|
Plant Physiol, January 2001, Vol. 125, pp. 396-405
A Nuclear Casein Kinase 2 Activity Is Involved in Early
Events of Transcriptional Activation Induced by Salicylic Acid in
Tobacco1
Perla
Hidalgo,
Virginia
Garretón,
Carmen Gloria
Berríos,
Héctor
Ojeda,
Xavier
Jordana, and
Loreto
Holuigue*
Departamento de Genética Molecular y Microbiología,
Facultad de Ciencias Biológicas, Pontificia Universidad
Católica de Chile, P.O. Box 114-D, Santiago, Chile
 |
ABSTRACT |
Salicylic acid (SA) activates immediate early transcription of
genes controlled by a family of DNA promoter elements named as-1-like elements. These elements are functional in the
promoter of glutathione S-transferase genes. We have
previously shown that SA increases the binding of tobacco
(Nicotiana tabacum cv Xanthi nc) nuclear factors to the
as-1 sequence in a process mediated by protein
phosphorylation. In this study we give evidence for the participation
of a nuclear protein kinase CK2 (casein kinase 2) in the pathway
activated by SA in tobacco. The first line of evidence comes from the
evaluation of the CK2 activity in nuclear extracts prepared from
tobacco plants treated with SA or water as a control. Results from
these experiments indicate that SA increases the nuclear CK2 activity.
The second line of evidence derives from the evaluation of the in vivo
effect of 5,6-dichloro-1-( -D-ribofuranosyl) benzimidazole (DRB), a cell-permeable CK2 inhibitor, on the
responsiveness of the as-1 sequence to SA. Results from
these experiments indicate that DRB impairs the activating effect of SA
on the transcription of both, the GUS reporter gene
controlled by a tetramer of the as-1 element, and the
endogenous gnt35 gene encoding a glutathione S-transferase, in transgenic tobacco plants. DRB also
impaired the increasing effect of SA on the binding of nuclear factors to the as-1 element. Furthermore, transcription of the
as-1/GUS reporter gene activated by the synthetic auxin
2,4-dichlorophenoxyacetic acid and by methyl jasmonate was also
inhibited by DRB. To our knowledge, this is the first report in which
activation of a CK2 enzyme by a plant hormone is reported.
 |
INTRODUCTION |
The transcription of defense genes
induced by pathogens in plants is regulated by a complex network of
signaling pathways (Yang et al., 1997 ; Scheel, 1998 ). In these
pathways, metabolites like salicylic acid (SA), jasmonates,
H2O2, ethylene, and nitric oxide, have been identified as secondary signals (Durner et al., 1997 ;
Dong, 1998 ; Reymond and Farmer, 1998 ). At different times after
pathogen recognition, these secondary signal substances accumulate
transiently and transduce the signal into the nucleus where the
transcription of specific defense genes is activated. The SA-mediated
pathway is probably one of the most studied pathways in defense
reactions (Durner et al., 1997 ; Dong, 1998 ; Reymond and Farmer, 1998 ).
Important components of the SA-mediated signaling pathway have been
identified by the use of molecular, biochemical, and genetical
approaches (Durner et al., 1997 ; Zhang and Klessig, 1997 , Zhang et al.,
1999 ). Nevertheless, the molecular mechanism by which SA activates gene
transcription is still poorly understood.
According to their activation kinetics, the genes directly activated by
SA can be classified into two groups (Durner et al., 1997 ; Reymond and
Farmer, 1998 ). One group corresponds to acidic pathogenesis-related
(PR) genes, whose activation by SA requires de novo protein
synthesis and forms part of the late events of the SA-mediated pathway
(Uknes et al., 1993 ; Qin et al., 1994 ). A second group corresponds to
genes whose activation by SA does not require protein synthesis and
forms part of the immediate early events of the SA-mediated pathway.
The genes coding for glutathione S-transferases (GSTs) are
one of the best characterized (Liu and Lam, 1994 ; Xiang et al., 1996 ).
They belong to the second group of SA-activated genes according to
their activation kinetics and are involved in the detoxification of
cytotoxic compounds produced during the defense reaction (Marrs, 1996 ).
Furthermore, other genes, whose role in defense is not clear, have also
been characterized as immediate early genes activated by SA (Horvath and Chua, 1996 ; Yang and Klessig, 1996 ; Horvath et al., 1998 ). It is
interesting that some of the immediate early genes activated by SA can
also be activated by other pathogenesis-related signals, such as
methyl jasmonate (MeJA),
H2O2, and also by auxins
(Horvath and Chua, 1996 ; Xiang et al., 1996 ). Therefore, it seems that these early events represent a point of convergency of different signal
transduction pathways.
Our interest has been focused in the elucidation of the mechanism by
which SA activates transcription of immediate early genes. For this
purpose we use a defined promoter cis-element which is responsive to SA, auxins, and MeJA (Qin et al., 1994 ; Zhang and Singh,
1994 ; Xiang et al., 1996 ). This cis-element belongs to the
family of as-1-related sequences (Lam et al., 1989 ),
characterized by two TGACG motifs for the binding of bZIP transcription
factors of the TGA/OCS-binding factor (OBF) family (Foster et al.,
1994 ). This element was first characterized in the 35S promoter from the cauliflower mosaic virus (CaMV) and in the promoter of opine synthase genes from the T-DNA of Agrobacterium tumefaciens
(Bouchez et al., 1989 ; Lam et al., 1989 ). It is interesting that
as-1-like sequences have been found in the promoter of
GST genes where they control the transcriptional activation
of these genes by SA, auxins, and MeJA (Ulmasov et al., 1994 ; Droog et
al., 1995 ; Xiang et al., 1996 , Chen and Singh, 1999 ).
Previous studies have given some information concerning the mechanism
by which SA and other signals activate as-1-like elements. In vivo assays using transgenic plants indicate that gene transcription controlled by as-1-like elements does not require de novo
protein synthesis (Liu and Lam, 1994 ; Qin et al., 1994 ), suggesting
that post-translational modifications of premade proteins are involved. In vitro DNA-protein binding assays using either total (Jupin and Chua,
1996 ) or nuclear protein extracts (Stange et al., 1997 ) indicate that
SA produces an increase in the binding of tobacco (Nicotiana
tabacum cv Xanthi nc) transcription factors to the as-1
sequence. This effect of SA was reversed by treatment of the extracts
with alkaline phosphatase, suggesting the involvement of a protein
phosphorylation event (Jupin and Chua, 1996 ; Stange et al., 1997 ). In
support of this idea, we have previously shown that in vitro
phosphorylation of nuclear proteins by an endogenous protein kinase
(PK) activity increases the as-1 binding activity, mimicking
the effect of SA on entire plants (Stange et al., 1997 ). This effect of
phosphorylation was inhibited by quercetin, but not by H-7
(1-[5-isoquinolinylsulfonyl]-2-methylpiperazine) or genistein
(Stange et al., 1997 ; Ramírez and Holuigue, unpublished data).
