DNA with three different restriction enzymes. These results indicate that AtUBP1 and 2 are the only members in this subfamily. By sequence analysis of genomic and cDNA clones, the partial organization for AtUBP1 and the complete organization of AtUBP2 was determined (Fig. 5A). Each contains a positionally conserved intron between the sequences for the F and His boxes, whereas AtUBP1 is predicted to contain a second intron following the sequence for the G box. A 531-bp intron was detected upstream of the Met start codon in AtUBP2; a similarly positioned intron may be present in AtUBP1 but could not be identified without an available cDNA sequence in that region.



View larger version (80K):
[in this window]
[in a new window]
 
Figure 4.   DNA gel-blot analysis of AtUBP1 and 2 from WT Arabidopsis (WT) and ubp1-1/ubp2-1 mutant plants. Arabidopsis genomic DNA was isolated from the ecotype WS and the double homozygous ubp1-1/ubp2-1 line, digested with BglII (B), EcoRI (E), or EcoRV (V) and then probed with either an AtUBP1 or 2 gene-specific probe. A, Analysis of WT Arabidopsis genomic DNA following washes at either low stringency (LS) or high stringency (HS). Each band marked by a white arrowhead represents a genomic fragment that corresponds to the gene-specific probe used in that blot. B, Analysis of genomic DNA from WT or the ubp1-1/ubp2-1 (1-1/2-1) double mutant. Blots were washed at high stringency. diamond , Indicates fragments only detected in DNA from WT and not the mutant plants. black-diamond , Denotes fragments present in DNA from the mutant and not WT plants.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 5.   Structure and derived amino acid sequence alignments of the AtUBP1 and 2 genes. A, Structure of AtUBP1 and 2 genes. Lines indicate introns and boxes indicate exons; white boxes, untranslated regions; gray/black boxes, translated regions. The Cys, Q, G, L, F, and His boxes are indicated in black. The T-DNA insertion sites for the ubp1-1 and ubp2-1 mutants are indicated by the triangles. B, Dotplot comparison of the deduced amino acid sequence of AtUBP1 with that of AtUBP2 (left) or human UBP-M (AF12636; Cai et al., 1999) (right). The positions of the conserved Cys, Q, G, L F, and His domains are labeled. Axes denote amino acid position.

The encoded AtUBP1 and 2 proteins are 120 and 106 kD, respectively, and contain all six of the conserved UBP motifs (Fig. 5A). Sequence comparisons revealed that AtUBP1 and AtUBP2 are more related to each other than to any of the other UBPs in Arabidopsis, sharing 62% amino acid sequence similarity. Dotplot comparisons show that this homology is evident even outside the six conserved domains, where most other Arabidopsis UBPs show little relatedness (Fig. 5B). No orthologs have been detected thus far in any other plant species. Their closest homologs outside of plants are human UBP-M (Cai et al., 1999), UBPY (Naviglio et al., 1998), and the oncoprotein tre-2 (Papa and Hochstrasser, 1993) (49%, 49%, and 45% similar to AtUBP1, respectively). However, Dotplot comparisons of UBPM, UBPY, and tre-2 versus AtUBP1 or 2 showed that this similarity is restricted to the six conserved motifs, suggesting that these human UBPs are not functional orthologs (Fig. 5C; data not shown). The absence of possible orthologs suggests that AtUBP1 and 2 are unique to plants.

AtUBP2 Is Active in Vivo and in Vitro

UBPs are best defined by their ability to cleave ubiquitin attached via peptide (alpha -amino) and/or isopeptide (epsilon -amino) bonds to other proteins. To confirm this activity for AtUBP1 and 2 and to identify the nature of their preferred linkages, the recombinant AtUBP2 protein was assayed against a variety of substrates both in vitro and in vivo. For ubiquitin linked via a peptide bond, three translational fusions of varying sizes were tested: the hexameric polyubiquitin protein AtUBQ10 (Callis et al., 1995), the AtUBQ1 ubiquitin-extension protein bearing the 52-amino acid ribosomal protein appended to a single ubiquitin moiety (Callis and Vierstra, 1989), and a fusion of ubiquitin and beta -galactosidase (Ub-beta gal) (Varshavsky, 1997). For ubiquitin linked via an isopeptide bond, a population of multiubiquitin chains linked through Lys-48 was the substrate (van Nocker and Vierstra, 1993). The wild-type (WT) AtUBP2 was tested along with two mutant forms in which the active-site Cys at position 240 (Fig. 3) was substituted for either Ser (AtUBP2C240S) or Ala (AtUBP2C240A). All three proteins could be expressed to high levels as soluble proteins in Escherichia coli.

As can be seen in Figure 6, A and B, AtUBP2 effectively cleaved ubiquitin attached via peptide linkages in vivo. When the recombinant protein was co-expressed with a hexameric polyubiquitin (AtUBQ10) or a ubiquitin-extension protein (AtUBQ1), free ubiquitin of the correct mobility was generated (Fig. 6, A and B). For the polyubiquitin reactions, the cleavage products were released as doublets. The species of higher mass in each doublet represented ubiquitin polymers containing an 11 amino acids N-terminal extension, which was added during the construction of the AtUBQ10 vector for expression in E. coli (Fig. 6A). The activity of AtUBP2 was similar to that of yeast ScUBP1, which has been previously shown to cleave ubiquitin attached via alpha -amino peptide linkages (Tobias and Varshavsky, 1991). As expected, the activity of AtUBP2 was dependent on the active-site Cys; both the AtUBP2C240S and AtUBP2C240A mutants were inactive.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 6.   AtUBP2 encodes a functional UBP protein capable of cleaving polypeptides linked by alpha -amino peptide bonds to the C terminus of ubiquitin. The substrates UBQ10 (hexameric polyubiquitin) (A), UBQ1 (ubiquitin-extension protein) (B), and Ub-X-beta -galactosidase (C) (X = Met or Leu) were co-expressed in E. coli NovaBlue (DE3) strain (Novagen) with either a control vector, a vector expressing yeast ScUBP1, or a vector expressing Arabidopsis AtUBP2, AtUBP2C240S, or AtUBP2C240A. The intact polyubiquitin hexamer (A) and the ubiquitin-extension protein (B) and their cleavage products were detected by immunoblot analyses with anti-ubiquitin antibodies. Ub-X-beta -gal and X-beta -gal (C) were detected using anti-beta -gal antibodies. The positions of the relevant products are indicated, Ub1-6 = polyubiquitins of the indicated lengths. The asterisk in C denotes the position of the omega  fragment of beta -gal expressed constitutively in the NovaBlue (DE3) strain.

AtUBP2 was also co-expressed with Ub-X-beta -galactosidase in which either a Met (Ub-M-beta gal) or a Leu (Ub-L-beta gal) residue immediately followed the ubiquitin moiety. As shown by Papa et al. (1993), this combination of substrates helps confirm that cleavage occurred at the correct site, i.e. immediately following the C-terminal Gly of the ubiquitin moiety. Correct cleavage of Ub-M-beta gal releases M-beta gal, which is stable and accumulates to high levels in E. coli. In contrast, correct cleavage of Ub-L-beta gal generates L-beta gal, which is rapidly degraded by the N-end rule pathway, and thus accumulates to substantially lower levels (Varshavsky, 1997). For example, when yeast ScUBP1 is used, loss of Ub-M-beta gal and Ub-L-beta gal was evident. However, whereas detectable levels of the Ub-M-beta gal digestion product could be seen, the expected cleavage product of Ub-L-beta gal was undetectable (Fig. 6C; Papa and Hochstrasser, 1993). A similar outcome was observed for AtUBP2; whereas the M-beta gal accumulated, the L-beta gal product did not (Fig. 6C). Like the results obtained with the polyubiquitin and ubiquitin-extension protein substrates, the activity of AtUBP2 on Ub-X-beta -gal substrates was dependent on the active-site Cys.

