|
Plant Physiol, April 2001, Vol. 125, pp. 2059-2067
Expression of a Pseudomonas aeruginosa Citrate
Synthase Gene in Tobacco Is Not Associated with Either Enhanced Citrate
Accumulation or Efflux1
Emmanuel
Delhaize,*
Diane M.
Hebb, and
Peter R.
Ryan
Commonwealth Scientific and Industrial Research Organization Plant
Industry, G.P.O. Box 1600, Canberra Australian Capital Territory 2601, Australia
 |
ABSTRACT |
Aluminum (Al) toxicity and poor phosphorus (P) availability are
factors that limit plant growth on many agricultural soils. Previous
work reported that expression of a Pseudomonas
aeruginosa citrate synthase gene in tobacco (Nicotiana
tabacum; CSb lines) resulted in improved Al tolerance (J.M. de
la Fuente, V. Ramírez-Rodríguez, J.L. Cabrera-Ponce, L. Herrera-Estrella [1997] Science 276: 1566-1568) and an enhanced
ability to acquire P from alkaline soils (J. López-Bucio, O. Martínez de la Vega, A. Guevara-García, L. Herrera-Estrella [2000] Nat Biotechnol 18: 450-453). These effects
were attributed to the P. aeruginosa citrate synthase
increasing the biosynthesis and efflux of citrate from roots. To verify
these findings we: (a) characterized citrate efflux from roots of
wild-type tobacco; (b) generated tobacco lines expressing the citrate
synthase gene from P. aeruginosa; and (c) analyzed
selected CSb lines described above. Al stimulated citrate efflux from
intact roots of wild-type tobacco and root apices were found to be
responsible for most of the efflux. Despite generating transgenic
tobacco lines that expressed the citrate synthase protein at up to a
100-fold greater level than the previously described CSb lines, these
lines did not show increased accumulation of citrate in roots or
increased Al-activated efflux of citrate from roots. Selected CSb
lines, similarly, failed to show differences compared with controls in either citrate accumulation or efflux. We conclude that expression of
the P. aeruginosa citrate synthase gene in plants is
unlikely to be a robust and easily reproducible strategy for enhancing the Al tolerance and P-nutrition of crop and pasture species.
 |
INTRODUCTION |
Organic acids exuded by roots have
been shown to have important roles in the mineral nutrition of plants.
In particular, organic acid exudation is involved in Al tolerance and
is a mechanism by which plants acquire P from soil. A range of species
exude organic acids from roots in response to Al, and this response is
associated with Al tolerance within species and across different species (Ma, 2000 ). It is postulated that the organic acids chelate Al
external to the root into forms that are not toxic to plants. The
relative strength of organic acid:Al complexes correlates well with the
observed effectiveness of different organic acids to protect plants
from Al-toxicity (Hue et al., 1986 ). In addition, some plant species
exude large quantities of organic acids when P deficient. For example,
Lupinus albus forms specialized roots that release large
amounts of citrate (Gardner et al., 1983 ) and, in some cases, the
amount of citrate accumulated around roots on calcereous soils
precipitate as Ca citrate (Dinklaker et al., 1989 ). Citrate exuded from
roots can liberate phosphate from poorly soluble forms of P present in
soils, and this phosphate is available for plant uptake.
Acid soils account for a large proportion of the earth's arable land
and on many of these soils Al toxicity and poor availability of P
limits plant production (von Uexküll and Mutert, 1995 ). In
addition, on alkaline soils P is poorly available as it forms sparingly
soluble compounds with Ca. The application of genetic engineering has
the potential to generate crop and pasture plants better adapted to
these soils. Toward this end, de la Fuente et al. (1997) reported that
tobacco (Nicotiana tabacum) engineered to over-produce
citrate had enhanced citrate efflux with a corresponding increase in Al
tolerance. Furthermore, López-Bucio et al. (2000) recently
reported that these same transgenic tobacco plants were able to acquire
P more efficiently than control plants when grown in an alkaline soil.
The potential benefits of improved P acquisition by use of this
technology are likely to be significant since every year over 30 million tons of P fertilizer as
P2O5 equivalents are
applied worldwide (www.fertilizer.org/stats.htm). More efficient use of
this applied P would reduce farmer costs as well as having environmental benefits. Enhancing the Al tolerance of selected species,
similarly, would also result in substantial benefits, particularly in
low input agricultural systems where the application of lime to correct
soil acidity is uneconomical. In the work of de la Fuente et al. (1997)
and López-Bucio et al. (2000) , the citrate synthase (CS) gene
from Pseudomonas aeruginosa was expressed in tobacco under
the control of the 35S cauliflower mosaic virus (35S CaMV) promoter.
This resulted in an increased internal citrate concentration of up to
10-fold compared with the control line not expressing the CS gene. The
increase in citrate efflux was somewhat less (up to 4-fold), and this
was attributed to saturation of the mechanism involved in transporting
citrate to the external medium.
In view of the potential benefits that enhanced citrate efflux can
confer to plants, we have attempted to verify these observations using
both transgenic tobacco plants that we generated as well as using some
of the CSb lines described by de la Fuente et al. (1997) . However,
despite at least a 100-fold greater expression of the P. aeruginosa CS protein in our lines compared with the best CSb
lines previously reported, we were unable to show either increased
internal citrate concentrations or increased citrate efflux from roots
above control plant levels. Characterization of the CSb lines similarly
failed to show any increases in either internal citrate concentrations
or citrate efflux above control plants.
 |
RESULTS AND DISCUSSION |
Characterization of Citrate Efflux from Roots of Wild-Type
Tobacco
To quantify citrate efflux from wild-type tobacco plants, we
immersed whole roots in aerated CaCl2 solution
for various times and analyzed the resulting solutions for organic
acids. Because Al has been shown to stimulate the efflux of organic
acids from a range of other plant species (Ma, 2000 ), we also assessed
the effect that Al had on organic acid efflux. In the absence of Al, low levels of organic acids were exuded from tobacco as determined by
either enzymatic or HPLC analysis. By contrast, exposure of whole roots
to Al stimulated the efflux of citrate (Fig.