It is known that these compounds inhibit different PK activities. Whereas quercetin inhibits PK CK2 and Tyr PK (Meggio et al., 1986 ), H-7
inhibits CAMP-dependent PK (PKA), CGMP-dependent PK (PKG), and PKC
(Hidaka et al., 1984 ) and genistein inhibits Tyr PK (Akiyama et al.,
1987 ). Therefore, the observation that only quercetin was able to
inhibit the activating effect of protein phosphorylation on DNA binding
supports the idea that a nuclear CK2 kinase may participate in the
SA-induced phosphorylation of proteins that probably underlies the
enhanced binding activity of as-1 to nuclear factors.
Furthermore, recent reports indicate that auxin potentiates the
trans-activation capacity of a tobacco TGA factor (Pascuzzi et al.,
1998 ). Therefore, transcription of genes controlled by the
as-1 element could be activated by increasing either the DNA binding activity or the trans-activation capacity of the nuclear factor.
In this study we give experimental evidence for the participation of a
nuclear CK2 in the SA-mediated pathway leading to the activation of
gene transcription controlled by the as-1-like element in
tobacco. Treatment of tobacco plants with SA increases the nuclear CK2 activity.
5,6-Dichloro-1-( -D-ribofuranosyl)
benzimidazole (DRB), a cell-permeable CK2 inhibitor, consistently
prevents the activating effect of SA on both the binding of nuclear
factors to the as-1 sequence, and the transcription of genes
controlled by the as-1 sequence (as-1/GUS and
gnt35 genes). Furthermore, our results show that DRB also
inhibits the effect of 2,4-dichlorophenoxyacetic acid (2,4-D) and MeJA
on the transcription of the as-1/GUS gene. Taken together,
these observation support a more general role for CK2 in the
as-1 mediated activation of immediate early genes. Possible
target proteins and mechanisms of CK2 regulation by SA are discussed.
 |
RESULTS |
SA Increases Nuclear CK2 Activity in Tobacco Plants
To study the participation of a nuclear kinase CK2 in the
SA-mediated pathway, we first evaluated the effect of SA on the endogenous nuclear CK2 activity. For this purpose, we assayed the CK2
activity in nuclear extracts prepared from tobacco leaves treated with
1 mM SA or water for 1 h. The peptide RRRDDDSDDD, which contains the consensus phosphorylation sequence for CK2 (Kuenzel
and Krebs, 1985 ; Pinna, 1990 ), was used as the phosphate acceptor
substrate. Either [ -32P]ATP or
[ -32P]GTP was used as phosphate donors since
CK2 is the only PK able to use either nucleotide as phosphate donor
(Pinna, 1990 ). Results shown in Figure 1A
indicate that a significant increase in CK2 activity, measured with GTP
(2-fold, P < 0.005) and ATP (3.3-fold, P < 0.05), was detected after SA treatment. This
effect of SA on the CK2 activity was detected using a relative broad
range of protein extract concentrations (2.5-10 µg of protein).
Within this range CK2 activity increased linearly with protein
concentration (data not shown).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 1.
SA increases nuclear CK2 activity in tobacco
leaves. A, CK2 activity was assayed in nuclear extracts obtained from
leaves of tobacco plants treated with water (C, white bars) or with 1 mM SA (SA, gray bars) for 1 h. The peptide RRRDDDSDDD
(1 mM) was used as phosphate acceptor and
[ -32P]GTP or
[ -32P]ATP (200 µM) was used as
phosphate donor, as indicated in the figure. Values are expressed as
the activation rate between control and SA-treated samples and
represent mean ± SD of three independent extract
preparations. Differences in CK2 activity between SA-treated and
control samples were significant (GTP, t test,
P < 0.005; ATP, t test, P < 0.05). B, Effect of DRB (60 µM) and heparin
(hep, 20 µg mL 1) on the CK2 activity in
nuclear extracts obtained from leaves of tobacco plants treated with
water (C, white bars) or with 1 mM SA (SA, gray
bars) for 1 h. Control treatments for DRB effect included 0.5%
(v/v) DMSO. CK2 specific activity is expressed as picomoles of
32P incorporated in the substrate peptide
min 1 mg 1 protein.
Values are mean ± SD of three
determinations from the same extract.
|
|
To give further support to the idea that the PK activity detected
corresponds to a CK2, the effect of the specific inhibitors heparin and
DRB was assayed. Heparin is known for its specificity and efficiency as
inhibitor of the CK2 enzyme (Hathaway et al., 1980 ). DRB and other
halogenated benzymidazole derivatives specifically inhibit CK2 enzyme,
less efficiently CK1 enzyme, but not other types of PKs (Meggio et al.,
1990 ; Szyszka et al., 1995 ). Results shown in Figure 1B indicate that
heparin (20 µg mL 1) strongly inhibited the
kinase activity detected in extracts from water- and SA-treated plants
(by 88% and 94%, respectively). Due to the specificity of this
inhibitor (Hathaway et al., 1980 ), this heparin-sensitive kinase
activity can confidently be attributed to a CK2. Unlike heparin, DRB
(60 µM) afforded only a partial inhibition of the kinase
activity detected in extracts from water- and SA-treated plants (50%
and 56%, respectively; Fig. 1B). The inability of DRB to fully inhibit
the CK2 activity in tobacco nuclear extracts is not surprising because
only a partial inhibition of purified CK2 enzyme from different species
has been reported using DRB (60-100 µM; Meggio et al.,
1990 ; Szyszka et al., 1995 ).
We also evaluated the effect of SA on the kinetic constants of the
nuclear CK2 activity. For this purpose, the CK2 activity present in
nuclear extracts from water- and SA-treated plants was measured using a
broader range of peptide substrate concentrations (0.05-2
mM). As shown in Table I, SA
increased the Vmax value (from 205 ± 14 to 571 ± 54 pmol 32P incorporated
min 1 mg 1 protein)
without affecting the apparent Km value
(51 ± 0.02 and 48 ± 0.02 µM for SA
and water treatments, respectively). This result suggests that SA
increased the enzymatic activity without affecting the substrate
affinity.
View this table:
[in this window]
[in a new window]
|
Table I.
Kinetic constants for CK2 activity from nuclear
extracts of water- and SA-treated plants
Initial rates of CK2 with the peptide RRRDDDSDDD (0.05-2
mM) as the variable substrate were determined as described
in "Materials and Methods." To calculate the kinetic constants,
data were fit to the Michaelis-Menten equation by a nonlinear
regression using SigmaPlot for Windows Version 4.0 (SPSS Inc).
