INTRODUCTION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

Light affects plant gene expression at many levels, including transcription, mRNA stability, translation, and post-translational steps (Thompson and White, 1991; Harter et al., 1994; Mayfield and Cohen, 1998), and multiple levels of regulation may affect the expression of a particular gene. Ferredoxin-1 (Fed-1), a nuclear gene from pea encoding the major chloroplast isoform of ferredoxin, exemplifies this complexity. Fed-1 mRNA abundance is regulated by light at the level of transcription initiation in etiolated seedlings (Gallo-Meagher et al., 1992). In green leaves, however, Fed-1 mRNA abundance is regulated primarily by changes in mRNA stability (Elliot et al., 1989; Petracek et al., 1998b). In green leaves Fed-1 mRNA levels decline during extended dark periods and increase dramatically upon 6 h of re-illumination (Dickey et al., 1992). Most of this light effect persists when Fed-1 mRNA is transcribed from the constitutive CaMV 35S-promoter (light:dark ratio [L:D] is 4- to 5-fold) (Elliot et al., 1989). The element responsible for this post-transcriptional light regulation is the internal light regulatory element (iLRE). The Fed-1 iLRE is contained within the 89-base untranslated region (5' UTR) and the first one-third (141 bases) of the coding region. Fusion to the iLRE confers light responsiveness on normally non-responsive mRNAs (Dickey et al., 1992). Direct half-life measurements using a repressible promoter system (Gatz, 1995) have confirmed that this light effect results from a change in mRNA stability. In the leaves of plants transferred from light to darkness, the half-life of Fed-1 mRNA decreases from 2.4 h to 1.2 h (Petracek et al., 1998b).

Two lines of evidence suggest that changes in translation are required for the observed changes in Fed-1 mRNA stability. First, light effects on Fed-1 mRNA abundance are observed only when the Fed-1 iLRE contains an open reading frame (Dickey et al., 1994, 1998). Second, Fed-1 mRNA is preferentially associated with polyribosomes in illuminated leaves but dissociates when plants are kept in darkness (Petracek et al., 1997; Dickey et al., 1998) or treated with 3-(3, 4-dichlorophenyl)-1,1-dimethylurea, an inhibitor of photosynthetic electron transport (Petracek et al., 1998b). The dissociation of Fed-1 mRNA from polyribosomes in the presence of 3-(3, 4-dichlorophenyl)-1,1-dimethylurea correlates with a decline in mRNA half-life similar to that observed in darkness, suggesting that photosynthesis is essential for Fed-1 mRNA translation and stability in the light (Petracek et al., 1998b).

These observations led us to propose that mRNAs containing the Fed-1 iLRE are translated more efficiently in photosynthetically active cells and that the process of translation and/or the presence of ribosomes on the mRNA reduces its degradation. That translating ribosomes can provide protection from degradation has been well described in prokaryotic systems (e.g. Iost and Dreyfus, 1995). In this paper we present time-course data on polyribosome association and translation efficiency of a model mRNA containing the Fed-1 iLRE. Consistent with our model, dark-induced dissociation of this mRNA from polyribosomes is rapid and reversible, and in vivo labeling data indicate that its rate of translation declines prior to the decrease in its abundance. It is interesting that other mRNAs, including full-length pea Fed-1 mRNA, endogenous tobacco (Nicotiana tabacum) Fed-1 mRNA, and endogenous tobacco Lhcb mRNA, were also rapidly released from ribosomes in the dark, suggesting they may be regulated by a translational mechanism similar to that regulating Fed-1. Not all photosynthesis-related mRNAs show this response, but we suggest that an important subclass of leaf mRNAs exhibit a translation-mediated response to changes in photosynthetic activity.

	RESULTS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

Translational Efficiency Declines during a Light-to- Dark Transition

We used two approaches to examine the translational response of Fed-1 mRNA. Both involved a reporter mRNA constructed by fusing chloramphenicol acetyltransferase (CAT) mRNA to the Fed-1 iLRE as previously described (Dickey et al., 1998; Fig. 1). Our first approach involved in vivo labeling with a mixture of [³⁵S]Met and [³⁵S]Cys, followed by immunoprecipitation of the fusion protein with an antibody against CAT. To avoid wound effects, we applied the ³⁵S-precursors to the leaf surfaces of intact seedlings for 2.5 h. (In our hands, this is the shortest time period during which a sufficient amount of label is absorbed and incorporated into protein.) Figure 2 and Table I show that incorporation of [³⁵S]Met and [³⁵S]Cys into the Fed-1 iLRE::CAT fusion protein was 5.8-fold less in the dark than in the light. In contrast, transgenic 35S::Fed-1 5' UTR::CAT plants showed only a 1.7-fold decrease in incorporation into CAT protein, whereas control plants containing a 35S::CAT transgene showed a 1.4-fold decrease.