Recombinant AtUBP2 could also cleave in vitro ubiquitin attached via isopeptide (epsilon -amino) linkages. Similar to yeast UBP14 (Amerik et al., 1997), AtUBP2 digested Lys-48-linked multiubiquitin chains and generated free ubiquitin monomers in a reaction that also required Cys-240 (data not shown).

Analysis of T-DNA Insertion Mutants of AtUBP1 and 2

To investigate the biological function(s) of the AtUBP1 and 2 subfamily, we screened available T-DNA-transformed populations of Arabidopsis (Krysan et al., 1996; Krysan et al., 1999) for disruptional insertion(s) in the corresponding genes. Insertion mutants ubp1-1 and ubp2-1 were identified that contain a T-DNA insertion in the coding region, 703- and 2,539-bp downstream of the respective translation start site, with the T-DNA either upstream of the Cys box (ubp1-1) or between the F and His boxes (ubp2-1) (Fig. 5A). Both insertions were predicted to generate a truncated protein missing one or more domains essential for catalysis and hence should represent loss-of-function alleles. To eliminate potential second-site mutations, three back crosses of the mutants to the WT ecotype WS were performed before the homozygous ubp1-1 and ubp2-1 lines were crossed and a double homozygote was isolated.

To confirm that the AtUBP1 and 2 genes were affected in the ubp1-1, ubp2-1, and ubp1-1/ubp2-1 lines, genomic DNA was isolated from the homozygotes and analyzed by DNA gel-blot analysis. In each case, the banding patterns of the mutant differed as predicted from that of WT at the respective loci (Fig. 4B; data not shown). By using RT-PCR, we found that the T-DNA insertion also affected expression of the AtUBP1 and 2 genes. Whereas, the AtUBP1 and 2 mRNAs could be easily detected by RT-PCR, using as a template RNA isolated from WT plants treated with or without CAN, none could be detected using RNA from the corresponding mutants treated similarly (Fig. 7). As a result, we consider it likely that ubp1-1 and ubp2-1 represent null alleles.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 7.   AtUBP1 and 2 mRNAs are absent in the Arabidopsis ubp1-1 and ubp2-1 mutants, respectively. Total RNA was isolated WT ecotype WS, ubp1-1, and ubp2-1 seedlings grown for 6 d on media without CAN followed by an additional 2 d on media with or without 44 µM CAN. RT-PCR was performed using 2 µg of RNA from the appropriate plant and gene-specific primers for AtUBP1 (A), AtUBP2 (B), or the Arabidopsis actin ACT2 gene (C; as a positive control). Reaction products were resolved by agarose gel electrophoresis and stained with ethidium bromide.

To assess the phenotypic functions of the AtUBP1 and 2 subfamily, the ubp1-1 and ubp2-1 mutant plants were examined under a variety of growth conditions. Under normal conditions, either on minimal agar media or in soil, the homozygous ubp1-1, ubp2-1, and ubp1-1/ubp2-1 plants were phenotypically indistinguishable from WT plants, including time of germination, growth rate, flowering time, and overall development. To potentially reveal more subtle phenotypes, we also grew the plants under a variety of adverse conditions, including media that contained amino acid analogs, heavy metals, high concentrations of salts or hormones, and various environmental stresses, e.g. heat, cold, high, and low light (J.C. Young, personal communication). Several of these conditions were chosen based on the reported involvement of the ubiquitin/26S proteasome in the response of plants to hormones (Ruegger et al., 1998; Xie et al., 1998; Girod et al., 1999), light (Jabben et al., 1989), drought (Kiyosue et al., 1994), and exposure to amino acid analogs (Bachmair et al., 1990; Girod et al., 1999). For almost all conditions, the mutant plants responded similar to WT.

The only exception was growth of the mutants on media containing the Arg analog, CAN. Whereas WT plants were mildly affected by concentrations of CAN greater than 5.5 µM, the ubp1-1, ubp2-1, and ubp1-1/ubp2-1 homozygous plants were severely stunted and had shorter roots and chlorotic leaves (Fig. 8). Comparisons of seedling fresh weight indicated that the greatest differences occurred when CAN concentrations were between 11 and 16 µM; at these levels, the fresh weights of mutant plants were 19% to 23% of those for WT plants (Fig. 9A). That the two single mutants and the double mutant showed similar CAN-sensitivity indicates that both AtUBP1 and 2 are necessary for optimal resistance to this amino acid analog (Figs. 8 and 9A).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 8.   T-DNA insertion mutants of Arabidopsis UBP1 and 2 are sensitive to the Arg analog CAN. Plants include WT ecotype WS and lines homozygous for ubp1-1, ubp2-1, and ubp1-1/ubp2-1. A, Plate of seedlings grown for 20 d on 16 µM CAN. B, Representative seedlings grown for 25 d on 11 or 16 µM CAN. C, Complementation of the ubp1 CAN-sensitive phenotype by transformation with the WT AtUBP1 gene and the active-site mutant AtUBP1C211S. Plants were grown for 25 d on 11 µM CAN.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 9.   Partial rescue of the CAN growth inhibition of ubp1-1 and ubp2-1 plants by simultaneous addition of Arg. A, Dose response of Arabidopsis seedlings grown on various concentrations of CAN. WT seedlings and lines homozygous for the ubp1-1, ubp2-1, and ubp1-1/ubp2-1 insertions were grown on various concentrations of CAN. After 25 d, the fresh weights of the plants were measured. B, Partial rescue of the growth inhibition by adding Arg to the growth media. Plants were grown for 25 d on 16 µM CAN with or without 80 µM Arg, Lys, His, Pro, or Glu. "None" represents plants grown without CAN or amino acids. Each bar represents the average of 10 plants ±SD

To confirm that the sensitivity to CAN was a direct result of the T-DNA disruption of either the AtUBP1 or 2 genes, we attempted to rescue the mutant phenotype of ubp1-1 by complementation with the WT AtUBP1 gene and the active-site Cys mutant AtUBP1C211S (Fig. 5C). These two genes were introduced into a homozygous ubp1-1 line using an Agrobacterium-based pCAMBIA3300 vector and T0 transformed seedlings were selected by BASTA herbicide resistance. T1 plants (heterozygous for the transgene), containing either the AtUBP1 or AtUBP1C211S transgene, were then self-pollinated. The progenies (T2) from each independently transformed T1 plant were grown on 11 µM CAN together with WT ecotype WS and the homozygous ubp1-1 mutant. Those plants containing the AtUBP1 transgene showed a 3:1 co-segregation of the CAN resistance with that of BASTA resistance, a marker for the AtUBP1 transgene, whereas all those harboring AtUBP1C211S remained CAN-sensitive like the homozygous ubp1-1 mutant (Fig. 8C; data not shown). The results collectively demonstrated that AtUBP1 is required for optimal CAN resistance and that an active enzyme is required. We also tried to complement the homozygous ubp2-1 line with AtUBP1. However, none of the BASTA-resistant plants regained resistance to CAN (data not shown), suggesting that the sensitivity is not simply caused by a lower dosage of the AtUBP1/2 activity in the ubp1-1 or ubp2-1 plants.