1), and this efflux increased with
increasing concentrations of Al (data not shown). The use of excised
root segments showed that the majority of the citrate efflux was
localized to the terminal 6 mm of roots (Fig.
2A) and, similar to whole roots, the
efflux from root apices responded to the concentration of Al (Fig. 2B).
Al stimulates citrate efflux from roots of maize (Pellet et al., 1995 ),
triticale (Ma et al., 2000 ), and Cassia tora (Ma et al.,
1997a ), and in all of these cases there is a considerable lag phase
before maximal efflux is attained. Although whole roots of tobacco
showed a lower efflux over the first 3 h of Al exposure compared
with later times (Fig. 1), this lag phase was not as evident in excised
root tips particularly at the lower Al concentrations (Fig. 2B). The
kinetics of efflux resembled those observed for malate efflux from root apices of wheat (Ryan et al., 1995 ) and oxalate efflux from buckwheat roots (Ma et al., 1997b ). The absence of a clear lag-phase in tobacco
suggests that, like wheat and buckwheat, Al activates a pre-existing
transport system for organic acid release. Because some plant species
show enhanced organic acid efflux from roots under P deficiency in the
absence of Al (Gardner et al., 1983 ; Lipton et al., 1987 ; Hoffland et
al., 1992 ), the effect of P deficiency on efflux from tobacco roots was
also examined. However, citrate efflux from whole roots of tobacco was
not increased even when plants were grown to be severely P-deficient,
yet these same P-deficient plants still showed an Al-activated citrate
efflux (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 1.
Al-activated efflux of citrate from whole roots of
tobacco. Tobacco (cv Wisconsin 38) plants were grown for 11 d in
full nutrients, then transferred to either control solution ( Al; 0.2 mM CaCl2, pH 4.3) or Al solution
(+Al; 0.2 mM CaCl2 plus 50 µM Al, pH 4.3). Solutions were replaced at 3-h intervals,
and the citrate exuded by roots over this time interval was assayed and
the cumulative amounts of citrate exuded are shown for each time point.
The means of four replicate plants ± SE are
shown.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Figure 2.
A, Al-activated efflux of citrate from various
root segments of tobacco; B, the effect of Al concentration (0-50
µM) on citrate exuded over 9 h by 6-mm root apices.
The inset in B shows the relationship of citrate exuded over 9 h
to the Al concentration in solution. The root segments were washed in
control solution ( Al; 0.2 mM CaCl2,
pH 4.3) for 60 min before incubation with shaking in 1 mL of control
solution or control solution that contained Al at the concentrations
shown. Solutions were replaced at 3-h intervals and citrate exuded by
the root segments over this time interval was assayed and the
cumulative amounts of citrate exuded are shown for each time point. The
means of three replicate plants ± SE are shown.
|
|
Expression of Bacterial CS Genes in Tobacco
The coding region of the P. aeruginosa CS gene was
expressed in tobacco under the control of the 35S CaMV promoter. The
integrity of the gene was assessed in a number of ways. First,
sequencing confirmed that the P. aeruginosa coding region
generated by PCR translated into a predicted protein of identical amino
acid sequence to that published in GenBank (accession no. AAG04969). Second, expression of the P. aeruginosa coding region in the
Escherichia coli mutant W620, that is defective in the CS
gene (Guest, 1981 ), resulted in a high level of CS activity (1.3 µmol
min 1 mg 1;
n = 1; activity in the mutant without the CS gene was
below the limits of detection). Third, the binary vector containing the
CS gene under the control of the 35S CaMV promoter, which has a low
level of bacterial promoter activity, resulted in a low but measurable
CS activity when introduced into the W620 mutant. Finally the P. aeruginosa gene was amplified from genomic DNA of transgenic line
PA12 (see below) by PCR and expression of this PCR product in the W620
mutant yielded approximately the same activity as the initial CS clone
used to transform the tobacco (0.83 ± 0.35 µmol
min 1 mg 1,
n = 2 range shown). When this PCR product was
sequenced, it yielded an identical DNA sequence to the CS cDNA that was
originally introduced into the plant. Taken together these results
indicate that the P. aeruginosa CS gene expressed in line
PA12 was not adversely affected by the transformation procedure and
encoded a functional protein when expressed in E. coli.
Sixty-three primary (T0) tobacco transformants were analyzed for
expression of the P. aeruginosa CS gene (PA lines) by either western- or northern-blot analysis. Of these plants, 36 showed detectable levels of P. aeruginosa CS expression, and four
T0 lines encompassing a wide range of expression levels were selected for further analysis (lines P5, P12, P49, and P57; Fig.
3A). Expression of P. aeruginosa CS protein was also detected in the T1 or T2 generations of these PA lines but apart from line PA12, the level of
expression was lower than the corresponding T0 lines (Fig. 3B). The
levels of expression in all of the PA lines, whether they were T0, T1,
or T2, were greater than those apparent in either of the CSb lines
(Fig. 3). Western blots showed that the highest expressing PA line
(PA12) had over 100-fold greater levels of CS protein than the highest
expressing CSb line (CSb47) where the level of antigen was at or below
the limits of detection. The presence of the gene in lines CSb18 and
CSb47 was confirmed by Southern-blot analysis, and expression at the
mRNA level was detected in line CSb47 by northern-blot analysis (data
not shown). Line PA12 was exceptional in its level of expression of CS
protein and in leaves of plants grown in tissue culture, P. aeruginosa CS accumulated to up to 5% of the total soluble
protein. Most of the P. aeruginosa CS protein was localized
to the cytosol and in roots it comprised approximately 2% of the total
cytosolic protein of line PA12 (Fig. 3C).

View larger version (57K):
[in this window]
[in a new window]
|
Figure 3.