View larger version (33K): [in this window] [in a new window]   Figure 1.   Diagrams of the transgenes used. Shown are the gene constructs used to transform tobacco plants. Except for 35S::FedA, plants expressing these constructs were previously characterized, as indicated. A, 35S::CAT (Petracek et al., 1997); B, 35S::Fed-1 5'-UTR::CAT (Dickey et al., 1998); C, 35S::Fed-1 iLRE::CAT (Dickey et al., 1998); D, 35S::Fed-1 (Dickey et al., 1992); E, 35S::PetE::Nos (Helliwell et al., 1997); F, 35S::FedA was constructed to achieve transcription at the transcriptional start site reported for the endogenous gene (Somers et al., 1990; Vorst et al., 1990).

View larger version (95K): [in this window] [in a new window]   Figure 2.   Autoradiograph of immunoprecipitated proteins from tobacco plants labeled for 2.5 h. Six-week-old plants grown on a 12-h light/dark cycle were labeled in the light (L) or dark (D) for 2.5 h. Sample volumes were adjusted to represent an equal number of counts taken up in the tissue. Fed-1 iLRE:CAT fusion protein has lower mobility than CAT, as predicted by its higher Mr. A, Radioactivity in immunoprecipitated CAT or CAT fusion proteins was measured with a Phosphorimager as described in "Materials and Methods." The boxes around the Fed-1 iLRE:CAT and CAT protein bands represent the approximate area counted. Background was estimated by moving the boxes to a position immediately above the protein bands. Resulting total counts are as follows: Fed-1 iLRE::CAT L (462,000), D (65,000), CAT L (61,000), D (72,000), and Fed-1 5'-UTR::CAT L (47,000), and D (57,000). B, RNA was extracted from the light- and dark-treated samples shown in A and 5 µg of total RNA was analyzed by northern-blot analysis using 32P-labeled antisense CAT.

View this table: [in this window] [in a new window]   Table I.   [35S]Met/Cys incorporation, mRNA abundance, and relative translational efficiency after transfer to darkness Vessels containing eight 6-week-old tobacco plants were either transferred to the dark or left in the light and [35S]Met/Cys was applied. Labeling time indicates the length of time the plants were exposed to the [35S]Met/Cys. Sample size (n) refers to the number of vessels used for protein labeling. For each experiment, mRNA was extracted from plants in an additional container. Differences in label uptake in the light and dark were determined from total protein extract radioactivity and the volume of immunoprecipitate loaded in the wells of the gel was corrected by the corresponding percent difference for each light-dark set. 35S-labeled transgenic protein was quantified by Phosphorimager analysis. L:D represents light:dark ratios. The change in translational efficiency ( Translational Efficiency) is obtained by dividing amino acid incorporation ratios by mRNA abundance ratios.

Given the rapid decline in translational activity, it was of interest to know whether or not there was a similarly rapid change in mRNA abundance. After 2.5 h of darkness, Fed-1 iLRE::CAT mRNA abundance declined 2.4-fold (Table I). This decline continued until 6 h, when Fed-1 iLRE::CAT mRNA levels were reduced by approximately 4- to 5-fold relative to those in light-treated leaves (Fig. 2B; Table I; Dickey et al., 1992). Thus, the effect of darkness on Fed-1 iLRE::CAT mRNA abundance is not complete at 2.5 h. CAT control and Fed-1 5' UTR::CAT mRNAs showed minimal decreases after 2.5 h of darkness, consistent with previous mRNA abundance measurements indicating that there is little, if any, light effect on mRNA produced by these transgenes (Dickey et al., 1992).

An estimate of the change () in translational efficiency for each mRNA was made by dividing the relative amount of ³⁵S-incorporation into CAT protein by the corresponding relative mRNA abundance value (Table I). The resulting ratio reflects the difference in translational efficiency (amino acid incorporation per unit mRNA) of Fed-1 iLRE::CAT mRNA in leaves exposed to light or darkness. Table I shows that the translational efficiency Fed-1 iLRE::CAT mRNA was 2.4-fold greater in the light than during the first 2.5 h of darkness. In contrast, CAT and Fed-1 5' UTR::CAT mRNAs exhibited no change in translational efficiencies between the light and dark.