CAN is naturally produced by certain legumes as an anti-herbivore compound. Its toxicity is a result of its ability to substitute for Arg during translation. Once incorporated into a protein, CAN can profoundly alter both protein charge and structure, often leading to the production of an abnormal protein (Rosenthal and Dahlman, 1991; Pazlarova et al., 1993). In plants and animals, such CAN-containing proteins are rapidly purged by the ubiquitin/26S proteasome system (Bachmair et al., 1990; Seufert and Jentsch, 1990; Girod et al., 1999). To help prove that the CAN toxicity was a direct result of its ability to substitute for Arg, we attempted to phenotypically rescue the mutant plants by adding increasing concentrations of Arg or other amino acids (Lys, His, Pro, or Glu) to the CAN-containing media. Lys was chosen because it is structurally similar to Arg; Pro was chosen because it shares a part of the Arg biosynthesis pathway (Arnstein, 1978); Glu was chosen because it is easily converted into Arg in vivo (Arnstein, 1978); and His was chosen because its biosynthesis is unrelated to that for Arg but carries a similar positive charge. We found that only Arg was able to partially restore CAN resistance. At a molar Arg/CAN ratio of 5:1, the ubp1-1, ubp2-1, and ubp1-1/ubp2-1 seedling displayed substantially improved growth. The fresh weights of the mutants grown in the presence of Arg increased to 58% to 66% those for WT plants as compared with approximately 20% if Arg was omitted. None of the other amino acids showed beneficial effects even when added at molar ratios of 10:1 (Fig. 9 and data not shown).

We also tested other amino acid analogs to see if the sensitivity of the ubp1-1 and ubp2-1 mutants was a general effect. These included p-fluoro-Phe (14-136 µM), S-(beta -aminoethyl) Cys (25-125 µM), 7-aza-Trp (5-122 µM), azetidine 2-carboxylic acid (2-247 µM), and O-methyl Thr (0.75-187 µM), analogs of Phe, Lys, Trp, Pro, and Ile, respectively (Busiello et al., 1979; Robinson and Ellis, 1985; Ghislain et al., 1995; van Nocker et al., 1996; Wong and Eftink, 1998). At these ranges of concentrations, all the analogs detectably inhibited growth of WT Arabidopsis. However, no difference in sensitivity was observed between the WT and either the ubp1-1, ubp2-1, or ubp1-1/ubp2-1 seedlings (data not shown). Likewise, the mutants were not hypersensitive to a number of other environmental stresses known to require the ubiquitin/26S proteasome pathway for resistance (Wilkinson, 1999), including heat shock and exposure to heavy metals such as cadmium and copper (data not shown). Taken together, it appeared that the sensitivity of the mutants was specific to CAN.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

Arabidopsis like other eukaryotes contains a large family of UBPs capable of removing polypeptides attached via peptide and/or isopeptide bonds to the C-terminal Gly of ubiquitin. Here, we described a family of 27 UBPs from the near complete genomic sequence of Arabidopsis, which can be tentatively grouped into 14 subfamilies. All contain a consensus His and Cys box that constitutes part of an active site as well as several less conserved boxes of unknown importance. Both the number of genes and the variety of distinct subfamilies suggest that these proteases must have important roles in the ubiquitin/26S proteasome pathway. Likely roles include: (a) generating free ubiquitins from their translation products; (b) recycling ubiquitins during target degradation by removing ubiquitin from peptide fragments and disassembling the multiubiquitin chains; and/or (c) releasing ubiquitins from conjugates before the target can be degraded (Fig. 1).

What are the specific functions of each of the Arabidopsis UBP subfamilies? Enzymatic analyses have provided few clues except to demonstrate that each has UBP activities. For example, AtUBP2 (and likely AtUBP1) appears to have broad specificity, capable of cleaving ubiquitin attached to a variety of substrates by either peptide (alpha -amino) or isopeptide (epsilon -amino) linkages (Fig. 6). Likewise, Callis and coworkers have shown that AtUBP3, 4, and 5 will cleave a variety of peptide linked substrates (Chandler et al., 1997; Rao-Naik et al., 2000). Sequence analysis has also been uninformative. Outside of the conserved regions (Cys, Q, G, L, F, and His boxes), the UBP subfamilies bear little relation to each other, suggesting that they perform specific role(s) and/or have distinct substrate specificities. Members of several subfamilies have additional sequence motifs that likely confer specific functions, e.g. zinc fingers, MATH, ubiquitin-like, and UBA domains, but their function(s) and interaction with potential substrates are unknown.

Cellular location may also determine the function of UBPs. In this regard, the AtUBP3 and 4 proteins have been localized to the nucleus (Chandler et al., 1997) and a nuclear localization signal has been detected in AtUBP5 (Rao-Naik et al., 2000). Given the likelihood that processing of the initial translation products of the polyubiquitin and ubiquitin-extension genes is co-translational (Baker et al., 1992; Hondred et al., 1999), this distribution would exclude involvement of AtUBP3-5 in cleaving these ubiquitin precursors and potentially restrict them to isopeptide-linked substrates.

The relationship of the Arabidopsis UBPs with those from other species may help infer function. However, the functions of most UBPs from other species are unknown. Deletion of many of the 16 UBP genes in yeast is without phenotypic consequence, suggesting that they have overlapping functions. Notable exceptions are ScUBP4 (DOA4) and ScUBP14. Scubp4Delta mutants show a number of defects, including sensitivity to CAN and the accumulation of ubiquitin coupled to small peptides. These data suggest that ScUBP4 is required for the regeneration of ubiquitins during or following target degradation by removing peptide fragments that remain bound to ubiquitin during hydrolysis of the target by the 26S proteasome. ScUBP14 (and its human ortholog IsoT) appears responsible for disassembling free multiubiquitin chains, thereby replenishing the supply of ubiquitin monomers following target degradation (Amerik et al., 1997). Scubp14Delta strains are hypersensitive to CAN and exhibit a strong sporulation defect, a common feature among many ubiquitin pathway mutants in yeast (Hochstrasser, 1996; van Nocker et al., 1996). They also accumulate higher levels of free multiubiquitin chains. Arabidopsis UBP14 could be an ortholog of ScUBP14 (Fig. 2). It is interesting that disruptions of AtUBP14 cause embryonic lethality, suggesting that multiubiquitin chain disassembly is vital during embryogenesis (unpublished data).

With regard to AtUBP1 and 2, we show here that this subfamily is not essential in Arabidopsis. However, it is needed for optimal resistance to CAN, the Arg analog that can increase the production of abnormal proteins by substituting for Arg during translation. The fact that disruption of either AtUBP1 or 2 individually generates a similar CAN sensitivity indicates that both members have non-overlapping roles in removing abnormal proteins. The failure of AtUBP1 to complement the ubp2-1 mutant would preclude the possibility that gene dosage is an important consideration. Whether the need for both enzymes reflects unique expression patterns, different cellular locations, and/or different substrates is unknown. Sequence comparisons of AtUBP1 with 2 identified two patches of unrelated sequences (positioned at 393-414 and 869-929 in AtUBP1) that could impart distinct functions. Using RT-PCR under semi-quantitative conditions, we did not observe any changes in AtUBP1 or 2 mRNA levels when WT seedlings were exposed to CAN (data not shown), indicating that the expression of neither gene is enhanced by the analog.

It was surprising that we did not find that the ubp1-1 and ubp2-1 mutants had increased sensitivity to other toxic amino acid analogs or other stressful conditions, which suggests that the corresponding UBP proteins do not contribute to a general stress response pathway. However, it is possible that the other amino acid analogs are detrimental to growth for reasons other than the increased production of abnormal proteins (e.g. inhibition of amino acid biosynthesis or transport).