SE is given. Differences in Km
values were not significant (Student's t test,
P < 0.95).
|
|
SA-Induced Binding of Nuclear Factors to the
as-1 Element Is Inhibited by DRB
To assess the participation of a CK2 in the SA-activated pathway
for transcription of genes controlled by the as-1 element, we evaluated the in vivo effect of CK2 inhibition on the SA-induced increase of the binding of nuclear factors to the as-1
element. DRB was used to inhibit CK2 in in vivo experiments because
this, unlike heparin, is a cell-permeable compound (Kim and Kahn, 1997 ; Delalande et al., 1999 ). In these in vivo experiments we used a higher
concentration of DRB (500 µM) as has been
reported to be effective in other in vivo systems (Kim and Kahn, 1997 ;
Delalande et al., 1999 ). Leaves from tobacco plants were pre-incubated
for 30 min in the presence or absence of 500 µM
DRB; then SA was added to a final concentration of 1 mM and the incubation was continued for another
30 min. A control sample was incubated in water for 1 h. Addition
of 0.5% (v/v) dimethyl sulfoxide (DMSO) did not have any effect on the
control as-1 binding activity (data not shown). Nuclear
extracts were prepared from these samples as described in "Materials
and Methods." The as-1 binding activity in these extracts
was detected by gel mobility shift assay using a 36-bp DNA fragment
containing one copy of the as-1 sequence as a probe. In
agreement with our previous results (Stange et al., 1997 ), treatment of
tobacco leaves with SA produced a 3.1-fold increase in the
as-1 binding activity (Fig. 2,
lanes 2 and 3). Similar levels of increase in the as-1
binding activity have been detected after 60 or 90 min of treatment
with SA (Stange et al., 1997 ; data not shown). In the presence of DRB,
SA elicited a considerably smaller increase in the as-1
binding activity (1.9-fold the control activity; Fig. 2, lanes 3 and
4). This result is consistent with the participation of a CK2 in the
activation by SA on the as-1 binding activity.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 2.
Binding of nuclear factors to the as-1
sequence induced by SA is inhibited by DRB. Gel mobility shift assays
were carried out with nuclear extracts from leaves of tobacco plants
subjected to the following treatments: water for 1 h (C, lane 2);
pre-incubation for 30 min with 0.5% (v/v) DMSO, then addition of 1 mM SA (SA, lane 3); and pre-incubation for 30 min
with 500 µM DRB, then addition of 1 mM SA (SA/DRB, lane 4). A
32P-labeled DNA fragment containing one copy of
the as-1 sequence was used as probe. Lane 1 shows a control
reaction without nuclear extract. The arrowhead indicates DNA-protein
complexes. The relative binding activities, estimated by densitometric
analysis of the autoradiography, are indicated below the figure.
|
|
SA-Activated Transcription of Genes Controlled by
as-1 Element Is Inhibited by DRB
To further assess the possible participation of a CK2 activity in
the SA-activated pathway, we evaluated the effect of DRB on the
SA-mediated activation of the gene transcription controlled by the
as-1 sequence. For this purpose, the activity of the
-glucuronidase (GUS) reporter protein was assayed in transgenic
tobacco plants containing the
(as-1)4/GUS chimeric gene after SA
treatment in the presence or absence of DRB. Leaf discs from transgenic
tobacco plants were pre-incubated for 30 min with 500 µM DRB or 0.5% (v/v) DMSO. Then SA (1 mM) was added and incubation was continued for 5 h. Control samples were incubated in water during 5.5 h in
the presence of 500 µM DRB or 0.5% (v/v) DMSO.
Total protein extracts were prepared from these samples, and GUS
enzymatic activity was measured by a fluorometric assay. Treatment
of tobacco leaves with SA significantly increases GUS activity
(3.3-fold; P < 0.001; Fig.
3A). When treatment with SA was carried
out in the presence of DRB, GUS activity was significantly reduced to
43% of the activity detected in the absence of DRB (P < 0.001; Fig. 3A). Similar results were obtained using an independent
(as-1)4/GUS transgenic tobacco clone (data not shown).

View larger version (33K):
[in this window]
[in a new window]
|
Figure 3.
Expression of
(as-1)4/GUS and gnt35
genes induced by SA is inhibited by DRB. Leaf discs obtained from
tobacco plants transformed with the
(as-1)4/GUS gene were treated
for 30 min with 500 µM DRB (or 0.5% [v/v]
DMSO in control samples) and then for 5 h in the presence or
absence of 1 mM SA. A, GUS activity measured in
protein extracts obtained from samples treated with SA (SA, gray bars)
or water (C, white bars). Values are expressed as the activation rate
between control and SA-treated samples and represent mean ± SD of four independent experiments (each done in
triplicate). Different letters indicate significantly different values
(P < 0.05; ANOVA followed by Tukey HSD's test). B,
Levels of gnt35 mRNA and actin mRNA (constitutive control)
detected by northern hybridization, using total RNA (20 µg per lane)
isolated from leaves subjected to the indicated treatments. Specific
32P-labeled gnt35 and actin gene
fragments were used as probes. Transcript levels were estimated by
densitometric analysis of the autoradiography. Asterisk, Signal from
unknown nature detected with the gnt35 probe.
|
|
We also evaluated the effect of DRB on the SA-mediated activation of
the transcription of the endogenous gnt35 gene.
gnt35 is one of the tobacco GST genes for which
SA-, auxin-, and MeJA-induced transcription controlled by an
as-1 element has been reported (Droog et al., 1995 ; Xiang et
al., 1996 ). Tobacco leaf samples were pretreated for 30 min with 500 µM DRB (or 0.5% [v/v] DMSO in the control
sample) and then for 5 h in the presence or absence of 1 mM SA. Total RNA was isolated from these samples
and the level of gnt35 and actin mRNA (constitutive control)
were detected by northern-blot analysis. Treatment with SA increased
the level of gnt35 mRNA (4.6-fold the basal level normalized
by actin signal; Fig. 3B, lanes 1 and 2). DRB markedly inhibited the
effect of SA on the level of gnt35 mRNA (2.6-fold the basal
level normalized by actin signal; Fig. 3B, lanes 3 and 4). Therefore,
the inhibitory effect of DRB was specific for transcription of the
SA-activated (as-1)4/GUS and
gnt35 genes and did not affect transcription of the
constitutive actin gene. This effect of DRB can be attributed to the
inhibition of an endogenous CK2 activity.
Transcription of the (as-1)4/GUS Gene
Activated by Auxin and MeJA Is Inhibited by DRB
Because the as-1 element is also responsive to auxins
and MeJA, we evaluated whether DRB also inhibited the transcription of
the (as-1)4/GUS gene activated by
the synthetic auxin 2,4-D and by MeJA. For this purpose, leaf discs
from transgenic tobacco plants were treated with 2,4-D (100 µM) or MeJA (50 µM), in
the presence or absence of DRB (500 µM). After
5 h of treatment, GUS activity was measured in leaf samples.
Treatment of tobacco leaves with 2,4-D (Fig.
4A) produced a significant increase in
GUS activity (4.8-fold, P < 0.001). Treatment of
tobacco leaves with MeJA (Fig. 4B) also produced a significant increase
in GUS activity (2.1-fold, P < 0.005). In the presence
of DRB, the GUS activity was significantly reduced to 50%
(P < 0.01) and 49% (P < 0.005) of
the activity detected with 2,4-D or MeJA alone. Similar results were
obtained using an independent
(as-1)4/GUS transgenic tobacco
clone (data not shown). These results suggest that a CK2 activity may
also be involved in the MeJA- and auxin-mediated transcriptional
activation of genes controlled by as-1-like elements in
tobacco.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 4.