When the labeling period was lengthened to 6 h, ³⁵S-incorporation into Fed-1 iLRE::CAT protein in the dark decreased slightly from that observed after 2.5 h (Table I). However, this additional decline notably was more than offset by a further decrease in Fed-1 iLRE::CAT mRNA abundance, resulting in a less dramatic change in the translational efficiency after 6 h darkness than after 2.5 h. We conclude that an initial decline in translational activity is followed by a decline in mRNA abundance, but that mRNA surviving the decline continues to be actively translated.

Polyribosome Association Decreases Rapidly in the Dark

As a second approach, and to more closely follow the kinetics of translational and mRNA abundance changes, we asked how polyribosome association and mRNA abundance change with time after transfer to darkness. We knew that Fed-1 mRNA dissociates from polyribosomes during 2 d in darkness and becomes associated with polyribosomes upon re-illumination for 2 h (Petracek et al., 1997). However, these experiments did not provide kinetic information about the early phase of the response. Therefore, we placed tobacco plants containing the 35S::Fed-1 iLRE::CAT transgene in darkness for 20, 40, or 60 min prior to isolation of polyribosomes and total mRNA. Polyribosomes were extracted and fractionated on Suc gradients as described in "Materials and Methods." The gradients were then fractionated, and the RNA in each fraction examined on northern blots hybridized with a probe for CAT sequences. Examples of northern analyses from a typical series of Suc gradients are presented in Figure 3A. Quantitative phosphorimager analysis of several gradients allowed us to calculate the percentage of Fed-1 iLRE::CAT mRNA in the polyribosome fractions (Fig. 3B). These data show that Fed-1 iLRE::CAT mRNA dissociates very rapidly after the onset of darkness, with maximal dissociation being achieved within 20 min.

View larger version (30K): [in this window] [in a new window]   Figure 3.   Polyribosome association of Fed-1 iLRE::CAT mRNA in plants transferred from light to dark. Transgenic 35S::Fed-1 iLRE::CAT tobacco were transferred to the dark for the time indicated, beginning during the 4th h of the light phase (time 0) of the 12-h-light/12-h-dark cycle. A, Autoradiograms of northern blots of Fed-1 iLRE::CAT mRNA fractionated on a Suc density gradient and resolved by gel electrophoresis. Fractions are labeled 1 through 12 from the top to the bottom of the gradient. The resulting gels were blotted to nylon membrane and hybridized with 32P-labeled antisense probe for CAT sequences. Fractions 1 to 5 from the top of the gradient contain mRNA not associated with polyribosomes, whereas fractions 6 to 12 contain polyribosomal mRNA. The time that plants were in darkness is indicated in minutes. Sample sizes were not the same on each gradient so signal strengths on the northern blots can be directly compared only within a given gradient. B, Percent polyribosome association of Fed-1 iLRE::CAT mRNA after 0, 20, 40, and 60 min in the dark. The percentage of mRNA in the polyribosomal fractions is calculated from Phosphorimager analysis of three separate experiments including the northern blots shown in 4A. C, Change in Fed-1 iLRE::CAT mRNA abundance after 0, 20, 40, and 60 min in the dark. Data was derived by Phosphorimager analysis of northern blots of 5 µg of total mRNA hybridized with 32P-labeled CAT specific antisense RNA. Each time point represents the average of at least three different experiments. Total abundance is shown relative to the abundance at zero time. D, UV A254 profiles of polyribosome fractionations were recorded after ultracentrifugation by pumping the gradient through a cuvette. Sample extracts included chloroplast ribosomes as well as cytoplasmic ribosomes, yielding multiple ribosomal subunit peaks (approximately fractions 2-4). The x axis is labeled with numbers indicating the approximate posi- tion of the fractions collected for the northern analysis shown in A through C. Polyribosomal and non-polyribosomal portions of the gradient are indicated. Fractions 4 and 5 represent the monosome peak. The sensitivity of the chart recorder was increased by a factor of two at the position indicated by the arrow. The y axis indicates the relative UV A254.

Next, we asked if the decline in Fed-1 iLRE::CAT mRNA abundance preceded or followed polyribosome dissociation. We measured the relative abundance of Fed-1 iLRE::CAT mRNA in RNA samples taken 20, 40, and 60 min after transfer to darkness (Fig. 3C). Fed-1 iLRE::CAT mRNA declined only gradually during the first hour of darkness. At 20 min we did not detect a statistically significant decrease, even though most of the mRNA had dissociated from polyribosomes at this time. After 40 and 60 min of darkness, mRNA levels were still approximately 80% and 50%, respectively, of what they had been in the light (Table I). It is clear that most if not all of the decline in Fed-1 iLRE::CAT mRNA abundance occurs after dissociation of polyribosomes.