Expression of the P. aeruginosa CS gene
in a range of transgenic tobacco lines determined by western-blot
analysis. P. aeruginosa CS protein in leaf extracts of T0
plants from four different PA lines (A) and T1 or T2 lines originating
from these same four T0 lines (B). Included for comparison are the two
CSb lines and control (T2 lines in both A and B). Identity of samples
are: 1, P502 (control for PA lines); 2, PA5; 3, PA12; 4, PA49; 5, PA57;
6, CM1522 (control for CSb lines); 7, CSb18; 8, CSb47; and 9, 0.25 µg
pure P. aeruginosa CS. For A, 70 µg of protein was loaded
per lane except for PA12 where 35 µg was loaded. For B, 240 µg of
protein was loaded per lane except for PA12 where 20 µg was loaded.
C, P. aeruginosa CS protein in the mitochondrial (1, P502;
2, PA12) and cytosolic (3, P502; 4, PA12) fractions of root extracts
from lines PA12 and P502 (30 µg protein loaded per lane). Lane 5 is
0.5 µg of pure P. aeruginosa CS.
|
|
Two of the PA lines showed phenotypes that may have resulted from
expression of the foreign gene. Line PA49 consistently showed necrosis
of the leaf margins and had necrotic patches on leaves, which resulted
in misshapen leaves. Occasional plants of line PA12 had similar
necrotic patches on leaves but the phenotype was less severe than
apparent for line PA49.
Citrate Concentrations in Roots of Transgenic Tobacco
Of the parameters measured in the transgenic CSb lines by de la
Fuente et al. (1997) , the citrate concentration of roots was reported
to be affected the greatest. For example, CSb18 was reported to have
approximately a 10-fold greater citrate concentration in roots than the
control line and citrate concentrations increased in accordance with
increased expression of the P. aeruginosa CS gene. In direct
contrast to this finding, we were unable to find any effect of
expressing the bacterial CS gene in tobacco on citrate concentrations
of roots for any line including the CSb18 and CSb47 lines generated by
de la Fuente et al. (1997) (Fig. 4). Even
the PA lines, which showed the greatest levels of CS expression, had similar citrate concentrations to the control. Analysis of root citrate
concentrations of some of the T0 lines similarly showed no differences
to the control line (citrate concentrations of T0 lines as a percent of
the P502 control were: PA49, 118 ± 21; PA57, 87 ± 11; and
PA12, 115 ± 19; means ± SE,
n = 6). Root citrate concentrations were also
determined in selected lines when grown in a greenhouse (PA12 and
control), under low-light conditions (PA12 and control), or with a
nutrient solution based on one described by López-Bucio et al.
(2000) (CSb lines, high nitrate solution). In all cases, roots had
similar citrate concentrations to the control plants (data not shown).
Furthermore, de la Fuente et al. (1997) reported very high citrate
concentrations in roots that ranged from 0.4 to 4 M. This is in contrast to our values in the
sub-millimolar range, which are consistent with values reported by
Scheible et al. (1997) for tobacco roots grown with a low nitrate
supply. A continuously high concentration of nitrate supplied to
tobacco can enhance citrate accumulation by roots with concentrations
reaching approximately 3 mM (Scheible et al., 1997 ).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 4.
Citrate concentrations of roots from various
transgenic lines expressed as a percent of control lines. Plants were
grown for either 10 (CSb lines) or 11 d (PA lines) in hydroponic
culture after transfer from agar plates. Experiments were undertaken on
three different occasions and appropriate controls were included with
each set of lines. Citrate concentrations for P502 (control for PA
lines) ranged from 0.29 ± 0.01 mM to 0.56 ± 0.11 mM and was 0.30 ± 0.04 mM for CM1522
(control for CSb lines). The means of four replicate plants ± SE are shown. No statistically significant differences were
found for any line when means were compared with their relevant
controls as determined by a Student's t test.
|
|
Root CS Activity of Transgenic Tobacco Lines
Total CS activities measured in root extracts of the various
transgenic lines were not statistically different to the controls (Fig.
5A). Specific activities reported by de
la Fuente et al. (1997) and López-Bucio et al. (2000) ranged from
approximately 200 to 700 mg CoA min 1
mg 1 (equivalent to 260-900 µmol CoA
min 1 mg 1), which are in
excess of 1,000-fold greater than those reported here and greater than
activities reported for highly purified CS from a range of organisms
(Donald et al., 1989 ; Unger and Vasconcelos, 1989 ; Mitchell et al.,
1995 ; Ruijter et al., 2000 ). In the PA12 line, the majority of the
P. aeruginosa CS protein in roots was localized to the
cytosolic fraction (Fig. 3C). We reasoned that since most of the
endogenous CS activity is present in the mitochondria, an assay of the
cytosolic fraction should provide a more sensitive measure of the CS
activity resulting from expression of the bacterial gene. Increased CS
activity was observed in two of the PA lines (Fig. 5B), but CS activity
did not correlate with the level of protein expressed. Line PA49 had
the greatest CS activity but based on the western blot (Fig. 3B) had
considerably less P. aeruginosa CS protein than line PA12.
Consistent with the low level of CS expression in lines CSb18 and
CSb47, CS activities in the cytosolic fraction of both of these lines
were the same as the CM1522 control.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 5.
Total CS (A) and cytosolic CS (B) activities of
roots from various transgenic lines expressed as a percent of control
lines. Plants were grown for either 10 (CSb lines) or 11 d (PA
lines) in hydroponic culture after transfer from agar plates.