How do AtUBP1 and 2 help confer CAN resistance? The lack of an obvious ortholog in yeast or animals suggests a novel function. If these UBPs are required for generating ubiquitin monomers from their translation products or regenerating free ubiquitin by disassembling multiubiquitin chains (Fig. 1), ubp1-1 and ubp2-1 mutants should have substantially reduced levels of free ubiquitin, which in turn could impair overall protein turnover by the ubiquitin/26S proteasome pathway. Like the CAN-sensitive ubp14Delta mutant of yeast (Amerik et al., 1997), this effect can be observed by a reduction in the pool of free ubiquitin and by an increase in the pool of free multiubiquitin chains and ubiquitin-protein conjugates. However, when crude extracts from WT, ubp1-1, ubp2-1, and ubp1-1/ubp2-1 plants grown with or without CAN were subjected to immunoblot analysis with anti-ubiquitin antibodies, indistinguishable profiles of ubiquitin, free multiubiquitin chains, and ubiquitinated proteins were observed (data not shown). This similarity implies that the levels and overall distribution of ubiquitin are unaffected by either mutation.

It is conversely possible that AtUBP1 and 2 are involved in a more subtle change in ubiquitination patterns. One scenario is that they are required to regulate the ubiquitination levels of one or more specific proteins essential for CAN resistance. Deubiquitination of these factors by AtUBP1 and 2 could save them from degradation by the 26S proteasome, leading to increased levels and a concomitant increase in CAN resistance. In a similar fashion, it has been proposed that the Drosophila UBP fat facets participates in eye development by deubiquitinating and thus stabilizing a negative regulator of facet development (Huang et al., 1995). Likewise, yeast UBP3 has been proposed to participate in the heat shock response by deubiquitinating a specific target, rather than affecting overall ubiquitination (Baxter and Craig, 1998). Certainly the nature of these specific substrates will help confirm this possibility. However, at present only three physiological substrates for UBPs have been identified, the ubiquitinated form of MEK kinase for Dictyostelium UbpB and ubiquitinated forms of AF-6 and beta -catenin for the mouse UBP Fam (Chung et al., 1998; Taya et al., 1998; Taya et al., 1999). With the discovery of more natural substrates, the regulatory roles of UBPs will be better understood.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

Identification of Arabidopsis UBP Genes

The Arabidopsis ecotype Columbia genomic and EST databases (http://genome-www.stanford.edu/Arabidopsis/) were searched by BLAST (Altschul et al., 1990) for potential UBP sequences using the consensus Cys and His boxes of yeast UBPs as queries. cDNA sequence information was obtained for 18 of the UBP genes by various strategies. Full-length cDNAs (AtUBP6, 15, and 22) and partial cDNAs (AtUBP8, 12, 16, and 25) were provided by the Arabidopsis Biological Resource Center (Ohio State University, Columbus, OH). Full-length cDNA clones for AtUBP2 and 14 were identified in size-selected cDNA libraries (Kieber et al., 1993). RT-PCR was performed to amplify all or part of the predicted coding region for AtUBP1, 7, 12, 16, 17, 20, 21, 23, 24, 25, and 27. RACE was used to obtain the 5' and/or 3' ends for the AtUBP7, 16, 20, 21, and 26 cDNAs. The nucleotide sequence for each cDNA was determined by the PCR-based dideoxy method (Perkin-Elmer Applied Biosystems, Foster City, CA). Intron/exon boundaries were identified by comparing the genomic DNA and the corresponding cDNA sequences. For several genes (AtUBP1, 8-13, 18, 19, 25, and 26), all or part of the coding regions were predicted using the NetPlantGene program (The Arabidopsis Information Resource database [TAIR]) and by matching the genomic sequence with probable Arabidopsis paralogs. DNA and deduced amino acid sequences were analyzed by using the University of Wisconsin-Genetics Computer Group software packages (Madison, WI). Clustering of the proteins into subfamilies was performed by the programs Pileup and ClustalX. Amino acid sequence alignments were created using Pileup and displayed using MacBoxshade 2.7 (Institute for Animal Health, Pirbright Surrey, UK), and Dotplot analyses were performed using Dotplot with the window set at 30 and the stringency set at 30. Homologs of the AtUBP family from other species were identified by BLAST (Altschul et al., 1990) using all available DNA sequences in the GenBank database; possible orthologs were defined using a cut off of e-100.

The genomic sequences of AtUBP1 and 2 were identified in the BAC clones F24L7 and F13M7, respectively. By comparison to its genomic sequence, the AtUBP2 cDNA was discovered to contain a single nucleotide deletion at position +251, thus causing a frame shift at codon 84. This mutation was corrected by PCR amplifying a 1.4-kb fragment (from nucleotide +1 to +1,462) of AtUBP2 from Arabidopsis genomic DNA (ecotype Columbia) using Pfu polymerase and a 5' primer that introduced a BamHI site at the native start codon. This PCR product was digested with BamHI and XhoI to generate an approximately 1.2-kb fragment (from nucleotide +1 to +1,196), which was then used to replace the region containing the error in the AtUBP2 cDNA harbored in pET32a (Novagen, Madison, WI). The AtUBP2 active-site mutants (pAtUBP2C240S and pAtUBP2C240A) were generated using the QuickChange site-directed mutagenesis method (Stratagene, La Jolla, CA). The primer pairs were CCTTGGGAACACATCGTTCTTTAATTCGATAATGCAG and CTGCATTATCGAATTAAAGAACGATGTGTTCCCAAGG for the Cysright-arrowSer mutant, and CCTTGGGAACACAGCTTTCTTTAATTCGATAATGCAGandCTGCATTATCGAATTAAGAA- AGCTGTGTTCCCAAGG for the Cysright-arrowAla mutant (the mutated nucleotides are underlined).

Genomic DNA Gel-Blot Analysis and RACE

Total genomic DNA was isolated from WT and mutant Arabidopsis (ecotype WS) (Cone et al., 1989), digested with various restriction enzymes, and subjected to DNA gel-blot analysis as described (Fu et al., 1998). 32P-labeled AtUBP1 or 2 DNA probes were hybridized to the membrane-bound DNA at 65°C in 0.5 M sodium phosphate (pH 7.2), 7% (v/v) SDS, 1 mM Na4EDTA. High-stringency wash conditions were 65°C in 0.5× SSC and 0.1% (v/v) SDS (20× SSC = 3 M NaCl and 0.3 M Na3 citrate). Low-stringency wash conditions were 65°C in 3× SSC and 0.1% (v/v) SDS. Following the washes, the blots were subjected to autoradiography.

Total RNA was extracted from 2-week-old Arabidopsis (ecotype Columbia) seedlings grown on Gamborg B-5 agar medium (GIBCO-BRL, Gaithersburg, MD) and purified by LiCl precipitation (Rapp et al., 1992). Residual DNA was digested with DNAse RQ1 (Promega, Madison, WI). 5' and 3' RACE was performed according to the manufacturer's instructions (CLONTECH, Palo Alto, CA). For RT-PCR, first-strand cDNA was generated using 1 µg of RNA, 80 units Moloney murine leukemia virus reverse transcriptase, and 6 pmol of a 3'-gene-specific primer in a 25-µL reaction at 37°C for 1 h. One microliter of this reaction was then used as template DNA in a 25-µL PCR containing 6 pmol each of 5'- and 3'-gene-specific primers and 1 unit Ex-Taq polymerase (PanVera, Madison, WI).