Expression of the
(as-1)4/GUS gene induced by 2,4-D
and MeJA is inhibited by DRB. Leaf discs obtained from tobacco plants
transformed with the
(as-1)4/GUS gene were
pretreated for 30 min with 500 µM DRB or 0.5%
(v/v) DMSO and then subjected to the following treatments: A, 100 µM 2,4-D or 0.5% (v/v) DMSO as a control (C);
B, 50 µM MeJA or 0.5% (v/v) DMSO-1% (v/v)
ethanol as a control (C). After 5 h of treatment, GUS activity was
measured in protein extracts obtained from these samples. Values are
expressed as the activation rate between control and treated samples
and represent mean ± SD of four independent
experiments (each done in triplicate). Different letters indicate
significantly different values (P < 0.05; ANOVA
followed by Tukey HSD's test).
|
|
The partial inhibition exerted by DRB in the in vivo assays for
transcriptional (Figs. 3 and 4) and DNA binding activities (Fig. 2) can
be explained by our in vitro experiments (Fig. 1B) showing that DRB
also exerts a partial inhibitory effect on CK2 activity.
 |
DISCUSSION |
Mechanism of Gene Activation by SA: Possible Role of
CK2
In this study we give evidence for the involvement of a PK CK2 in
the mechanism by which SA activates the transcription of certain
immediate early genes. Thus, we showed that DRB, a cell-permeable CK2
inhibitor, impairs the activating effect of SA on the binding of
nuclear factors to the as-1 element and on the transcription of genes controlled by this cis-element (the
(as-1)4/GUS reporter gene and the
endogenous gnt35 gene). We also showed that DRB impairs transcription of the (as-1)4/GUS
reporter gene activated by 2,4-D and MeJA. These results from in vivo
experiments support previous evidence obtained from in vitro
experiments where the involvement of protein phosphorylation events in
the activation of genes controlled by the as-1 cis-element
was suggested (Jupin and Chua, 1996 ; Stange et al., 1997 ). It is
interesting that in this study we also showed that SA produces a
significant increase in the nuclear CK2 activity, which gives a
stronger support for the participation of this type of PK in the
SA-mediated signal transduction pathway.
It is interesting that unlike the activation of late defense genes
(e.g. pathogenesis-related (PR) genes), activation of early defense genes (e.g. GST genes) represents a point of
convergency of several signal transduction pathways activated by
different hormones, such as SA, MeJA, and auxins. Consistently,
functional as-1-like promoter elements, which are responsive
to these hormonal signals (SA, MeJA, and auxins) have been found in
GST genes (Ulmasov et al., 1994 ; Droog et al., 1995 ; Chen
and Singh, 1999 ). Considering that GST proteins play a protective role
against the oxidative and chemical stress (Marrs, 1996 ), activation of
their genes may represent a common response triggered by different
signals to elicit protective responses against stress. Unlike
GST genes, PR genes seem to be activated as a
more specific response of protection against pathogen-induced stress.
Two main questions remain open concerning to the participation of a CK2
in the mechanism of gene activation by SA. The first one concerns the
identification of the target(s) protein(s) for CK2 activity in the
SA-activated pathway and, the second one, the mechanism by which SA
produces an increase in the nuclear CK2 activity.
Among the possible candidates for target proteins of CK2 activity are
the TGA/OBF transcription factors known to bind to the as-1-like elements. Four members of this gene family (TGA1a,
PG13, TGA2.1, and TGA2.2) have been isolated from tobacco (Katagiri et
al., 1989 ; Fromm et al., 1991 ; Niggeweg et al., 2000b ). A recent report
indicates that TGA2.2 is the main component of the complex that binds
to as-1 sequence in tobacco cellular or nuclear extracts, suggesting an important role for this protein in the response to SA
(Niggeweg et al., 2000a ). Nevertheless, it is not known whether the
responsiveness to SA may be due to phosphorylation of this factor.
Biochemical evidence, obtained from in vitro assays of the
as-1 binding activity of TGA/OBF factors present in total or
nuclear tobacco extracts, indicate that phosphorylation of nuclear
proteins is required for the activating effects of SA on the
as-1 binding activity (Jupin and Chua, 1996 ; Stange et al.,
1997 ; this study). Furthermore, the observation that dissociating agents increase per se the as-1 binding activity of total
extracts, suggests that phosphorylation may play a role in activating
the dissociation of the factor from other proteins leading to the release of the active factor (Jupin and Chua, 1996 ). The NPR1 protein,
which interacts with members of the TGA/OBF family increasing its DNA
binding activity (Zhang et al., 1999 ; Després et al., 2000 ;
Niggeweg et al., 2000b ) could be also considered as a putative CK2
substrate. NPR1 has been characterized as an important component of the pathway leading to activate PR genes by SA (Cao et
al., 1997 ). Nevertheless, NPR1 seems not to be required to activate GST genes by SA or 2,4-D (Uquillas and Holuigue, unpublished
data), suggesting that this protein does not play a role in the pathway leading to activate early defense genes by SA. Therefore, whether one
of the TGA factors itself or another protein that interacts with it is
the CK2 substrate remains to be determined.
Function and Regulation of CK2 Activity
CK2 is a ubiquitous ser/thr PK present in the nucleus and the
cytoplasm of eukaryotic cells with an heterotetrameric structure composed by two catalitic ( or ') and two regulatory ( )
subunits (Pinna, 1990 ; Allende and Allende, 1995 ). At present,
more than 160 proteins have been recognized as endogenous substrates
for CK2, including enzymes that control DNA and RNA synthesis,
transcription and translation factors, and other proteins crucial for
cell growth, proliferation, and differentiation (Allende and Allende,
1995 ). One of the roles generally attributed to CK2 is as a key
regulator of the cell cycle (Allende and Allende, 1995 ).
Consistently, increased expression and activity of CK2 has been
detected in actively proliferating animal and plant cells (Bosc et al.,
1999 ; Espunya et al., 1999 ).
Although CK2 was one of the first PKs to be described, it is not clear
yet whether its activity in non-dividing cells is constitutive or is
subjected to regulation in vivo (Allende and Allende, 1995 ; Dobrowolska et al., 1999 ). A transient activation of CK2 (1.3- to
6-fold) was reported to occur in animal cells upon stimulation with
polypeptidic hormones like insulin (Sommercorn et al., 1987 ; Klarlund
and Czech, 1988 ; Kim and Kahn, 1997 ), insulin-like growth factor
(Klarlund and Czech, 1988 ), and epidermal growth factor (Sommercorn et
al., 1987 ; Ackerman et al., 1990 ). These results, however, have been
challenged on grounds of lack of reproducibility (Litchfield et al.,
1991 ). In this context, our results are of interest as they represent
the first evidence for the activation of a potential plant CK2 enzyme
by a stress-induced hormone. Further work is certainly needed to
elucidate the mechanism by which SA increases the nuclear CK2 activity.
CK2 in Transcriptional Control of Gene Expression
Several authors have reported the participation of CK2 in
transcriptional activation of genes, through the phosphorylation of
transcription factors (for review, see Allende and Allende, 1995 ). In some cases (involving c-Jun, serum response factor, Sp1, and Myb) a clear effect of the CK2-mediated phosphorylation on the DNA binding activity of the factor has been established (Lüscher et al., 1990 ; Manak et al., 1990 ; Lin et al., 1992 ; Armstrong et al., 1997 ).