Experiments were undertaken on several different occasions, and
appropriate controls were included with each set of lines. Total CS
activities for P502 (control for PA lines) ranged from 73 ± 11 to
91 ± 8 nmol min 1
mg 1 protein and CM1522 (control for CSb lines)
had 77 ± 5 nmol min 1
mg 1 protein. Cytosolic CS activities for P502
ranged from 7.1 ± 1.2 to 8.6 ± 0.5 nmol
min 1 mg 1 protein and
was 5.7 ± nmol min 1
mg 1 protein for CM1522. The means of four or
three replicates ± SE are shown for each line and
values that are significantly different to the control line at
P < 0.01 as determined by a Student's t
test are denoted by **.
|
|
From the western blot described above, we estimated that the cytosolic
fraction of line PA12 contained approximately 2% of total protein as
P. aeruginosa CS (Fig. 3C). Pure CS from P. aeruginosa has been reported to have a specific activity of
approximately 3 µmol min 1
mg 1 protein when assayed at 20°C (Donald et
al., 1989 ) and, depending on the CS isoform, from 4 to 11 µmol
min 1 mg 1 protein when
assayed at 25°C (Mitchell et al., 1995 ). Therefore, we expected that
the activity of CS in the cytosolic fraction of line PA12 should be in
the order of 60 to 220 nmol min 1
mg 1 protein. However, CS activity for the PA12
cytosolic fraction when measured at 20°C was found to be 11.3 ± 0.7 nmol 1 min 1 mg
protein (mean ± SE; n = 4),
which indicates that only a small proportion of the total P. aeruginosa CS was active in this line. On the basis of these
results we suggest that the CS from P. aeruginosa is largely
inactive in plants when expressed at a high level and this might result
from incorrect folding of the protein or the formation of inactive
aggregates in the plant host. It is unlikely that the lower than
expected activity was associated with a mutation in the gene introduced
into line PA12 since, as discussed above, we were able to rescue a PCR
product from line PA12 that could express a functional CS enzyme in
E. coli. By contrast, the increase in CS activity over the
control found in the root cytosolic fraction of line PA49 was
consistent with all of the P. aeruginosa CS protein been
active suggesting that at lower levels of expression, most of the
protein remains functional in the plant. Similar calculations for the
CSb18 line indicate that, at the lower level of expression in this
line, the increase in CS activity in the cytosolic fraction would be
less than 0.5-fold even if all the P. aeruginosa CS were active. For total CS activity of root extracts (cytosolic plus mitochondrial), the increase would only be approximately 0.05-fold. We
conclude that the 3-fold enhancement in total root CS activity of line
CSb18 reported previously (de la Fuente et al., 1997 ) is either not due
to expression of the microbial gene or that some environmental factor,
not replicated in our work, is required to maximize activity. The gene
used to generate the transgenic CSb tobacco lines was a modified
version of the wild-type P. aeruginosa CS gene resulting in
an N-terminal truncation of the protein and this alteration may have
influenced both the expression and activity of the bacterial CS protein
(Herrera-Estrella, personal communication).
Citrate Efflux from Roots of Transgenic Tobacco Lines
The most important parameter in terms of enhancing P-nutrition and
Al tolerance is the efflux of organic acids from roots. In the absence
of Al, efflux was at or below the limits of detection for all lines
tested. As shown above (Figs. 1 and 2), Al activated the efflux of
citrate but there were no statistically significant differences in
Al-activated efflux from either whole roots or root apices between the
CS transgenic lines and their respective controls (Table
I). The CM1522 control line (tobacco cv
Xanthia) had approximately a 3-fold greater Al-activated efflux from
intact roots than the P502 control line (tobacco cv Wisconsin 38; Table I). However, this difference was not apparent when citrate efflux from
excised root apices was compared in these control lines (Table I). This
result suggests that the differences observed in intact roots may be
due to differences in root morphology between these lines. By contrast,
de la Fuente et al. (1997) reported a 4-fold increase in citrate efflux
from whole roots of CSb18 compared with the CM1522 control line. In
those experiments roots were incubated in water only and as such it
would be expected that only basal efflux, similar to that measured in
the absence of Al, would be observed. When we incubated roots of
tobacco in distilled water overnight, we found small amounts of citrate
exuded (at the limits of detection) that were comparable with those
obtained for roots incubated in CaCl2 over the
same period (data not shown).
There is evidence that overexpression of a plant gene encoding the
mitochondrial form of CS in Arabidopsis plants can enhance citrate
efflux with associated benefits in P-acquisition and Al tolerance
(Koyama et al., 2000 ). The highest expressing line had about a 3-fold
greater CS activity than controls and this was associated with an
increase of 1.6-fold in citrate exuded. Although the increase in
citrate efflux was small, it appeared to be sufficient to confer a
correspondingly small increase in Al tolerance. Carrot cells grown in
culture that overexpress a mitochondrial CS gene from Arabidopsis,
similarly, show enhanced citrate exudation (Koyama et al., 1999 ),
whereas mutant carrot cell lines selected for greater citrate exudation
had greater mitochondrial CS activity than wild-type cells (Takita et
al., 1999 ). Hoffland et al. (1992) also attributed the enhanced citrate
and malate efflux from roots of P-deprived Brassica napus
plants to greater activity of enzymes involved in organic acid
biosynthesis. These observations support the notion that enhanced
activity of enzymes involved in organic acid biosynthesis in plants can
alter metabolism and result in increased exudation of organic acids. By
contrast, overexpression in Aspergillus niger of its
mitochondrial CS gene did not increase internal citrate concentrations
or citrate exudation despite an increase CS activity of up to 11-fold
(Ruijter et al., 2000 ).
CS activity in a single 6-mm-long root apex from a wild-type
tobacco plant was estimated to be approximately 500 pmol
min 1 and citrate efflux from the same tissue
exposed to 50 µM Al to be approximately 3 pmol
min 1. Therefore, citrate efflux from root
apices in the presence of Al uses less than 1% of the endogenous CS
capacity. Even if only 10% of the cells of the root apex are involved
in supplying citrate for efflux, then this still represents less than
10% of the CS capacity. This suggests that CS activity is unlikely to
limit citrate efflux from root apices, a similar finding to that of Ruijter et al. (2000) who concluded that CS activity was not limiting the flow of metabolites toward citrate production in A. niger.