UBP Activity Assays

The ability of UBPs to cleave ubiquitin linked via alpha -amino linkages was determined in vivo using the substrates polyubiquitin AtUBQ10 (modified from p8190; Rao-Naik et al., 2000), ubiquitin-extension protein AtUBQ1 (p8185; Chandler et al., 1997), and Ub-X-beta -galactosidase (X = Met or Leu; Papa and Hochstrasser, 1993). To attenuate the expression of AtUBQ10, the first three nucleotides of the transcription start site were changed to unfavorable bases (Milligan and Uhlenbeck, 1989) by the QuickChange method (Stratagene) using the two degenerate oligonucleotides AATACGACTCACTATAC[A/C][A/C/G]AGACCACAACGGTTTC and GAAACCGTTGTGGTCT[C/G/T][G/T]GTATAGTGAGTCGTATT (substitutions are underlined; degenerate nucleotides are bracketed). A low-expressing clone (pAtUBQ10-LE) of AtUBQ10 was identified by immunoblot analysis of individual colonies using anti-ubiquitin antibodies (van Nocker and Vierstra, 1993). All substrate constructs were pACYC184-based plasmids.

Each of the three alpha -amino substrates was co-expressed with WT or mutant versions of AtUBP2 in pET32a (see above) in the Escherichia coli strain NovaBlue (DE3) using the standard conditions (Novagen). Lysates were subjected to SDS-PAGE, transferred to nitrocellulose (Millipore, Bedford, MA) for AtUBQ10 or AtUBQ1 substrates or Immobilon-P polyvinylidene difluoride (Millipore) for Ub-X-beta -gal substrates, and probed with anti-ubiquitin antibodies or anti-beta -gal antibodies (Promega). Alkaline phosphatase-conjugated goat anti-rabbit immunoglobulins (Kirkegaard and Perry Laboratories, Gaithersburg, MD), in conjunction with the substrates nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate, were used for detection. Yeast UBP1, expressed from plasmid RB293 (Tobias and Varshavsky, 1991; RT Baker, unpublished data), was used as a positive control.

The in vitro cleavage assay for ubiquitin attached via an epsilon -amino isopeptide bond used Lys-48-linked multiubiquitin chains as substrates. These chains were synthesized in vitro using the wheat E2 TaUBC7 as described (van Nocker and Vierstra, 1993). Cell extracts containing recombinant AtUBP2 or yeast UBP14 (Amerik et al., 1997) were obtained by sonicating packed cells expressing the corresponding proteins resuspended in 1/20 of the original culture volumes with 50 mM Tris-HCl, pH 8.0, 5% (v/v) glycerol, 1 mM dithiothreitol, and 1 mM Na4 EDTA. Lysates (37.5 µL) were incubated for 2 h at 37°C with 2.5 µL of multiubiquitin chains (50 ng). The reactions were quenched by adding 5× SDS-PAGE sample buffer and heating for 5 min. Reaction products were subjected to SDS-PAGE and immunoblot analysis with anti-ubiquitin antibodies.

Isolation of T-DNA Insertion Mutants in AtUBP1 and 2

Using the PCR-based method of Krysan et al. (1999), Arabidopsis lines containing a T-DNA insertion within either AtUBP1 or 2 were identified. For the initial screens, DNA pools prepared from approximately 1,200 individually transformed plants were PCR amplified with a 3'-gene-specific primer of either AtUBP1 (AAGATATCAAGCTTCCGTGTTCTCAGATTC) or AtUBP2 (ACCTCCTCTAACATACGCCACATAATGACC) in combination with either a left border or right border (RB) T-DNA-specific primer (Krysan et al., 1996). The PCR products were subjected to DNA gel-blot analysis using AtUBP1 or AtUBP2 gene-specific probes. The candidate PCR products were sequenced to confirm disruption of the correct gene and locate the exact insertion site of the T-DNA. DNA subpools from pools that tested positive were screened individually by PCR using the appropriate primer combinations. Individual mutant plants were identified by PCR and DNA gel blotting using the corresponding gene as the probe. ubp1-1 and ubp2-1 were found within the T-DNA insertion lines generated by Dr. K. Feldmann (obtained from the Arabidopsis Biological Resource Center and from E.I. du Pont de Nemours & Company, Wilmington, DE). Homozygous lines for each mutant were isolated following three backcrosses of the heterozygous mutants to WT ecotype WS and then one round of self pollination. The presence of the T-DNA (which carries the NPTII gene) was identified by both PCR and kanamycin resistance. The ubp1-1/ubp2-1 double mutant was generated by crossing homozygous ubp1-1 with homozygous ubp2-1 plants; individuals homozygous for both insertions were identified in the F2 generation.

To verify that AtUBP1 and 2 are not expressed in the Arabidopsis ubp1-1 and ubp2-1 mutants, respectively, RNA was from each line was subjected to RT-PCR. Total RNA was isolated from the mutant and WT ecotype WS seedlings (see above; Rapp et al., 1992) grown for 6 d on minimal media and an additional 2 d with or without 44 µM CAN. RT-PCR was performed using 2 µg RNA from the appropriate plants and gene-specific primers for AtUBP1 (GGCTTTTGATGAGTGTAGAGAC and CATTGCCCCTAAATGTTCC), AtUBP2 (ATCAAGCAACACCAGCAAC and GCCACATAATGACCTCCTC), or the Arabidopsis actin ACT2 gene (GGTTTTGCTGGTGATGATG and ACCATAAGGTTCTAAAGAG). The conditions for RT-PCR were as described above.

Phenotypic Analysis of AtUBP1 and 2 T-DNA Insertion Mutants

Sterilized seeds of WT (ecotype WS) and mutant plants were stratified for 4 d at 4°C and then spotted on agar plates containing 0.5× Murashige and Skoog media (GIBCO BRL) with or without supplements. Under most conditions, seedlings were grown at 21°C with a 19-h-light/5-h-dark photoperiod. The effects of the various supplements were assayed after 25 d of growth by measuring seedling fresh weight. For immunoblot analysis, leaves were collected and homogenized in extraction buffer (3 mL/g fresh weight) containing 50 mM Tris, pH 8.0, 1 mM Na4EDTA, and 10 mM Na2S2O5. Following clarification at 14,000g for 5 min, an appropriate volume of 5× SDS-PAGE sample buffer was added to each supernatant, and the total mixture was boiled for 5 min. Samples were assayed by SDS-PAGE and immunoblot analysis using anti-ubiquitin antibodies as described above.

Complementation of ubp1-1

For complementation of the ubp1-1 mutation, a WT AtUBP1 gene was reconstructed from a 5-kb XbaI/XhoI fragment from BAC F24L7 containing the 5' region of AtUBP1 and a 400-bp XhoI/EcoRI fragment from the AtUBP1 cDNA containing the 3' region. The resulting 5.4-kb sequence included the entire coding region of AtUBP1 and 1.8 kb upstream of the predicted start codon. The Cysright-arrowSer active-site mutant was prepared by converting the Cys211 codon in the XbaI/XhoI 5' fragment to that for Ser by the QuickChange method. The WT and mutated genes were cloned into the binary vector pCAMBIA3300 (CAMBIA, Canberra, Australia). The vectors were introduced into the Agrobacterium strain GV3101, which then was used to infect the Arabidopsis ubp1-1 mutant by the floral dip method (Clough and Bent, 1998). Transgenic plants harboring the BAR selection marker were identified by spraying T1 seedlings from the original transformants with 200 mg/L of the herbicide BASTA (Casas et al., 1993).


    ACKNOWLEDGMENTS

We thank Judy Callis, Alex Varshavsky, Rohan Baker, and Mark Hochstrasser for providing several of the UBP substrates and two yeast UBP enzymes. We are also grateful for the technical assistance from Joe Walker, Rich Clough, Jeff Young, and Peggy Hatfield.

    FOOTNOTES

Received September 11, 2000; accepted September 26, 2000.