In plants, the participation of CK2 in gene transcription regulation
has been described in three models. In one of these models, CK2
mediated phosphorylation was reported to increase the binding activity
of the light-regulated bZIP G-box-binding factor to G-box DNA elements
(Klimczak et al., 1995 ). This CK2 mediated phosphorylation was also
demonstrated to be relevant for the in vivo regulation of this factor
by light (Harter et al., 1994 ). More recently, further evidences for
the participation of CK2 in light-regulated gene expression were
reported using antisense expression of CK2 gene in Arabidopsis (Lee
et al., 1999 ). In a second model, phosphorylation by CK2 of the bZIP
transcription factor Opaque2 involved in maize seed development was
reported (Ciceri et al., 1997 ). This phosphorylation affects its
binding to DNA (Ciceri et al., 1997 ). In a third model, phosphorylation
by CK2 of two proteins related to the control of the circadian rhythms
(circadian clock-associated 1, CCA1, and late elongated hypocotyl, LHY,
proteins) was reported (Sugano et al., 1999 ). Further evidences for a
role of CK2 in regulation of the circadian rhythms were reported using
Arabidopsis plants overexpressing a CK2 gene (Sugano et al.,
1999 ).
Results reported in this study reinforce a role for CK2 in control of
gene expression in plants, in this case in association with defense
responses against stress conditions.
 |
MATERIALS AND METHODS |
Gene Construct
For construct
(as-1)4/GUS, the following DNA
fragment containing four copies of the as-1 sequence
(DNA binding motifs in bold) was generated by annealing and ligation of
four complementary single-stranded oligonucleotides:
5'-agctt(CTGACGTAAGGGATGACGCAC)2tctaga(CTGACGTAAGGGATGACGCAC)2c-3' and
3'-a(GACTGCATTC CCTACTGCGTG)2
agatct(GACTGCATTCCCTACTGCGTG)2 gagct-5'.
This fragment was cloned upstream of the truncated 46 to +8 35S CaMV
minimal promoter of the X-GUS-46 plasmid (Benfey et al., 1990 ),
using the HindIII and XhoI cohesive ends designed in the 5'- and 3'-ends of the synthetic DNA fragment (underlined). Correct insertion of this sequence was corroborated by DNA sequencing. The HindIII (5')-EcoRI (3') fragment containing
the tetramer of the as-1 sequence fused to the 46
truncated 35S promoter, to the GUS reporter gene, and to the
3'-polyadenylation sequence from pea rbcS3C gene, was
inserted into the pBI121 binary vector (CLONTECH Laboratories, Palo
Alto, CA), in replacement of the CaMV
35S/GUS/3'NOS cassette. This pBI-derived plasmid
containing the chimeric
(as-1)4/GUS reporter gene
(pBI-as-1-GUS plasmid), was introduced into
Agrobacterium tumefaciens strain LBA4404 by electroporation
(Singh et al., 1993 ).
Plant Transformation
Tobacco (Nicotiana tabacum cv Xanthi nc) plants
used for transformation were propagated in vitro in Murashige and Skoog
(MS) medium under controlled conditions (20°C-22°C, 16-h light).
Transformation was carried out by infection of leaf sections with
A. tumefaciens strain harboring the binary vector
pBI-as-1-GUS. After infection, transgenic shoots were
selected for resistance to kanamycin. Selected shoots were rooted in MS
medium supplemented with 50 µg mL 1 kanamycin.
Independent transgenic clones were cultivated in vitro and then
transferred to soil and grown in the greenhouse (15°C-25°C, 16-h light).
Chemical Treatments of Plant Tissues
All the experiments were performed with tobacco plants grown in
the greenhouse (15°C-25°C, 16-h light) and containing eight to 12 expanded leaves. To assay as-1-binding activity or CK2
activity, wild-type tobacco (N. tabacum cv Xanthi nc)
plants were used. To assay transcriptional activity of the
(as-1)4/GUS reporter
gene or the endogenous gnt35 gene, transgenic
tobacco plants harboring the
(as-1)4/GUS gene were
used. For treatments, tobacco leaf discs of 1.2 cm in diameter were
punched out and placed in a solution containing 1 mM
SA, 100 µM 2,4-D, or 50 µM MeJA.
Stock solutions of 2,4-D and MeJA were prepared in DMSO and ethanol,
respectively. Final concentrations of DMSO and ethanol in the medium
were 0.5% and 1% (v/v), respectively. Control samples were incubated
in water (SA) with 0.5% (v/v) DMSO (2,4-D) or 1% (v/v) ethanol
(MeJA). Samples were vacuum-infiltrated for 2 min and incubated under
constant light in a growth chamber (22°C-25°C) with shaking (50 rpm). After incubation for the periods of time indicated in each case,
leaf discs were immediately frozen in liquid nitrogen and stored at
70°C. To assay the in vivo effect of the CK2 inhibitor DRB, leaf
discs were first pre-incubated in a solution containing the inhibitor
(500 µM DRB) or water in the presence of 0.5% (v/v)
DMSO. A stock solution of DRB was prepared in DMSO (final DMSO
concentration 0.5% [v/v]). Samples were vacuum-infiltrated and
incubated as described above. After 30 min of pre-incubation, SA,
2,4-D, or MeJA was added, samples were vacuum-infiltrated, and
incubation was continued for the period of time indicated. After
treatments, leaf samples were frozen and stored under the conditions
described above.
GUS Activity Assay
To prepare protein extracts, frozen leaf discs were ground in
liquid nitrogen; extracted with a buffer containing 50 mM
sodium phosphate, pH 7.0, 1 mM EDTA, 0.1% (v/v) Triton
X-100, and 10 mM 2-mercaptoethanol; and centrifuged for 10 min at 4°C in a microfuge. GUS activity was assayed by the
fluorescent method as described by Jefferson (1987) .
4-Methylumbelliferyl glucoside was used as substrate and the
fluorescence of the 4-methylumbelliferone (MU) released was
measured by emission at 455 nm, after excitation at 365 nm (Fluorometer
Hoefer TKO 100, Hoefer Scientific Instruments, San Francisco). GUS
activity was expressed as pmol MU min 1 mg 1
protein. A series of MU standard solutions prepared in 0.2 M Na2CO3 were used for calibration.
Protein concentration was determined using the protein assay (Bio-Rad
Laboratories, Hercules, CA).
RNA Extraction and Northern Analysis
Total RNA was extracted from frozen leaf samples as described
(Logemann et al., 1987 ). RNA (20 µg) was resolved on
formaldehyde-agarose gels and blotted onto nylon membranes (Hybond N,
Amersham, Buckinghamshire, UK). Membranes were hybridized in a buffer
containing 6× SSC, 5× Denhardt's solution, 50% (v/v) formamide,
0.5% (w/v) SDS, 1 mM EDTA, 150 µg mL 1
salmon sperm carrier DNA, and 32P-labeled probe (3-5 × 107 cpm). Then filters were washed twice in 2× SSC,
0.5% (w/v) SDS for 10 min at 55°C. DNA probes of 410 and 130 bp from
tobacco gnt35 and actin genes, respectively, were
synthesized by PCR using synthetic primers designed from known sequence
data (GenBank accesion nos. X56269 for pGNT35 and X63603 for NTACTI).