We asked if the polyribosome dissociation of Fed-1 iLRE mRNAs was unique or if other plant mRNAs are also rapidly dissociated from polyribosomes in the dark. Figure 3D shows UV absorbance profiles of polyribosome gradients corresponding to the time points presented in Figure 3A. Even at 20 min there was a substantial reduction in the area under the polyribosome peaks and a concomitant increase in non-polyribosomal material, indicating that many mRNAs dissociate from polyribosomes in darkness with kinetics similar to that of the Fed-1 iLRE::CAT mRNA.

The Decline in Polyribosome-Associated mRNA Is Rapidly Reversed upon Re-Illumination

Fed-1 mRNA abundance increases when plants are returned to the light after an extended dark treatment (3 d) (Elliot et al., 1989), and this increase is accompanied by an increase in polyribosome association (Petracek et al., 1997). However, our previous re-illumination experiments have not examined the kinetics of these processes. In view of the rapid changes that occur after transfer to darkness, it was of interest to obtain kinetic data for the re-illumination response. Tobacco plants containing the 35S::Fed-1 iLRE::CAT transgene were transferred to darkness for 60 min and then returned to the light for 30, 60, or 120 min. Northern analysis of polyribosome gradients (Fig. 4, A and B) showed that the proportion of Fed-1 iLRE::CAT mRNA in the polyribosomal fraction increases from 30% at the end of the dark period to 55% after 30 min in the light, and reaches 70% after 2 h. As there is a similarly rapid increase in mRNA abundance (Fig. 4C), the total translational potential must increase even more dramatically. We conclude that the iLRE-mediated decline in translational activity is rapidly reversed when plants are returned to the light and that the increase probably involves both pre-existing and newly synthesized mRNA.

View larger version (41K): [in this window] [in a new window]   Figure 4.   Reversible dissociation/re-association of Fed-1 iLRE::CAT mRNA. Transgenic 35S:: Fed-1 iLRE::CAT tobacco were transferred to the dark for 1 h, beginning during the 4th h of the light phase as described for Figure 3. Plants were then transferred back to the light for the indicated times prior to harvest. A, Autoradiograms of northern blots of Fed-1 iLRE::CAT mRNA fractionated on a Suc density gradient. Fractions are labeled 1 through 12 from the top to the bottom of the gradient. RNA was purified from each fraction and analyzed by gel-blot hybridization using a32P-labeled antisense probe for CAT sequences. Different gradients were not loaded equally so band intensities can be compared only within a given gradient. B, Percentage of polyribosome association of Fed-1 iLRE::CAT mRNA after 0, 30, 60, and 120 min of re-illumination. The percentage of mRNA in the polyribosomal fractions is calculated from Phosphorimager data for three separate experiments, including northern blots shown in A. C, Change in Fed-1 iLRE::CAT mRNA abundance following 1 h of dark and various periods of re-illumination. The relative amount of Fed-1 iLRE::CAT hybridizing RNA was calculated from at least three different experiments at each time point. Data were derived by Phosphorimager analysis of northern blots hybridized with a 32P-labeled CAT -specific antisense RNA probe. Abundance is shown relative to that at zero time.

Polyribosome Association of Other Photosynthetic and Non-Photosynthetic Genes

To determine whether CAT sequences contributed to the rapid decline in the association of Fed-1 iLRE::CAT mRNA with polyribosomes, we measured polyribosome association of full length Fed-1 mRNA after a brief dark treatment. Like Fed-1 iLRE::CAT mRNA, full length Fed-1 mRNA dissociates from polyribosomes after 20 min of darkness (Fig. 5). However, 35S::CAT mRNA showed no changed in polyribosome association under the same conditions (M.E. Petracek, data not shown). Together these results indicate that the rapid dissociation did not require CAT sequences.

View larger version (50K): [in this window] [in a new window]   Figure 5.   Polyribosome association of transgenic and endogenous mRNAs. Wild-type tobacco or plants containing various transgenes (35S::Fed-1, 35S::FedA, or 35S::PetE) or wild-type tobacco plants (for endogenous genes) were transferred to darkness for 20 min as described in Figure 3 or allowed to remain in the light before harvest. Following Suc gradient ultracentrifugation, RNA from the resulting gradient fractions 1 through 12, numbered from the top to bottom of the gradient, were resolved by gel electrophoresis. The resulting gels were blotted to nylon membrane and hybridized with 32P-labeled antisense gene-specific probes as indicated. The polyribosome association profile for each mRNA is representative of two to three independent experiments. Different gradients were not loaded equally so signal strengths on the northern blots can be compared only within the same gradient.