1 This work was supported by the U.S. Department of Agriculture-National Research Initiative Competitive Grants Program (grant nos. 97-35301-4218 and 00-35301-9040) and the Research Division of the University of Wisconsin, College of Agriculture and Life Sciences (grant no. Hatch 142-N936), a National Institutes of Health Postdoctoral Fellowship (to J.H.D.), and a U.S. Department of Agriculture Postdoctoral Grant (to T.G.F.).

2 Present address: Department of Biochemistry, University of Washington, Seattle, WA 98195.

3 Present address: Department of Biochemistry, University of Wisconsin, Madison, WI 53706.

* Corresponding author; e-mail vierstra{at}facstaff.wisc.edu; fax 608-262-4743.


    LITERATURE CITED
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED

  • Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403-410 [CrossRef][Web of Science][Medline]
  • Amerik A, Swaminathan S, Krantz BA, Wilkinson KD, Hochstrasser M (1997) In vivo disassembly of free polyubiquitin chains by yeast Ubp14 modulates rates of protein degradation by the proteasome. EMBO J 16: 4826-4838 [CrossRef][Web of Science][Medline]
  • Arnstein HRV, ed (1978) Amino Acid and Protein Biosynthesis. University Park Press
  • Bachmair A, Becker F, Masterson RV, Schell J (1990) Perturbation of the ubiquitin system causes leaf curling, vascular tissue alterations and necrotic lesions in a higher plant. EMBO J 9: 4543-4549 [Web of Science][Medline]
  • Baek SH, Park KC, Lee JI, Kim KI, Yoo YJ, Tanaka K, Baker RT, Chung CH (1998) A novel family of ubiquitin-specific proteases in chick skeletal muscle with distinct N- and C-terminal extensions. Biochem J 334: 677-684
  • Baker RT, Tobias JW, Varshavsky A (1992) Ubiquitin-specific proteases of Sacchraromyces cerevisiae: cloning of UBP2 and UBP3, and functional analysis of the UBP gene family. J Biol Chem 267: 23364-23375 [Abstract/Free Full Text]
  • Bates PW, Vierstra RD (1999) UPL1 and 2, two 405 kDa ubiquitin-protein ligases from Arabidopsis thaliana related to the HECT-domain protein family. Plant J 20: 183-195 [CrossRef][Web of Science][Medline]
  • Baxter BK, Craig EA (1998) Isolation of UBP3, encoding a de-ubiquitinating enzyme, as a multicopy suppressor of a heat-shock mutant strain of S. cerevisiae. Curr Genet 33: 412-419 [CrossRef][Medline]
  • Busiello V, Di Girolamo M, De Marco C (1979) Thiaisoleucine and protein synthesis. Biochim Biophys Acta 561: 206-214 [Medline]
  • Cai SY, Babbitt RW, Marchesi VT (1999) A mutant deubiquitinating enzyme (Ubp-M) associates with mitotic chromosomes and blocks cell division. Proc Natl Acad Sci USA 96: 2828-2833 [Abstract/Free Full Text]
  • Callis J, Vierstra RD (1989) Ubiquitin and ubiquitin genes in higher plants. Oxford Surv Plant Mol Cell Biol 6: 1-30
  • Callis J, Vierstra RD (2000) Protein degradation in signaling. Curr Opin Biol 3: 381-386
  • Callis JA, Carpenter TB, Sun CW, Vierstra RD (1995) Structure and evolution of genes encoding polyubiquitin and ubiquitin-like proteins in Arabidopsis thaliana ecotype Columbia. Genetics 139: 921-939 [Abstract]
  • Casas AM, Kononowicz AK, Zehr UB, Tomes DT, Axtell JD, Butler LG, Bressan RA, Hasegawa PM (1993) Transgenic sorghum plants via microprojectile bombardment. Proc Natl Acad Sci USA 90: 11212-11216 [Abstract/Free Full Text]
  • Chandler JS, McArdle B, Callis J (1997) AtUBP3 and AtUBP4 are two closely related Arabidopsis thaliana ubiquitin-specific proteases present in the nucleus. Mol Gen Genet 255: 302-310 [CrossRef][Web of Science][Medline]
  • Chung CH, Baek SH (1999) Deubiquitinating enzymes: their diversity and emerging roles. Biochem Biophys Res Commun 266: 633-640 [CrossRef][Web of Science][Medline]
  • Chung CY, Reddy TB, Zhou K, Firtel RA (1998) A novel, putative MEK kinase controls developmental timing and spatial patterning in Dictyostelium and is regulated by ubiquitin-mediated protein degradation. Genes Dev 12: 3564-3578 [Abstract/Free Full Text]
  • Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 [CrossRef][Web of Science][Medline]
  • Cone KC, Frisch EB, Phillips TE (1989) dek1 interferes with aleurone differentiation. Maize Genet Coop Newsl 63: 67-68
  • D'Andrea A, Pellman D (1998) Deubiquitinating enzymes: a new class of biological regulators. Crit Rev Biochem Mol Biol 33: 337-352 [CrossRef][Web of Science][Medline]
  • Eytan E, Armon T, Heller H, Beck S, Hershko A (1993) Ubiquitin C-terminal hydrolase activity associated with the 26S protease complex. J Biol Chem 268: 4668-4674 [Abstract/Free Full Text]
  • Freemont PS (1993) The RING finger: a novel protein sequence motif related to the zinc finger. Ann NY Acad Sci 684: 174-192 [Web of Science][Medline]
  • Fu H, Doelling JH, Arendt CS, Hochstrasser M, Vierstra RD (1998) Molecular organization of the 20S proteasome gene family from Arabidopsis thaliana. Genetics 149: 677-692 [Abstract/Free Full Text]
  • Galan J, Haguenauer-Tsapis R (1997) Ubiquitin lys63 is involved in ubiquitination of a yeast plasma membrane protein. EMBO J 16: 5847-5854 [CrossRef][Web of Science][Medline]
  • Ghislain M, Frankard V, Jacobs M (1995) A dinucleotide mutation in dihydrodipicolinate synthase of Nicotiana sylvestris leads to lysine overproduction. Plant J 8: 733-743 [CrossRef][Medline]
  • Girod PA, Fu H, Zryd JP, Vierstra RD (1999) Multiubiquitin chain binding subunit MCB1 (RPN10) of the 26S proteasome is essential for developmental progression in Physcomitrella patens. Plant Cell 11: 1457-1472 [Abstract/Free Full Text]
  • Gray DA, Inazawa J, Gupta K, Wong A, Ueda R, Takahashi T (1995) Elevated expression of Unph, a proto-oncogene at 3p21.3, in human lung tumors. Oncogene 10: 2179-2183 [Web of Science][Medline]
  • Hadari T, Warms JV, Rose IA, Hershko A (1992) A ubiquitin C-terminal isopeptidase that acts on polyubiquitin chains: role in protein degradation. J Biol Chem 267: 719-727 [Abstract/Free Full Text]
  • Hegde AN, Inokuchi K, Pei W, Casadio A, Ghirardi M, Chain DG, Martin KC, Kandel ER, Schwartz JH (1997) Ubiquitin C-terminal hydrolase is an immediate-early gene essential for long-term facilitation in aplysia. Cell 89: 115-126 [CrossRef][Web of Science][Medline]
  • Hershko A, Ciechanover A (1998) The ubiquitin system. Annu Rev Biochem 67: 425-479 [CrossRef][Web of Science][Medline]
  • Hochstrasser M (1996) Ubiquitin-dependent protein degradation. Annu Rev Genet 30: 405-439 [CrossRef][Web of Science][Medline]
  • Hofmann RM, Pickart CM (1999) Noncanonical MMS2-encoded ubiquitin-conjugating enzyme functions in assembly of novel polyubiquitin chains for DNA repair. Cell 96: 645-653 [CrossRef][Web of Science][Medline]
  • Hondred D, Walker JM, Mathews DE, Vierstra RD (1999) Use of ubiquitin fusions to augment protein expression in transgenic plants. Plant Physiol 119: 713-724 [Abstract/Free Full Text]
  • Huang Y, Baker RT, Fischer-Vize JA (1995) Control of cell fate by a deubiquitinating enzyme encoded by the fat facets gene. Science 270: 1828-1831 [Abstract/Free Full Text]
  • Jabben M, Shanklin J, Vierstra RD (1989) Ubiquitin-phytochrome conjugates: pool dynamics during in vivo phytochrome degradation. J Biol Chem 264: 4998-5005 [Abstract/Free Full Text]
  • Johnston SC, Larsen CN, Cook WJ, Wilkinson KD, Hill CP (1997) Crystal structure of a deubiquitinating enzyme (human UCH-L3) at 1.8 Å resolution. EMBO J 16: 3787-3796 [CrossRef][Web of Science][Medline]
  • Kahana A, Gottschling DE (1999) DOT4 links silencing and cell growth in Saccharomyces cerevisiae. Mol Cell Biol 19: 6608-6620 [Abstract/Free Full Text]
  • Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR (1993) CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell 72: 427-441 [CrossRef][Web of Science][Medline]
  • Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1994) ERD15, a cDNA for a dehydration-induced gene from Arabidopsis thaliana. Plant Physiol 106: 1707 [CrossRef][Web of Science][Medline]
  • Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an insertional mutagen in Arabidopsis. Plant Cell 11: 2283-2290 [Free Full Text]
  • Krysan PJ, Young JC, Tax F, Sussman MR (1996) Identification of transferred DNA insertions within Arabidopsis genes involved in signal transduction and ion transport. Proc Natl Acad Sci USA 93: 8145-8150 [Abstract/Free Full Text]
  • Lam YA, Xu W, DeMartino GN, Cohen RE (1997) Editing of ubiquitin conjugates by an isopeptidase in the 26S proteasome. Nature 385: 737-740 [CrossRef][Medline]
  • Leroy E, Boyer R, Auburger G, Leube B, Ulm G, Mezey E, Harta G, Brownstein MJ, Jonnalagada S, Chernova T, Dehejia A, Lavedan C, Gasser T, Steinbach PJ, Wilkinson KD, Polymeropoulos MH (1998) The ubiquitin pathway in Parkinson's disease. Nature 395: 451-452 [CrossRef][Medline]
  • Lindsey DF, Amerik A, Deery WJ, Bishop JD, Hochstrasser M, Gomer RH (1998) A deubiquitinating enzyme that disassembles free polyubiquitin chains is required for development but not growth in Dictyostelium. J Biol Chem 273: 29178-29187 [Abstract/Free Full Text]
  • Liu LQ, Ilaria R Jr, Kingsley PD, Iwama A, van Etten RA, Palis J, Zhang DE (1999) A novel ubiquitin-specific protease, UBP43, cloned from leukemia fusion protein AML1-ETO-expressing mice, functions in hematopoietic cell differentiation. Mol Cell Biol 19: 3029-3038 [Abstract/Free Full Text]
  • Milligan JF, Uhlenbeck OC (1989) Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol 180: 51-62 [Web of Science][Medline]
  • Moazed D, Johnson D (1996) A deubiquitinating enzyme interacts with SIR4 and regulates silencing in S. cerevisiae. Cell 86: 667-677 [CrossRef][Web of Science][Medline]
  • Nakamura T, Hillova J, Mariage-Samson R, Onno M, Huebner K, Cannizzaro LA, Boghosian-Sell L, Croce CM, Hill M (1992) A novel transcriptional unit of the tre oncogene widely expressed in human cancer cells. Oncogene 7: 733-741 [Web of Science][Medline]
  • Naviglio S, Mattecucci C, Matoskova B, Nagase T, Nomura N, Di Fiore PP, Draetta GF (1998) UBPY: a growth-regulated human ubiquitin isopeptidase. EMBO J 17: 3241-3250 [CrossRef][Web of Science][Medline]
  • Papa FR, Hochstrasser M (1993) The yeast DOA4 gene encodes a deubiquitinating enzyme related to a product of the human tre-2 oncogene. Nature 366: 313-319 [CrossRef][Medline]
  • Pazlarova J, Dvorakova M, Chaloupka J (1993) Turnover of canavanine-containing proteins in Saccharomyces cerevisiae. Folia Microbiol 38: 225-228
  • Pickart CM, Rose IA (1985) Ubiquitin carboxyl-terminal hydrolase acts on ubiquitin carboxyl-terminal amides. J Biol Chem 260: 7903-7910 [Abstract/Free Full Text]
  • Rao-Naik C, Chandler JS, McArdle B, Callis J (2000) Ubiquitin-specific proteases from Arabidopsis thaliana: cloning of AtUBP5 and analysis of substrate specificity of AtUBP3, AtUBP4, and AtUBP5 using Escherichia coli in vivo and in vitro assays. Arch Biochem Biophys 379: 198-208 [CrossRef][Web of Science][Medline]
  • Rapp JC, Baumgartner BJ, Mullet J (1992) Quantitative analysis of transcription and RNA levels of 15 barley chloroplast genes: transcription rates and mRNA levels vary over 300-fold, predicted mRNA stabilities vary 30-fold. J Biol Chem 267: 21404-21411 [Abstract/Free Full Text]
  • Robinson C, Ellis RJ (1985) Transport of proteins into chloroplasts: the effect of incorporation of amino acid analogues on the import and processing of chloroplast polypeptides. Eur J Biochem 152: 67-73 [Web of Science][Medline]
  • Rosenthal GA, Dahlman DL (1991) Studies of L-canavanine incorporation into insectan lysozyme. J Biol Chem 266: 15684-15687 [Abstract/Free Full Text]
  • Ruegger M, Dewey E, Gray WM, Hobbie L, Turner J, Estelle M (1998) The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast grr1p. Genes Dev 12: 198-207 [Abstract/Free Full Text]
  • Seufert W, Jentsch S (1990) Ubiquitin-conjugating enzymes UBC4 and UBC5 mediate selective degradation of short-lived and abnormal proteins. EMBO J 9: 543-550 [Web of Science][Medline]
  • Singer JD, Manning BM, Formosa T (1996) Coordinating DNA replication to produce one copy of the genome requires genes that act in ubiquitin metabolism. Mol Cell Biol 16: 1356-1366 [Abstract]
  • Sullivan ML, Callis J, Vierstra RD (1990) High performance liquid chromatography resolution of ubiquitin pathway enzymes from wheat germ. Plant Physiol 94: 710-716 [Abstract/Free Full Text]
  • Takatsuji H (1998) Zinc-finger transcription factors in plants. Cell Mol Life Sci 54: 582-596 [CrossRef][Web of Science][Medline]
  • Taya S, Yamamoto T, Kanai-Azuma M, Wood SA, Kaibuchi K (1999) The deubiquitinating enzyme Fam interacts with and stabilizes beta-catenin. Genes Cells 4: 757-767 [Abstract]
  • Taya S, Yamamoto T, Kano K, Kawano Y, Iwamatsu A, Tsuchiya T, Tanaka K, Kanai-Azuma M, Wood SA, Mattick JS, Kaibuchi K (1998) The Ras target AF-6 is a substrate of the Fam deubiquitinating enzyme. J Cell Biol 142: 1053-1062 [Abstract/Free Full Text]
  • Tobias JW, Varshavsky A (1991) Cloning and functional analysis of the ubiquitin-specific protease gene UBP1 of Saccharomyces cerevisiae. J Biol Chem 266: 12021-12028 [Abstract/Free Full Text]
  • Tyers M, Jorgensen P (2000) Proteolysis and the cell cycle: with this RING I do thee destroy. Curr Opin Genet Dev 10: 54-64 [CrossRef][Web of Science][Medline]
  • Uren AG, Vaux DL (1996) TRAF proteins and meprins share a conserved domain. Trends Biochem Sci 21: 244-245 [CrossRef][Medline]
  • van Nocker S, Sadis S, Rubin DM, Glickman M, Fu H, Coux O, Wefes I, Finley D, Vierstra RD (1996) The multiubiquitin-chain-binding protein Mcb1 is a component of the 26S proteasome in Saccharomyces cerevisiae and plays a nonessential, substrate-specific role in protein turnover. Mol Cel Biol 16: 6020-6028 [Abstract]
  • van Nocker S, Vierstra RD (1993) Multiubiquitin chains linked through lysine-48 are abundant in vivo and competent intermediates in the ubiquitin-dependent proteolytic pathway. J Biol Chem 268: 24766-24773 [Abstract/Free Full Text]
  • Varshavsky A (1997) The N-end rule pathway of protein degradation. Genes Cells 2: 13-28 [Abstract]
  • Vierstra RD (1996) Proteolysis in plants: mechanisms and functions. Plant Mol Biol 32: 275-302 [CrossRef][Web of Science][Medline]
  • Wilkinson KD (1997) Regulation of ubiquitin-dependent processes by deubiquitinating enzymes. FASEB J 11: 1245-1256 [Abstract]
  • Wilkinson KD (1999) Ubiquitin-dependent signaling: the role of ubiquitination in the response of cells to their environment. J Nutr 129: 1933-1936 [Abstract/Free Full Text]
  • Wilkinson KD, Lee KM, Deshpande S, Duerksen-Hughes P, Boss JM, Pohl J (1989) The neuron-specific protein PGP 9.5 is a ubiquitin carboxyl-terminal hydrolase. Science 246: 670-673 [Abstract/Free Full Text]
  • Wilkinson KD, Tashayev VL, O'Connor LB, Larsen CN, Kasperek E, Pickart CM (1995) Metabolism of the polyubiquitin degradation signal: structure, mechanism, and role of isopeptidase T. Biochemistry 34: 14535-14546 [CrossRef][Medline]
  • Wong CY, Eftink MR (1998) Incorporation of tryptophan analogues into Staphylococcal nuclease: stability toward thermal and guanidine-HCl induced unfolding. Biochemistry 37: 8947-8953 [CrossRef][Medline]
  • Wyndham AM, Baker RT, Chelvanayagam G (1999) The Ubp6 family of deubiquitinating enzymes contains a ubiquitin-like domain: SUb. Protein Sci 8: 1268-1275 [Web of Science][Medline]
  • Xie DX, Feys BF, James S, Nieto-Rostro M, Turner JG (1998) COI1: an Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 280: 1091-1094 [Abstract/Free Full Text]
  • Zhu Y, Carroll M, Papa FR, Hochstrasser M, D'Andrea AD (1996) DUB-1, a deubiquitinating enzyme with growth-suppressing activity. Proc Natl Acad Sci USA 93: 3275-3279 [Abstract/Free Full Text]
© 2000 American Society of Plant Physiologists