These probes were labeled with [ -32P]dCTP by random
oligonucleotide-primed synthesis (Megaprime DNA labeling system, Amersham).
Nuclear Extracts
Nuclear extracts were prepared from leaves of treated plants
according to the procedure described by Green et al. (1989) and modified as follows. Frozen tobacco leaf samples (approximately 4 g of fresh weight) were ground in a mortar with liquid nitrogen and
resuspended in 25 mL of homogenization buffer (1 M hexylene glycol, 10 mM PIPES [1,4-piperazinediethanesulfonic
acid]/KOH, pH 7.0, 10 mM MgCl2, 10 mM NaF, 10 mM KCl, 1 mM EDTA, 0.5%
[v/v] Triton X-100, 1 mM 2-mercaptoethanol, 0.8 mM phenylmethylsulfonyl fluoride). The homogenate was
filtered through two layers of Miracloth and nuclei were sedimented at
3,000g for 2 min. The pellet was resuspended in 10 mL of
nuclei wash buffer (0.5 M hexylene glycol, 10 mM PIPES/KOH, pH 7.0, 10 mM MgCl2,
10 mM NaF, 10 mM KCl, 1 mM EDTA, 1 mM 2-mercaptoethanol, 0.8 mM
phenylmethylsulfonyl fluoride) with 0.5% (v/v) Triton X-100, and
nuclei were sedimented at 3,000g for 1.45 min. The
nuclear pellet was resuspended in 10 mL of nuclei wash buffer,
sedimented at 3,000g for 1.45 min, and resuspended in 5 mL of lysis buffer (15 mM HEPES/KOH, pH 7.5, 110 mM KCl, 5 mM MgCl2, 10 mM NaF, 100 µM EDTA, and 2 µg
mL 1 of leupeptin, pepstatin A, and aprotinin). After
1 h on ice, ammonium sulfate was added and fractionation was
performed as described (Green et al., 1989 ). After the second
fractionation, the pellet was resuspended in 100 µL of nuclear
extract buffer (25 mM HEPES/KOH, pH 7.5, 40 mM
KCl, 100 µM EDTA, 15% [v/v] glycerol, 10 mM NaF, and 2 µg mL 1 of leupeptin,
pepstatin A, and aprotinin), dialyzed for 3.5 h against the same
buffer and stored at 70°C. Protein concentration was determined
using the Bio-Rad Laboratories kit.
Gel Mobility Shift Assays
To obtain the as-1 element DNA probe for protein
binding assays, the oligonucleotide
5'-CTGCAGACTGACGTAAGGGATGACGCACAACTCGAG-3' was used (protein binding motifs are indicated in bold). The
complementary strand was synthesized and labeled using the primer
5'-CTCGAGT-3', [ -32P]dCTP, dNTPs, and Klenow
DNA polymerase, following standard protocols (Sambrook et al., 1989 ).
DNA-protein binding assays were performed in 12 µL of a medium
containing 50 mM HEPES, pH 7.9, 100 mM KCl, 2 mM MgCl2, 20 mM
dithiothreitol, 3.75% (v/v) glycerol, 10 mM NaF, 8 mM Na2MoO4, and
15 ng poly(dG)·poly(dC) (Pharmacia Biotech, Piscataway, NJ),
radioactively labeled probe (25,000 cpm, 0.12 pmol), and nuclear
protein extract (5 µg of protein). After 20-min incubation at room
temperature, DNA-protein complexes were separated from the unbound
probe by electrophoresis in a 6.072% T (1.186% C) polyacrylamide gel
in Tris-borate/EDTA. After electrophoresis, gels were
dried and subjected to autoradiography at 70°C with enhancer
screens for 16 h.
CK2 Activity Assay
CK2 activity was assayed in nuclear extracts obtained from
tobacco leaves subjected to the indicated treatments. CK2 assays were
performed in 30 µL of medium containing 50 mM HEPES/KOH, pH 7.9, 8 mM MgCl2, 10 mM KCl, 10 mM NaF, 1 mM peptide RRRDDDSDDD, 200 µM [ -32P]ATP or
[ -32P]GTP (400-500 cpm pmol 1), and
nuclear extract (5 µg of protein). To assay the effect of heparin or
DRB, these compounds were added directly to the reaction medium. After
incubation for 15 min at 30°C, reaction mixtures were spotted onto
Whatman P81 ion-exchange papers. Papers were washed three times with 75 mM phosphoric acid, dried, and radioactivity was
quantitated with a liquid scintillation counter. To determine the
specific 32P-incorporation into the substrate peptide, the
incorporation of label into endogenous nuclear proteins obtained in the
absence of the peptide was subtracted from the total
32P-incorporation. CK2 specific activity was expressed as
pmol 32P incorporated into the peptide min 1
mg 1 protein. Activity was linear with the amount of
extract assayed in the range of 2.5 to 10 µg of protein in 30 µL of
reaction medium.
Statistical Analysis of Data
Differences in the CK2 activity between control and SA-treated
samples (Fig. 1) were evaluated by the Student's t
test. Differences in the GUS activity among treatments (Figs. 3A and 4)
were tested by one-way ANOVA and Post Hoc Tukey HSD's
Multiple-Comparison Test, using the statistical program SPSS 7.5 (SPSS,
Inc., Chicago).
 |
ACKNOWLEDGMENT |
The authors are greatly indebted to Dr. Marcela Bitran for
improving the manuscript.
 |
FOOTNOTES |
Received April 7, 2000; modified June 9, 2000; accepted August 21, 2000.
1
This work was supported by the Fondecyt-Conicyt,
Chile (grant nos. 8980005, 2980027, and 2980065).
*
Corresponding author; e-mail lholuig{at}genes.bio.puc.cl; fax
56-2-222-5515.
 |
LITERATURE CITED |
-
Ackerman P, Glover CVC, Osheroff N
(1990)
Stimulation of casein kinase II by epidermal growth factor: relationship sue-specific expression from CaMV 35S enhancer subdomains in early stages of plant development.
EMBO J
9: 1677-1684
[ISI][Medline]
-
Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe S, Itoh N, Shibuya M, Fukami Y
(1987)
Genistein, a specific inhibitor of tyrosine-specific protein kinases.
J Biol Chem
262: 5592-5595
[Abstract/Free Full Text]
-
Allende JE, Allende CC
(1995)
Protein kinase CK2: an enzyme with mutiple substrates and puzzling regulation.
FASEB J
9: 313-323
[Abstract/Free Full Text]. 31
-
Armstrong SA, Barry DA, Legett RW, Mueller CR
(1997)
Casein kinase n-mediated phosphorylation of the C terminus of Sp1 decreases its DNA binding activity.
J Biol Chem
272: 13489-13495
[Abstract/Free Full Text]
-
Benfey PN, Ren L, Chua NH
(1990)
Tissue-specific expression from CaMV 35S enhancer subdomains in early stages of plant development.