If the rapid changes in polyribosome association are not unique to pea Fed-1 mRNA, they may represent an important form of post-transcriptional control. Thus, we measured the polyribosome association of several mRNAs encoding photosynthetic and non-photosynthetic proteins, using leaves harvested in the light or after 20 min of darkness. Figure 5 shows that full-length transgenic Fed-1, endogenous tobacco Fed-1, and endogenous tobacco Lhcb mRNAs all dissociate from polyribosomes in darkness, suggesting that these mRNAs are regulated by a translational mechanism similar to that of Fed-1 iLRE::CAT. The rapid response of Lhcb mRNA also suggested that this mechanism might affect other genes for photosynthesis-related proteins. However, it is notable that the dissociation pattern of the transgenic pea Fed-1 mRNA is different from that of both Lhcb and endogenous tobacco Fed-1 mRNA. For all three mRNAs in the dark, a substantial portion of the mRNA shifts to non-polyribosomal fractions, whereas a lesser portion remains in the polyribosome fractions. In the case of pea Fed-1 mRNA, however, Figure 5 shows that mRNAs remaining in the polyribosome fractions are associated with fewer ribosomes, shifting from fractions 8 and 9 in the light to fractions 6 and 7 in the dark. No such shift was observed for endogenous tobacco Fed-1 mRNA and Lhcb mRNA, suggesting that in these cases the number of ribosomes per translated mRNA remains the same.

The mRNAs of two other photosynthetic transgenes in tobacco, 35S::FedA (Arabidopsis ferredoxin) (Caspar and Quail, 1993; Bovy et al., 1995) and 35S::PetE (pea plastocyanin) (Helliwell et al., 1997), do not display appreciable declines in polyribosome association in the dark (Fig. 5). PetE mRNA has been shown to increase by 5.3-fold when etiolated seedlings containing 35S::PetE constructs were exposed to light (Helliwell et al., 1997), and we have shown that PetE mRNA increases 3-fold when plants held for 40 h in the dark are re-illuminated for 6 h (Table II). Because light has little effect on the 35S-promoter, we interpret both sets of results as indicating changes in the stability of PetE mRNA. However, in contrast to the Fed-1 response, these changes may take place in the polyribosomal fraction.

Plants in which FedA is transcribed from the 35S-promoter do not show appreciable changes in FedA mRNA abundance or polyribosome association in re-illumination experiments (Table II; Bovy et al., 1995; M. Petracek, unpublished data). Although these results are not fully understood, they emphasize the likelihood that not all nuclear-encoded photosynthetic mRNAs display the translation-linked mRNA stability response documented for pea Fed-1.

In addition to mRNAs associated with photosynthesis, we also examined polyribosome profiles for the non-light regulated endogenous tobacco mRNA, eIF-4A10 (GenBank accession no. X79009), which encodes a translation initiation factor. Polyribosome association of this mRNA also did not decline in the dark (Fig. 5). Taken together, these observations suggest that a subset of nuclear-encoded photosynthetic genes is translationally regulated through a mechanism similar to pea Fed-1.

	DISCUSSION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

We have shown that mRNA containing the Fed-1 iLRE ceases translation and dissociates from polyribosomes soon after photosynthetically active green leaves are transferred from light to darkness. Polyribosome dissociation reached a maximum by 20 min in the dark, well before a significant decline in mRNA abundance. This observation provides strong additional support for a model (Petracek et al., 1998a) in which Fed-1 mRNA is protected from degradation in the light by association with ribosomes and/or the act of translation.

The decrease we observe in translational efficiency (translational activity per unit mRNA) of Fed-1 iLRE::CAT mRNA is associated with a shift from the polyribosomal to the non-polyribosomal fractions. This shift occurs quite soon after the onset of darkness. We therefore propose that iLRE-containing mRNAs dissociate from polyribosomes prior to the onset of increased degradation, resulting in a transient accumulation of Fed-1 iLRE::CAT mRNA in the non-polyribosomal fractions. Because this pool of "free" mRNA is translationally inactive, its presence decreases the average translational efficiency of the mRNA population, even though the small amount of mRNA remaining on polyribosomes may still be actively translated. At later times, the amount of free mRNA decreases, probably as the result of preferential degradation (Petracek et al., 1998b). If polyribosomal messages continue to be translated normally, the resulting decrease in free mRNA would account for the increase in translational efficiency (translation per unit of mRNA present anywhere in the cell) that we observe between 2.5 and 6 h of darkness.