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
J. Stuttmann, E. Lechner, R. Guerois, J. E. Parker, L. Nussaume, P. Genschik, and L. D. Noel
COP9 Signalosome- and 26S Proteasome-dependent Regulation of SCFTIR1 Accumulation in Arabidopsis
J. Biol. Chem., March 20, 2009; 284(12): 7920 - 7930.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
R. J. Schmitz, Y. Tamada, M. R. Doyle, X. Zhang, and R. M. Amasino
Histone H2B Deubiquitination Is Required for Transcriptional Activation of FLOWERING LOCUS C and for Proper Control of Flowering in Arabidopsis
Plant Physiology, February 1, 2009; 149(2): 1196 - 1204.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Luo, M.-Z. Luo, D. Buzas, J. Finnegan, C. Helliwell, E. S. Dennis, W. J. Peacock, and A. Chaudhury
UBIQUITIN-SPECIFIC PROTEASE 26 Is Required for Seed Development and the Repression of PHERES1 in Arabidopsis
Genetics, September 1, 2008; 180(1): 229 - 236.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
J. H. Doelling, A. R. Phillips, G. Soyler-Ogretim, J. Wise, J. Chandler, J. Callis, M. S. Otegui, and R. D. Vierstra
The Ubiquitin-Specific Protease Subfamily UBP3/UBP4 Is Essential for Pollen Development and Transmission in Arabidopsis
Plant Physiology, November 1, 2007; 145(3): 801 - 813.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
J. Larkindale, J. D. Hall, M. R. Knight, and E. Vierling
Heat Stress Phenotypes of Arabidopsis Mutants Implicate Multiple Signaling Pathways in the Acquisition of Thermotolerance
Plant Physiology, June 1, 2005; 138(2): 882 - 897.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. J. Book, P. Yang, M. Scalf, L. M. Smith, and R. D. Vierstra
Tripeptidyl Peptidase II. An Oligomeric Protease Complex from Arabidopsis
Plant Physiology, June 1, 2005; 138(2): 1046 - 1057.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Yang, H. Fu, J. Walker, C. M. Papa, J. Smalle, Y.-M. Ju, and R. D. Vierstra
Purification of the Arabidopsis 26 S Proteasome: BIOCHEMICAL AND MOLECULAR ANALYSES REVEALED THE PRESENCE OF MULTIPLE ISOFORMS
J. Biol. Chem., February 20, 2004; 279(8): 6401 - 6413.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
J. H. Kim, K. C. Park, S. S. Chung, O. Bang, and C. H. Chung
Deubiquitinating Enzymes as Cellular Regulators
J. Biochem., July 1, 2003; 134(1): 9 - 18.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. M. Mariadason, D. Arango, G. A. Corner, M. J. Aranes, K. A. Hotchkiss, W. Yang, and L. H. Augenlicht
A Gene Expression Profile That Defines Colon Cell Maturation in Vitro
Cancer Res., August 15, 2002; 62(16): 4791 - 4804.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. P. Malakhov, O. A. Malakhova, K. I. Kim, K. J. Ritchie, and D.-E. Zhang
UBP43 (USP18) Specifically Removes ISG15 from Conjugated Proteins
J. Biol. Chem., March 15, 2002; 277(12): 9976 - 9981.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
I. Tzafrir, J. A. McElver, C.-m. Liu, L. J. Yang, J. Q. Wu, A. Martinez, D. A. Patton, and D. W. Meinke
Diversity of TITAN Functions in Arabidopsis Seed Development
Plant Physiology, January 1, 2002; 128(1): 38 - 51.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. P. Malakhov, O. A. Malakhova, K. I. Kim, K. J. Ritchie, and D.-E. Zhang
UBP43 (USP18) Specifically Removes ISG15 from Conjugated Proteins
J. Biol. Chem., March 15, 2002; 277(12): 9976 - 9981.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (39)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yan, N.
Right arrow Articles by Vierstra, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yan, N.
Right arrow Articles by Vierstra, R. D.
Agricola
Right arrow Articles by Yan, N.
Right arrow Articles by Vierstra, R. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2000 by the American Society of Plant Biologists