EMBO J
9: 1677-1684
-
Bosc DG, Lüscher B, Litchfield DW
(1999)
Expression and regulation of protein kinase CK2 during the cell cycle.
Mol Cell Biochem
191: 213-222
[CrossRef][ISI][Medline]
-
Bouchez D, Tokuhisa JG, Llewellyn DJ, Dennis ES, Ellis JG
(1989)
The ocs-element is a component of the promoters of several T-DNA and plant viral genes.
EMBO J
8: 4197-4204
[ISI][Medline]
-
Cao H, Glazebrook J, Clarke JD, Volko S, Dong X
(1997)
The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats.
Cell
88: 57-63
[CrossRef][ISI][Medline]
-
Chen W, Singh KB
(1999)
The auxin, hydrogen peroxide and salicylic acid induced expression of the Arabidopsis GST6 promoter is mediated in part by an ocs element.
Plant J
19: 667-677
[CrossRef][ISI][Medline]
-
Ciceri P, Gianazza E, Lazzari B, Lippoli G, Genga A, Hoschek G, Schmidt RJ, Viotti A
(1997)
Phosphorylation of opaque2 changes diurnally and impacts its DNA binding activity.
Plant Cell
9: 97-108
[Abstract]
-
Delalande C, Belle R, Cormier P, Mulner-Lorillon O
(1999)
Transient increase of a protein kinase activity identified to CK2 during sea urchin development.
Biochem Biophys Res Commun
266: 425-431
[CrossRef][Medline]
-
Després C, DeLong C, Glaze S, Liu E, Fobert PR
(2000)
The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors.
Plant Cell
12: 279-290
[Abstract/Free Full Text]
-
Dobrowolska G, Lozeman FJ, Li D, Krebs EG
(1999)
CK2, a protein kinase of the next millennium.
Mol Cell Biochem
191: 3-12
[CrossRef][ISI][Medline]
-
Dong X
(1998)
SA, JA, ethylene, and disease resistance in plants.
Curr Opin Plant Biol
1: 316-323
[CrossRef][ISI][Medline]
-
Droog F, Spek A, van der Kooy A, de Ruyter A, Hoge H, Libbenga K, Hooykaas P, van der Zaal B
(1995)
Promoter analysis of the auxin-regulated tobacco glutathione S-transferase genes Nt103-1 and Nt103-35.
Plant Mol Biol
29: 413-429
[CrossRef][ISI][Medline]
-
Durner J, Shah J, Klessig DF
(1997)
Salicylic acid and disease resistance in plants.
Trends Plant Sci
2: 266-274
[CrossRef]
-
Espunya MC, Combettes B, Dot J, Chaubet-Gigot N, Martínez MC
(1999)
Cell-cycle modulation of CK2 activity in tobacco BY-2 cells.
Plant J
19: 655-666
[CrossRef][ISI][Medline]
-
Foster R, Izawa T, Chua N-H
(1994)
Plant bZIP proteins gather at ACGT elements.
FASEB J
8: 192-200
[Abstract]
-
Fromm H, Katagiri F, Chua N-H
(1991)
The tobacco transcription activator TGA1a binds to a sequence in the 5' upstream region of a gene encoding a TGA1a-related protein.
Mol Gen Genet
229: 181-188
[CrossRef][ISI][Medline]
-
Green PJ, Kay SA, Lam E, Chua NH
(1989)
In vitro footprinting.
In
SB Gelvin, RA Schilperoort, eds, Plant Molecular Biology Manual. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp B11:1-B11:22
-
Harter K, Kircher S, Frohnmeyer H, Krenz M, Nagy F, Schäfer E
(1994)
Light-regulated modification and nuclear translocation of cytosolic G-box binding factors in parsley.
Plant Cell
6: 545-559
[Abstract]
-
Hathaway GM, Lubben TH, Traugh JA
(1980)
Inhibition of casein kinase II by heparin.
J Biol Chem
255: 8038-8041
[Abstract/Free Full Text]
-
Hidaka H, Inagaki M, Kawamoto S, Sasaki Y
(1984)
Isoquinolinesulfonamides, novel and potent inhibitors of cyclic nucleotide dependent protein kinase and protein kinase C.
Biochemistry
23: 5036-5041
[CrossRef][Medline]
-
Horvath D, Chua N-H
(1996)
Identification of an immediate-early salicylic acid-inducible tobacco gene and characterization of induction by other compounds.
Plant Mol Biol
31: 1061-1072
[CrossRef][ISI][Medline]
-
Horvath DM, Huang DJ, Chua N-H
(1998)
Four classes of salicylate-induced tobacco genes.
Mol Plant-Microbe Interact
11: 895-905
[ISI][Medline]
-
Jefferson RA
(1987)
Assaying chimeric genes in plants: the GUS gene fusion system.
Plant Mol Biol Rep
5: 387-405
-
Jupin I, Chua N-H
(1996)
Activation of the CaMV as-1 cis-element by salicylic acid: differential DNA-binding of a factor related to TGA1a.
EMBO J
15: 5679-5689
[ISI][Medline]
-
Katagiri F, Lam E, Chua N-H
(1989)
Two tobacco DNA-binding proteins with homology to the nuclear factor CREB.
Nature
340: 727-729
[CrossRef][Medline]
-
Kim S-J, Kahn CR
(1997)
Insulin regulation of mitogen-activated protein kinase kinase (MEK), mitogen-activated protein kinase and casein kinase in the cell nucleus: a possible role in the regulation of gene expression.
Biochem J
323: 621-627
-
Klarlund JK, Czech MP
(1988)
Insulin-like growth factor I and insulin rapidly increase casein kinase II activity in BALB/c 3T3 fibroblasts.
J Biol Chem
263: 15872-15875
[Abstract/Free Full Text]
-
Klimczak LJ, Collinge MA, Farini D, Giuliano G, Walker JC, Cashmore AR
(1995)
Reconstitution of Arabidopsis casein kinase II from recombinant subunits and phosphorylation of transcription factor GBF1.
Plant Cell
7: 105-115
[Abstract]
-
Kuenzel EA, Krebs EG
(1985)
A synthetic peptide substrate specific for casein kinase II.
Proc Natl Acad Sci USA
82: 737-741
[Abstract/Free Full Text]
-
Lam E, Benfey PN, Gilmartin PM, Fang R-X, Chua N-H
(1989)
Site-specific mutations alter in vitro factor binding and change promoter expression pattern in transgenic plants.
Proc Natl Acad Sci USA
86: 7890-7894
[Abstract/Free Full Text]
-
Lee Y, Lloyd AM, Roux SJ
(1999)
Antisense expression of the CK2
-subunit gene in Arabidopsis: effects on light-regulated gene expression and plant growth.
Plant Physiol
119: 989-1000
[Abstract/Free Full Text] -
Lin A, Frost J, Deng T, Smeal T, Al-Alawi N, Kikkawa U, Hunter T, Brenner D, Karin M
(1992)
Casein kinase II is a negative regulator of c-Jun DNA binding and AP-1 activity.