Our data are most consistent with a model in which translational initiation, rather than translational elongation or termination, is the principal process affected by the light to dark transition. If elongation or termination was blocked in darkness, one would expect polyribosome association to remain high, as observed for RbcS mRNA in Amaranth seedlings (Berry et al., 1988). Untranslated mRNAs might then be degraded while still associated with ribosomes, and there would be no accumulation of free mRNA. In contrast, we observe a rapid and transient accumulation of free Fed-1 iLRE::CAT and Fed-1 mRNA (fraction 2 in Figs. 3A and 5). This accumulation is strongly suggestive of reduced translational initiation.

Although PetE mRNA regulation seems similar to that of Fed-1 mRNA in many respects (Helliwell et al., 1997), we detected no increase in the non-polyribosomal PetE mRNA in the dark. The apparent lack of a change in polyribosome association during either a 20-min (Fig. 5) or a 40-h dark treatment (M.E. Petracek, data not shown) may indicate that PetE mRNA translation does not respond to darkness. However, an alternative possibility that we consider more likely is that PetE mRNA is very rapidly degraded in the absence of polyribosomal protection and thus cannot be detected in non-polyribosomal fractions.

In dark-treated plants, a decline in total polyribosomal mRNA parallels the changes we have observed for mRNA containing the Fed-1 iLRE. This decline implies a considerable decrease in translation within the cell, which is consistent with our observation that darkness reduced total amino acid incorporation by 30% in a 2.5-h labeling period (E.R. Hansen, data not shown). In principle, this decline in isotope incorporation could result from a uniform decrease in translation of all proteins. However, we believe it is more likely to reflect a selective effect on the translation of a few abundant mRNAs encoding highly expressed photosynthetic proteins. As a first step in testing this hypothesis, we have identified a number of other transcripts that are preferentially depleted in the polyribosome fraction shortly after transfer to darkness. Almost all encode proteins known to be involved in photosynthesis (M.E. Petracek, unpublished data). Although it is clear that not all photosynthesis-related mRNAs are regulated this way, further investigation may reveal a regulatory subclass in which mRNA stability is strongly influenced by rapid changes in translational initiation.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

Plasmid Construction and Tobacco Transformation

All plasmids for the production of transgenic plants were made by inserting the appropriate sequences behind the 35S-promoter of pBi121 (Jefferson, 1987). Plasmids were transferred into Agrobacterium tumafaciens by triparental mating and transgenic tobacco (Nicotiana tabacum) were derived via Agrobacterium sp.-mediated leaf disc transformation into tobacco (cv SR-1 and cv Petite Havana) plants (Horsch et al., 1985). Line 1520 contains the 35S::CAT transgene (Petracek et al., 1997); line 2910 contains the 35S::5'-UTR Fed-1::CAT transgene (Dickey et al., 1998); and line 1458 contains 35S::Fed-1 iLRE::CAT (Dickey et al., 1998) transgene and includes the entire 230-bp Fed-1 iLRE (GenBank accession no. M31713; nt 677-907). Line 312, 35S::Fed-1 contains the Fed-1 transcribed and terminator sequences, and line 35S::PetE (GenBank accession no. X16082; nt 760-1,319) tobacco plants were as described previously (Helliwell et al., 1997).

The 35S::FedA plasmid was constructed as follows. We wanted an Arabidopsis FedA transgene that initiates transcription at the natural FedA initiation site. We performed two-step PCR. TC2 (Caspar and Quail, 1993), which contains the entire FedA mRNA sequence and promoter, was used as a template in the first PCR reaction to generate an approximately 800-bp product. A hybrid oligonucleotide (5' TCATTTCATTTGGAGAGGAATAATCCTCAAAAATCTCAA 3') composed of the last 19 nt of the CaMV 35S-promoter (up to the transcriptional start site) and the first 20 nt of the FedA 5' UTR (underlined) was used as the 5' primer. The 3' primer (5' CAGGAGCTCTCTAGAGAATTATCAATCTAAGATT 3') was homologous to the antisense 3' portion of FedA with SacI and XbaI sites (underlined) added. A second PCR reaction was performed as described (Dickey et al., 1994). Specifically, the resulting approximately 800-bp PCR product from the first PCR step was used as a 3' primer on a 35S-promoter template with the 5' primer (5' TGCAAGCTTCCCACAGAATGGTTAGAGAGGC 3') designed to have homology to the 5' end of the 35S-promoter while incorporating a HindIII site (underlined). The resulting approximately 1,600-bp fusion PCR product consists of the 35S-promoter and FedA transcript and directs transcriptional initiation at the native FedA transcription start site without the addition of 35S-promoter sequences on the transcript (M.E. Petracek, unpublished data). The approximately 1,600-bp PCR product was digested with HindIII and SacI and ligated into the HindIII/SacI sites of pGPTV-Kan (Becker et al., 1992) and transformed into Agrobacterium tumefaciens strain LBA4404 by triparental mating (Elliot et al., 1989).