Al Tolerance of Transgenic Tobacco and Alfalfa Lines
Al tolerances of line PA12 and both CSb lines were assessed. Lines
PA12 and CSb18 did not show enhanced Al tolerance, whereas line CSb47
showed a small, yet statistically significant, increase in Al tolerance
at 25 µM Al but not at 50 µM Al when
compared with the CM1522 control (Fig.
6). The increase in Al tolerance observed
in CSb47 could not be attributed to increased citrate concentrations
(Fig. 4), resulting in enhanced citrate efflux (Table I). The increased
Al tolerance of this line may have resulted from somaclonal variation
that can occur during the transformation procedure used to generate
transgenic tobacco. These findings contrast with those of de la Fuente
et al. (1997) who showed increased Al tolerance of line CSb18 over the
control line for a range of Al concentrations. Al tolerance in
transgenic alfalfa (Medicago sativum) lines expressing the
P. aeruginosa CS protein was also assessed. Since alfalfa is
more sensitive of Al than tobacco, it provides a lower background to
test the effectiveness of transgenes to enhance Al tolerance. Although
expression of the CS protein was clearly apparent in two lines
(estimated at approximately 0.02% and 0.1% of total leaf protein for
lines CS34 and CS24, respectively), neither line showed enhanced Al
tolerance to 6 µM Al (Fig.
7).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 6.
Al tolerance of selected transgenic lines of
tobacco. Root elongations during exposure to Al are expressed as a
percent of root growth in the zero Al control solutions for the various
transgenic lines. The means ± SE are shown for 17 to
36 replicate seedlings of each line. Values for the transgenic lines
that are significantly different from the appropriate control lines at
P < 0.05 and P < 0.01 as determined
by a Student's t test are denoted by * and **,
respectively. Root elongations for the lines grown in the control
solution ( Al) over the same time interval used for Al exposure were
15.6 ± 0.5 mm for P502, 12.8 ± 0.7 mm for PA12, 14.9 ± 0.5 mm for CM1522, 13.6 ± 0.6 mm for CSb18, and 12.6 ± 0.5 mm for CSb47.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
Figure 7.
Al tolerance of transgenic lines of alfalfa. Root
elongations during exposure to 6 µM Al for 15 d are
expressed as a percent of root growth in the zero Al solutions for the
various transgenic lines. The means ± SE are shown
for six to eight replicate seedlings of each line. Root elongations for
the lines grown in the zero Al solution over the same time interval
used for Al exposure were 70 ± 8 mm for the control line, 59 ± 7 mm for line CS24, and 71 ± 9 mm for line CS34. The inset
shows the relative level of P. aeruginosa CS protein in the
transgenic lines (C = control line with plasmid only) as
determined by a western blot. Each lane contained 100 µg of total
leaf protein.
|
|
Concluding Remarks
Significant improvements in Al tolerance and P-nutrition were
previously reported for transgenic tobacco plants expressing a P. aeruginosa CS gene (de la Fuente et al., 1997 ; López-Bucio et al., 2000 ). These effects were attributed to increased production of
citrate and its subsequent efflux from roots. We have been unable to
replicate the previously reported differences in CS activity, internal
citrate, citrate efflux, and Al tolerance in these same CSb lines as
well as in newly developed transgenic lines that express the P. aeruginosa CS at up to a 100-fold greater level. This would
suggest that the activity of the P. aeruginosa CS in
transgenic tobacco is either sensitive to environmental conditions or
that the improvements in Al tolerance and P-nutrition observed
previously are due to some other variable. In any case, our results
indicate that the expression of the P. aeruginosa CS gene is
unlikely to be a robust and easily reproducible strategy for enhancing
the Al tolerance and P-nutrition of crop and pasture species.
 |
MATERIALS AND METHODS |
Plant Material
The transgenic tobacco (Nicotiana tabacum cv
Xanthia) lines CM1522 (control) and CSb18, previously described by de
la Fuente et al. (1997) , used the 35S CaMV promoter to drive the
Pseudomonas aeruginosa CS gene. Line CSb47 was produced
using the same binary construct and was identified as a line with
greater expression than CSb18 (L. Herrera-Estrella, personal
communication). The PA lines were generated in the cv Wisconsin 38 and
also used the 35S CaMV promoter to drive expression of the coding
region of the P. aeruginosa CS gene. Primary transgenic
lines were analyzed for expression by western blots to identify lines
with high levels of expression. Selected lines were grown in soil and
seed collected to generate T1 lines. These lines were either used
directly for experiments after selection on Murashige and Skoog
(Murashige and Skoog, 1962 ) agar plates that contained 100 µg
mL 1 kanamycin or were grown to produce the T2 generation
from which homozygous lines were identified (line PA12). Several lines
of alfalfa (CS lines; Medicago sativum cv Aquarius) were
also generated using the same binary constructs as was used for the PA
tobacco lines. These alfalfa lines were maintained as clonal explants.
Cloning and Preparation of Plasmid Constructs
The coding region of the P. aeruginosa CS gene
was amplified from genomic DNA with the primers
CGTGGATCCGATGGCTGACAAAAAAGC and
GTATCTAGATCAGCCGCGATCCTTG. Inclusion of
BamHI and XbaI restriction sites (shown
italicized) in the primers allowed the PCR products to be cloned into
the BamHI/XbaI site of the pDH51
expression cassette (Pietrzak et al., 1986 ), which contains the 35S
CaMV promoter and terminator. The resulting EcoRI
fragment that carried the CS gene was then introduced into the
EcoRI site of the binary vector pPLEX502, originally
described as pPLEX101 by Surin et al. (1998) , and this vector was used
to generate lines PA12 and PA5. For other lines (PA49 and PA57) the
pART7 expression cassette (Gleave, 1992 ) containing the 35S CaMV
promoter and octopine synthase terminator was used, and the
NotI fragment containing the CS gene, cloned into the
BamHI/XbaI site, was introduced into the
NotI site of pPLEX502. The binary vectors were
introduced into tobacco using Agrobacterium-mediated
transformation (Horsch et al., 1985 ). Alfalfa was transformed with the
same binary vectors using a procedure described by Tabe et al.