Cell
70: 777-789
[CrossRef][ISI][Medline]
-
Litchfield DW, Lozeman FJ, Cicirelli MF, Harrylock M, Ericsson LH, Piening CJ, Krebs EG
(1991)
Phosphorylation of the
subunit of casein kinase II in human A431 cells.
J Biol Chem
266: 20380-20389
[Abstract/Free Full Text] -
Liu X, Lam E
(1994)
Two binding sites for the plant transcription factor ASF-1 can respond to auxin treatments in transgenic tobacco.
J Biol Chem
269: 668-675
[Abstract/Free Full Text]
-
Logemann J, Schell J, Willmitzer L
(1987)
Improved method for the isolation of RNA from plant tissues.
Anal Biochem
163: 16-20
[CrossRef][ISI][Medline]
-
Lüscher B, Christenson E, Litchfield DW, Krebs EG, Eisenman RN
(1990)
Myb DNA binding inhibited by phosphorylation at a site deleted during oncogenic activation.
Nature
344: 517-521
[CrossRef][Medline]
-
Manak JR, Bisschop N, Kris RM, Prywes R
(1990)
Casein kinase II enhances the DNA binding activity of serum response factor.
Genes Dev
4: 955-967
[Abstract/Free Full Text]
-
Marrs KA
(1996)
The functions and regulation of glutathione S-transferases in plants.
Annu Rev Plant Physiol Plant Mol Biol
47: 127-158
[CrossRef][ISI]
-
Meggio F, Grankowski N, Kudlicki W, Szyszka R, Gasior E, Pinna LA
(1986)
Structure and properties of casein kinase-2 from Saccharomyces cerevisiae: a comparison with the liver enzyme.
Eur J Biochem
159: 31-38
[Medline]
-
Meggio F, Shugar D, Pinna LA
(1990)
Ribofuranosyl-benzimidazole derivatives as inhibitors of casein kinase-2 and casein kinase-1.
Eur J Biochem
187: 89-94
[Medline]
-
Niggeweg R, Thurow C, Kegler C, Gatz C
(2000a)
Tobacco transcription factor TGA2.2 is the main component of ASF1/SARP and is involved in salicylic acid- and auxin-inducible expression of as-1-containing target promoters.
J Biol Chem
275: 19897-19905
[Abstract/Free Full Text]
-
Niggeweg R, Thurow C, Weigel R, Pfitzner U, Gatz C
(2000b)
Tobacco TGA factors differ with respect to interaction with NPR1, activation potential and DNA-binding properties.
Plant Mol Biol
42: 775-788
[CrossRef][ISI][Medline]
-
Pascuzzi P, Hamilton D, Bodily K, Arias J
(1998)
Auxin-induced stress potentiates trans-activation by a conserved plant basic/leucine-zipper factor.
J Biol Chem
273: 26631-26637
[Abstract/Free Full Text]
-
Pinna LA
(1990)
Casein kinase 2: an "eminence grise" in cellular regulation.
Biochim Biophys Acta
1054: 267-284
[Medline]
-
Qin X-F, Holuigue L, Horvath DM, Chua N-H
(1994)
Immediate early transcription activation by salicylic acid via the cauliflower mosaic virus as-1 element.
Plant Cell
6: 863-874
[Abstract]
-
Reymond P, Farmer EE
(1998)
Jasmonate and salicylate as global signals for defense gene expression.
Curr Opin Plant Biol
1: 404-411
[CrossRef][ISI][Medline]
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York
-
Scheel D
(1998)
Resistance response physiology and signal transduction.
Curr Opin Plant Biol
1: 305-310
[CrossRef][ISI][Medline]
-
Singh A, Kao TH, Lin JJ
(1993)
Transformation of Agrobacterium tumefaciens with T-DNA vectors using high-voltage electroporation.
FOCUS
15: 84-87
-
Sommercorn J, Mulligan JA, Lozeman FJ, Krebs EG
(1987)
Activation of casein kinase II in response to insulin and to epidermal growth factor.
Proc Natl Acad Sci USA
84: 8834-8838
[Abstract/Free Full Text]
-
Stange C, Ramírez I, Gómez I, Jordana X, Holuigue L
(1997)
Phosphorylation of nuclear proteins directs binding to salicylic acid-responsive elements.
Plant J
11: 1315-1324
[CrossRef][Medline]
-
Sugano S, Andronis C, Ong MS, Green RM, Tobin EM
(1999)
The protein kinase CK2 is involved in regulation of circadian rhythms in Arabidopsis.
Proc Natl Acad Sci USA
96: 12362-12366
[Abstract/Free Full Text]
-
Szyszka R, Grankowski N, Felczak K, Shugar D
(1995)
Halogenated benzimidazoles and benzotriazoles as selective inhibitors of protein kinases CK I and CK II from Saccharomyces cerevisiae and other sources.
Biochem Biophys Res Commun
208: 418-424
[CrossRef][Medline]
-
Uknes S, Dincher S, Friedrich L, Negrotto D, Williams S, Thompson-Taylor H, Potter S, Ward E, Ryals J
(1993)
Regulation of pathogenesis-related protein-1a gene expression in tobacco.
Plant Cell
5: 159-169
[Abstract]
-
Ulmasov Y, Hagen G, Guilfoyle T
(1994)
The ocs element in the soybean GH2/4 promoter is activated by both active and inactive auxin and salicylic acid analogues.
Plant Mol Biol
26: 1055-1064
[CrossRef][ISI][Medline]
-
Xiang C, Miao Z-H, Lam E
(1996)
Coordinated activation of as-1 type elements and a tobacco glutathione S-transferase gene by auxins, salicylic acid, methyl-jasmonate and hydrogen peroxide.
Plant Mol Biol
32: 415-426
[CrossRef][ISI][Medline]
-
Yang Y, Klessig DF
(1996)
Isolation and characterization of a tobacco mosaic virus-inducible myb oncogene homolog from tobacco.
Proc Natl Acad Sci USA
93: 14972-14977
[Abstract/Free Full Text]
-
Yang Y, Shah J, Klessig DF
(1997)
Signal perception and transduction in plant defense responses.
Genes Dev
11: 1621-1639
[Free Full Text]
-
Zhang B, Singh KB
(1994)
ocs element promoter sequences are activated by auxin and salicylic acid in Arabidopsis.
Proc Natl Acad Sci USA
91: 2507-2511
[Abstract/Free Full Text]
-
Zhang S, Klessig DF
(1997)
Salicylic acid activates a 48-kD MAP kinase in tobacco.
Plant Cell
9: 809-824
[Abstract]
-
Zhang Y, Fan W, Kinkema M, Li X, Dong X
(1999)
Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene.
Proc Natl Acad Sci USA
96: 6523-6528
[Abstract/Free Full Text]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
M. Zottini, A. Costa, R. De Michele, M. Ruzzene, F. Carimi, and F. Lo Schiavo
Salicylic acid activates nitric oxide synthesis in Arabidopsis
J. Exp. Bot.,
April 1, 2007;
58(6):
1397 - 1405.
[Abstract]
[Full Text]
[PDF]
|
 | |