Plant Growth

Transgenic seeds were germinated in petri dishes on sterile solid Murashige and Skoog media containing 0.8% (w/v) Phytagar (Life Technologies, Grand Island, NY) and kanamycin (300 mg/mL). After 3 weeks, resistant seedlings were transferred to Plant-Cons (ICN Pharmaceutical, Costa Mesa, CA) containing sterile solid Murashige and Skoog media, at a density of 8 to 10 seedlings per container. The seedlings were grown for an additional 3 weeks in a growth chamber at 22°C using a 12-h light/12-h dark cycle with 12 fluorescent and six incandescent lamps that produced a light fluence of approximately 240 µmol m² s¹ between 380 and 780 nm.

For polyribosome experiments, the Plant-Cons were wrapped in three layers of aluminum foil. After 20, 40, or 60 min of darkness, the containers were unwrapped and leaves were harvested in the dark. For some experiments, plants were placed in the dark for 1 h, followed by re-illumination. In these experiments, containers with plants were wrapped in aluminum foil as above. After 1 h of darkness, the foil was removed and leaves were harvested after 0, 30, 60, and 120 min in the light. All samples were harvested directly into liquid nitrogen and subsequently stored at 80°C. Frozen tissue was broken into small fragments (2-4 mm²) and mixed with a glass rod while immersed in liquid nitrogen. Separate portions of the resulting powder were then used for total RNA extraction and polyribosome analysis.

For in vivo labeling experiments, pairs of Plant-Cons with similar plants were used for light to dark comparisons and analyzed together. Closed containers are beneficial in these experiments for several reasons. First, leaves of plants grown under tissue culture conditions have thinner cuticles and absorb radioactive label at higher rates than plants grown in open air. Second, the closed containers prevent the release of volatile radioactive compounds during labeling. Also, the use of sterile conditions reduces the problem of incorporation of radioactive amino acids by epiphytic bacteria.

RNA Analysis

For mRNA abundance measurements, total RNA was prepared from each sample, 5 µg was run in each lane and analyzed by RNA-blot (northern) analysis as described previously (Elliot et al., 1989). Polyribosome analysis was performed using a modification of a published protocol (Davies and Abe, 1995). These modifications have been previously described in detail (Petracek et al., 1997); the following provides a brief summary. Approximately 100-250 mg of leaf tissue were used for each gradient. In general, lower quantities of tissue resulted in less mRNA degradation. We avoided weighing samples prior to grinding and extraction to prevent even slight tissue thawing (and thus mRNA degradation). Therefore, different gradients were not loaded equally, and the total signal on northern blots cannot be compared between different treatments. Sample extracts were centrifuged for 15 min at 9,000g to remove plant debris, but the polyribosomes were not pelleted. Extract (750 µL) was loaded directly onto a 14-mL 15% to 60% (w/v) Suc gradient. After ultracentrifugation for 3.5 h in an AH-629 rotor at 88,300g, the gradient was fractionated using an ISCO syringe pump fractionator (ISCO Separations, Lincoln, NE). One-milliliter fractions were dripped directly into phenol:chloroform:isoamyl-alcohol supplemented with 25 µL of 10% (w/v) SDS, 20 µL of 0.5 M EDTA, and 5 µL of 100 mM aurin tricarboxylic acid, followed rapidly by ethyl alcohol precipitation with sodium acetate of the aqueous phase. Following glyoxylation, one-third of each fraction was loaded onto a phosphate-buffered 1.5% (w/v) agarose gel. Hybridizations were carried out using antisense RNA probes as described (Dickey et al., 1992). mRNAs were quantified using a Phosphorimager (Molecular Dynamics, Sunnyvale, CA) to detect radioactive signals after RNA-blot hybridization.