(1995) .
Plant Growth
Plants grown from seed were first selected for kanamycin
resistance on 0.4% (w/v) agar and after 20 to 30 d growth were
transferred to hydroponic culture in 2.2-L containers using methods
described previously for Arabidopsis (Delhaize and Randall, 1995 ). The
nutrient solution was as described by Delhaize et al. (1993) except
that 500 µM Ca(NO3)2 was replaced
with 500 µM CaCl2 and the pH adjusted to 4.3. When plants were used for citrate efflux, the K phosphate concentration
was reduced to 10 µM on the final day of growth to
prevent formation of Al phosphate complexes that may have reduced the
concentration of free Al in solution. For the cv Xanthia, nutrient
solution was changed after 7 and 9 d of growth and plants harvested on d 10. For the cv Wisconsin 38, nutrient solution was
changed after 8 and 10 d of growth and plants were harvested on d
11. Plants were grown in a controlled environment cabinet at constant
temperature (25°C) and photon flux density of approximately 500 µmol m 2 s 1 with a 16-h-light/8-h-dark
period. Some lines were also grown in (a) a glasshouse under natural
daylight where temperature varied between 18°C to 23°C and (b) in a
growth room under low intensity fluorescent light (approximately photon
flux density of 100 µmol m 2 s 1) at 22°C
to 25°C with a 12-h-light/12-h-dark period. The CSb lines were also
grown in the nutrient solution (solution J) described by
López-Bucio et al. (2000) . However, since this solution lacked Ca
as described by López-Bucio et al. (2000) , 3 mM
Ca(NO3)2 was included. Growth of seedlings was
initiated on the above low pH nutrient solution for 5 d then the
solution was replaced with one-quarter strength solution J and after an
additional 2 d of growth, finally replaced with one-half-strength
solution J and plants harvested 2 d later. For the analysis of T0
plants, clonal explants were propagated on Murashige and Skoog medium,
and six plants from each line were transferred to nutrient solution and grown for 7 d before analysis of root citrate concentrations.
Plant Analysis
For internal citrate concentrations, roots were excised, patted
dry between tissue paper, weighed, and then frozen in liquid nitrogen.
The frozen tissue was ground to a powder and extracted in 2 volumes of
0.6 M perchloric acid and neutralized with 2 M KOH before assay for citrate using an enzymatic procedure (Dagley, 1974 ). Some root samples were also extracted using 10 volumes of
ethanol at 80°C for 2 h and the resulting ethanol extracts assayed for citrate. Both types of analysis yielded similar values and
the perchloric extraction method was used for routine analyses. For
total CS assay, the frozen tissues were ground in liquid nitrogen, thawed into 2 volumes of buffer, and assayed for activity using previously described methods (Landschütze et al., 1995 ).
Cytosolic and mitochondrial fractions for CS assay were prepared from
fresh tissues as described by Landschütze et al. (1995) . CS
activities are expressed as nmol acetylCoA-hydrolyzed
min 1 mg 1 protein. Citrate efflux from whole
roots was determined by immersing the roots of one plant in 50 mL of
continuously aerated solution and the resulting solution was measured
for citrate by either enzymatic or HPLC methods. Organic acids were
analyzed by HPLC using an ion-exclusion column (IC-Pak, 7.8 × 300 mm, Waters, Milford, MA) and 13 mM
H2SO4 as the running solvent (1 mL
min 1) with UV detection at 214 nm. The solutions for
efflux experiments consisted of either 200 µM
CaCl2, pH 4.3, or the same solution with Al added as
AlCl3. To determine citrate efflux from excised root
segments, 20 root segments were incubated with shaking in 1 mL of
solution using procedures described previously for wheat (Ryan et al.,
1995 ) and the resulting solution assayed for citrate by the enzymatic
procedure. Proteins were extracted with the CS extraction buffer and
assayed using the method described by Bradford (1976) . An antibody
prepared against the P. aeruginosa CS (Donald et al.,
1989 ) was used to detect expression of the protein by western-blot
analysis using a second antibody conjugated to alkaline phosphatase
(Rerie et al., 1991 ). Samples were extracted for RNA using a method
described by Rerie et al. (1991) . Southern blots, northern blots, and
sequencing were undertaken using procedures described by Sambrook et
al. (1989) .
Al Tolerance
Al tolerance of tobacco was determined using a modification of a
procedure described by Toda et al. (1999) . Sixteen seeds were placed on
nylon mesh held up by slide mounts floating on 200 mL of nutrient
solution (as described above except K phosphate at 10 µM). After 7 d of growth in the absence of Al,
seedlings were thinned to obtain a uniform set and root lengths were
measured. Seedlings were then transferred to 2 L of aerated nutrient
solution that contained the Al treatment and after a further 7 (cv
Xanthia) or 8 (cv Wisconsin 38) d growth, root lengths were measured.
For alfalfa, clonally-propagated explants were grown in batches of 42 L
of aerated nutrient solution (10 or 11 plants per batch) of the same
composition as used for the tobacco experiments except that the pH was
maintained at 4.4 to 4.5. Root lengths were measured on the day of
transfer to hydroponic culture when treatments were imposed and 15 d later.
 |
ACKNOWLEDGMENTS |
We thank Dr. Luis Herrera-Estrella for making available the CSb
tobacco lines, CS antibodies, and purified CS protein. We thank Terese
Richardson for generating the transgenic alfalfa lines.
 |
FOOTNOTES |
Received September 22, 2000; returned for revision November 15, 2000; accepted December 29, 2000.
1
This work was supported by the Australian Grains
Research and Development Corporation.
*
Corresponding author; e-mail e.delhaize{at}pi.csiro.au; fax
61-2-6246-5000.
 |
LITERATURE CITED |
-
Bradford MM
(1976)
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72: 248-254
[CrossRef][Web of Science][Medline]
-
Dagley S
(1974)
Citrate, UV spectrophotometric determination.
In
HU Bergmeyer, ed, Methods of Enzymatic Analysis. Academic Press, New York, pp 1585-1589
-
de la Fuente JM, Ramírez-Rodríguez V, Cabrera-Ponce JL, Herrera-Estrella L
(1997)
Aluminum tolerance in transgenic plants by alteration of citrate synthesis.
Science
276: 1566-1568
[Abstract/Free Full Text]
-
Delhaize E, Craig S, Beaton CD, Bennet RJ, Jagadish VC, Randall PJ
(1993)
Aluminum tolerance in wheat (Triticum aestivum L.): I. Uptake and distribution of aluminum in root apices.
Plant Physiol
103: 685-693
[Abstract]
-
Delhaize E, Randall PJ
(1995)
Characterization of a phosphate-accumulator mutant of Arabidopsis thaliana.
Plant Physiol
107: 207-213
[Abstract]
-
Dinklaker B, Römheld V, Marschner H
(1989)
Citric acid excretion and precipitation of calcium citrate in the rhizosphere of white lupin (Lupinus albus L.).
Plant Cell Environ
12: 285-292
[CrossRef]
-
Donald L, Molgat G, Duckworth H
(1989)
Cloning, sequencing, and expression of the gene for NADH-sensitive citrate synthase of Pseudomonas aeruginosa.
J Bacteriol
171: 5542-5550
[Abstract/Free Full Text]
-
Gardner WK, Barber DA, Parbery DG
(1983)
The acquisition of phosphorus by Lupinus albus L.: III. The probable mechanism by which phosphorus movement in the soil/root interface is enhanced.
Plant Soil
70: 107-124
[CrossRef]
-
Gleave AP
(1992)
A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome.
Plant Mol Biol
20: 1203-1207
[CrossRef][Web of Science][Medline]
-
Guest J
(1981)
Hybrid plasmids containing the citrate synthase gene (gltA) of Escherichia coli K12.
J Gen Microbiol
124: 17-23
[Abstract/Free Full Text]
-
Hoffland E, Van Den Boogaard R, Nelemans J, Findenegg G
(1992)
Biosynthesis and root exudation of citric and malic acids in phosphate-starved rape plants.
New Phytol
122: 675-680
-
Horsch RB, Fry JE, Hoffman NL, Eichholtz D, Rogers SG, Fraley RT
(1985)
A simple and general method for transferring genes into plants.
Science
227: 1229-1231
[Abstract/Free Full Text]
-
Hue NV, Craddock GR, Adams F
(1986)
Effect of organic acids on aluminum toxicity in subsoils.
Soil Sci Am J
50: 28-34
[Abstract/Free Full Text]
-
Koyama H, Kawamura A, Kihara T, Hara T, Takita E, Shibata D
(2000)
Overexpression of mitochondrial citrate synthase in Arabidopsis thaliana improved growth on a phosphorus limited soil.
Plant Cell Physiol
41: 1030-1037
[Abstract/Free Full Text]
-
Koyama H, Takita E, Kawamura A, Hara T, Shibata D
(1999)
Over expression of mitochondrial citrate synthase gene improves the growth of carrot cells in Al-phosphate medium.
Plant Cell Physiol
40: 482-488
[Abstract/Free Full Text]
-
Landschütze V, Willmitzer L, Müller-Röber B
(1995)
Inhibition of flower formation by antisense repression of mitochondrial citrate synthase in transgenic potato plants leads to a specific disintegration of the ovary tissues of flowers.
EMBO J
14: 660-666
[Web of Science][Medline]
-
Lipton DS, Blanchar RW, Blevins DG
(1987)
Citrate, malate, and succinate concentration in exudates from P-sufficient and P-stressed Medicago sativa L. seedlings.
Plant Physiol
85: 315-317
[Abstract/Free Full Text]
-
López-Bucio J, Martínez de la Vega O, Guevara-García A, Herrera-Estrella L
(2000)
Enhanced phosphorus uptake in transgenic tobacco plants that overproduce citrate.
Nat Biotech
18: 450-453
[CrossRef][Web of Science][Medline]
-
Ma JF
(2000)
Role of organic acids in detoxification of aluminum in higher plants.
Plant Cell Physiol
41: 383-390
-
Ma JF, Taketa S, Yang ZM
(2000)
Aluminum tolerance genes on the short arm of chromosome 3R are linked to organic acid release in Triticale.
Plant Physiol
122: 687-694
[Abstract/Free Full Text]
-
Ma JF, Zheng SJ, Matsumoto H
(1997a)
Specific secretion of citric acid induced by Al stress in Cassia tora L.
Plant Cell Physiol
38: 1019-1025
[Abstract/Free Full Text]
-
Ma JF, Zheng SJ, Matsumoto H, Hiradate S
(1997b)
Detoxifying aluminum with buckwheat.
Nature
390: 569-570
[Medline]
-
Mitchell CG, Anderson SCK, El-Mansi EMT
(1995)
Purification and characterization of citrate synthase isoenzymes from Pseudomonas aeruginosa.
Biochem J
309: 507-511
-
Murashige T, Skoog F
(1962)
A revised medium for a rapid growth and bioassay with tobacco tissue culture.
Physiol Plant
15: 473-497
[CrossRef]
-
Pellet DM, Grunes DL, Kochian LV
(1995)
Organic acid exudation as an aluminum tolerance mechanism in maize (Zea mays L.).
Planta
196: 788-795
[CrossRef][Web of Science]
-
Pietrzak M, Shillito RD, Hohn T, Potrykus I
(1986)
Expression in plants of two bacterial antibiotic resistance genes after protoplast transformation with a new plant expression vector.
Nucleic Acids Res
14: 5857-5868
[Abstract/Free Full Text]
-
Rerie WG, Whitecross M, Higgins TJV
(1991)
Developmental and environmental regulation of pea legumin genes in transgenic tobacco.