Labeling with ³⁵S-Amino Acids

The plants in each Plant-Con were labeled with 250 µCi of >1,000 Ci (37.0 TBq)/mmol [³⁵S]Met and [³⁵S]Cys (EXPRE³⁵S³⁵S Labeling Mix, NEN Life Science Products, Boston) diluted to 200 µL of final volume in water, 0.1% (v/v) Tween 20, with no additional buffer. The label was spotted on the leaves with a pipettor and spread with a soft paintbrush. Immediately after application of ³⁵S-amino acids, containers for dark-labeling were wrapped in aluminum foil, and all Plant-Cons were returned to the growth chamber for 2.5 h. Plants were then harvested, rinsed briefly in water containing 1 mM unlabeled Met, frozen in liquid nitrogen, and stored at 80°C until samples were prepared.

Protein Extraction and Immunoprecipitation

Labeled plant tissue (0.5-1.0 g) was ground to a fine powder under liquid nitrogen. Three milliliters of phosphate buffered saline containing 0.8 mM phenylmethylsulfonyl fluoride, 10 mM diethyl-dithiocarbamate, 1 µg mL¹ aprotinin (Sigma, St. Louis), 1 µg mL¹ trans-Epoxysuccinyl-L-leucylamido (4-guanidino) butane (Sigma), and 0.5% (v/v) -mercaptoethanol were added to the sample, along with approximately 0.2 g of insoluble polyvinylpolypyrolidone (Sigma). Upon thawing, the sample was briefly ground and transferred to a 15-mL round bottom snap-cap tube (Falcon) and centrifuged at 9,400g for 15 min in a Sorvall SA600 rotor to remove debris. The supernatant was transferred into two 2.2-mL Eppendorf tubes and centrifuged at 13,100g at 4°C for 30 min. The supernatant was transferred to a new tube and centrifuged for an additional 30 min at 4°C. To avoid excessive protein degradation, equal volumes of protein extract from light and dark samples were used immediately for immunoprecipitation. The remaining total protein extract was used to calculate relative uptake of radiolabeled amino acid in the light compared to the dark. The amount of immunoprecipitated product used for SDS-PAGE was adjusted to account for greater label uptake in the light.

For immunopreciptitation of CAT-containing proteins, 0.85 mL of the final supernatant was combined with 60 µL of immobilized anti-CAT antibody sepharose beads (Eppendorf 5 Prime, Boulder, CO) and shaken on a rotary shaker for 2.5 h at room temperature. The suspension was transferred to a 2-mL Select-D column (Eppendorf 5 Prime, Boulder, CO) and washed four times with 2 mL of phosphate-buffered saline containing 0.2% (v/v) Nonidet P-40 (Sigma). We determined by ELISA that the immobilized anti-CAT antibody removed more than 99.9% of the Fed-1 iLRE::CAT fusion protein from extracts. The sepharose bead suspension was transferred to a 1.5-mL Eppendorf tube with 1.2 mL of wash solution and spun for 2 min at 700g. The supernatant was removed and mixed with 60 µL of 5× SDS sample loading buffer (Ausubel et al., 1998). The samples were incubated at 50°C for 30 min and 100°C for an additional 30 min to release the CAT fusion proteins from the antibodies (Ausubel et al., 1998), and centrifuged for 20 s at 13,100g. Aliquots of the resulting supernatant were loaded onto a 14 × 14 cm 16% (w/v) SDS-polyacrylamide gel with a 19:1 acrylamide:bisacrylamide ratio (Amresco, Dallas). Aliquots (60 µL) were loaded from dark-treated samples, and the volume of light-treated samples loaded was adjusted using the calculations of total uptake of labeled amino acid.

The gel was run overnight at a constant 60 V (5 V/cm), then electroblotted to Immobilon membrane (Millipore, Bedford, MA) using a NovaBlot semi-dry blotter (LKB, Bromma, Sweden). To prevent excessive heating, the blotter was run at 0.8 milliamps cm² constant current, until the voltage increased from 8 to 30 V, and then at constant voltage for 2 h. Autoradiographs were obtained directly from the blots, and the amount of radioactively labeled CAT protein in each sample was determined by Phosphorimager analysis of the blots (Molecular Dynamics). Background on the blots was estimated by measuring the radioactivity in each lane immediately above the CAT fusion-protein bands.

Total protein in extracts was determined by Bradford Analysis using a reagent supplied by Bio-Rad (Hercules, CA). ELISA assays were performed with a CAT ELISA kit from Eppendorf 5 Prime, using the protocol supplied by the manufacturer.