Mol Gen Genet
225: 148-157
[Web of Science][Medline]
-
Ruijter G, Panneman H, Xu D-B, Visser J
(2000)
Properties of Aspergillus niger citrate synthase and effects of citA overexpression on citric acid production.
FEMS Lett
184: 35-40
-
Ryan PR, Delhaize E, Randall PJ
(1995)
Characterization of Al-stimulated malate efflux from the root apices of Al-tolerant genotypes of wheat.
Planta
196: 103-110
[Web of Science]
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed.. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Scheible W-R, González-Fontes A, Lauerer M, Müller-Röber B, Caboche M, Stitt M
(1997)
Nitrate acts as a signal to induce organic acid metabolism and repress starch metabolism in tobacco.
Plant Cell
9: 783-798
[Abstract]
-
Surin B, Boevink P, Keese P, Chu P, Larkin P, Llewellyn D, Kahn R, Ellacott G, Waterhouse P
(1998)
A suite of promoters and terminators for plant biotechnology.
In
PJ Larkin, ed, Proceedings of the 4th Asia-Pacific Conference on Agricultural Bio/Technology. Canberra UTC Publishing, Darwin, pp121-122
-
Tabe LM, Wardley-Richardson T, Ceriotti A, Aryan A, McNabb W, Moore A, Higgins TJV
(1995)
A biotechnological approach to improving the nutritive value of alfalfa.
J Anim Sci
73: 2752-2759
[Abstract]
-
Takita E, Koyama H, Hara T
(1999)
Organic acid metabolism in aluminum-phosphate utilizing cells of carrot (Daucus carota L.).
Plant Cell Physiol
40: 489-495
[Abstract/Free Full Text]
-
Toda T, Koyama H, Hara T
(1999)
A simple hydroponic culture method for the development of a highly viable root system in Arabidopsis thaliana.
Biosci Biotechnol Biochem
63: 210-212
[CrossRef][Medline]
-
Unger EA, Vasconcelos AC
(1989)
Purification and characterization of mitochondrial citrate synthase.
Plant Physiol
89: 719-723
[Abstract/Free Full Text]
-
von Uexküll HR, Mutert E
(1995)
Global extent, development and economic impact of acid soils.
Plant Soil
171: 1-15
[CrossRef]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
A. Sienkiewicz-Porzucek, A. Nunes-Nesi, R. Sulpice, J. Lisec, D. C. Centeno, P. Carillo, A. Leisse, E. Urbanczyk-Wochniak, and A. R. Fernie
Mild Reductions in Mitochondrial Citrate Synthase Activity Result in a Compromised Nitrate Assimilation and Reduced Leaf Pigmentation But Have No Effect on Photosynthetic Performance or Growth
Plant Physiology,
May 1, 2008;
147(1):
115 - 127.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. YANG, L. ZHANG, Y. Y. LI, J. F. YOU, P. WU, and S. J. ZHENG
Citrate Transporters Play a Critical Role in Aluminium-stimulated Citrate Efflux in Rice Bean (Vigna umbellata) Roots
Ann. Bot.,
April 1, 2006;
97(4):
579 - 584.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Yang, S. J. Zheng, Y. F. He, and H. Matsumoto
Aluminium resistance requires resistance to acid stress: a case study with spinach that exudes oxalate rapidly when exposed to Al stress
J. Exp. Bot.,
April 1, 2005;
56(414):
1197 - 1203.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Delhaize, P. R. Ryan, D. M. Hebb, Y. Yamamoto, T. Sasaki, and H. Matsumoto
Engineering high-level aluminum tolerance in barley with the ALMT1 gene
PNAS,
October 19, 2004;
101(42):
15249 - 15254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. HAMMOND, M. R. BROADLEY, and P. J. WHITE
Genetic Responses to Phosphorus Deficiency
Ann. Bot.,
September 1, 2004;
94(3):
323 - 332.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Ermolayev, W. Weschke, and R. Manteuffel
Comparison of Al-induced gene expression in sensitive and tolerant soybean cultivars
J. Exp. Bot.,
December 1, 2003;
54(393):
2745 - 2756.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kihara, T. Wada, Y. Suzuki, T. Hara, and H. Koyama
Alteration of Citrate Metabolism in Cluster Roots of White Lupin
Plant Cell Physiol.,
September 15, 2003;
44(9):
901 - 908.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. M. Anoop, U. Basu, M. T. McCammon, L. McAlister-Henn, and G. J. Taylor
Modulation of Citrate Metabolism Alters Aluminum Tolerance in Yeast and Transgenic Canola Overexpressing a Mitochondrial Citrate Synthase
Plant Physiology,
August 1, 2003;
132(4):
2205 - 2217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Hayes and J. F. Ma
Al-induced efflux of organic acid anions is poorly associated with internal organic acid metabolism in triticale roots
J. Exp. Bot.,
July 1, 2003;
54(388):
1753 - 1759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Kobayashi and H. Koyama
QTL Analysis of Al Tolerance in Recombinant Inbred Lines of Arabidopsis thaliana
Plant Cell Physiol.,
December 15, 2002;
43(12):
1526 - 1533.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sasaki, B. Ezaki, and H. Matsumoto
A Gene Encoding Multidrug Resistance (MDR)-Like Protein is Induced by Aluminum and Inhibitors of Calcium Flux in Wheat
Plant Cell Physiol.,
February 1, 2002;
43(2):
177 - 185.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tesfaye, S. J. Temple, D. L. Allan, C. P. Vance, and D. A. Samac
Overexpression of Malate Dehydrogenase in Transgenic Alfalfa Enhances Organic Acid Synthesis and Confers Tolerance to Aluminum
Plant Physiology,
December 1, 2001;
127(4):
1836 - 1844.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Ezaki, M. Katsuhara, M. Kawamura, and H. Matsumoto
Different Mechanisms of Four Aluminum (Al)-Resistant Transgenes for Al Toxicity in Arabidopsis
Plant Physiology,
November 1, 2001;
127(3):
918 - 927.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|