|
Plant Physiol, April 2001, Vol. 125, pp. 2104-2119
Differential Regulation of a Family of Apyrase Genes from
Medicago truncatula1
Jonathan R.
Cohn,
Taesik
Uhm,
Senthil
Ramu,
Yong-Woo
Nam,
Dong-Jin
Kim,
R. Varma
Penmetsa,
Todd C.
Wood,
Roxanne L.
Denny,
Nevin D.
Young,
Douglas R.
Cook, and
Gary
Stacey*
Center for Legume Research, Department of Microbiology, University
of Tennessee, Knoxville, Tennessee 37996 (J.R.C., G.S.); Department of
Plant Pathology and Microbiology, Texas A&M University, College
Station, Texas (T.U., S.R., Y.-W.N., D.-J.K., R.V.P., D.R.C.); Clemson
University Genomics Institute, Clemson University, Clemson, South
Carolina (T.C.W.); and Departments of Plant Pathology (R.L.D., N.D.Y.)
and Plant Biology (N.D.Y.), University of Minnesota, Minneapolis,
Minnesota 55108
 |
ABSTRACT |
Four putative apyrase genes were identified from the model legume
Medicago truncatula. Two of the genes identified from
M. truncatula (Mtapy1 and Mtapy4) are
expressed in roots and are inducible within 3 h after inoculation
with Sinorhizobium meliloti. The level of mRNA
expression of the other two putative apyrases, Mtapy2
and Mtapy3, was unaffected by rhizobial inoculation.
Screening of a bacterial artificial chromosome library of M.
truncatula genomic DNA showed that Mtapy1,
Mtapy3, and Mtapy4 are present on a
single bacterial artificial chromosome clone. This apyrase cluster was
mapped to linkage group seven. A syntenic region on soybean linkage
group J was found to contain at least two apyrase genes. Screening of
nodulation deficient mutants of M. truncatula revealed
that two such mutants do not express apyrases to any detectable level.
The data suggest a role for apyrases early in the nodulation response
before the involvement of root cortical cell division leading to the
nodule structure.
 |
INTRODUCTION |
Apyrases are enzymes that have the
ability to hydrolyze nucleotide tri- and diphosphates to nucleotide
monophosphates (Komoszynski and Wojtczak, 1996 ). Apyrases have been
identified in almost all organisms investigated and have been proposed
to function in very diverse roles, including blood platelet aggregation
(Marcus and Safier, 1993 ), neurotransmission (Sarkis and Salto, 1991 ;
Edwards and Gibb, 1993 ), protein glycosylation (Abeijon et al., 1993 ; Gao et al., 1999 ), and phosphate metabolism (Thomas et al., 1999 ). Apyrases can be classified as endoapyrases, enzymes that act
intracellularly, and as ectoapyrases, enzymes that have their catalytic
domain outside the cell. One function proposed for apyrases in animals is the regulation of blood platelet aggregation. Ectoapyrases present
in the saliva of many insects that feed on blood can prevent blood
platelet aggregation directly by decreasing the ADP concentration in
damaged tissues (Marcus and Safier, 1993 ; Komoszynski and Wojtczak, 1996 and refs. therein). It is normal that the concentration of ADP in
the extracellular space increases in response to damage. ADP is then
able to bind to P2 purinergic receptors on
platelets, causing their concomitant aggregation (Komoszynski, and
Wojtczak, 1996 ). Apyrases found in animal cells have also been proposed to function in neurotransmission by interacting indirectly with P2 purinoreceptors (Edwards and Gibb, 1993 ).
These receptors have a high affinity for ATP and ADP, but a much lower
affinity for AMP. Ectoapyrases present in synaptic membranes are
thought to degrade ATP in the synaptic space (Sarkis and Salto, 1991 ).
As the pool of ATP is hydrolyzed to AMP, the receptor is released and
its stimulation is broken (Komoszynski and Wojtczak, 1996 ). In
addition, apyrase effects on the ATP + ADP/AMP ratio modulate the
action of 5'-nucleotidase, an enzyme that is abundant in the synaptic
space. This enzyme is inhibited by ATP and ADP, but is activated by AMP.
Two endoapyrases, GDA1 and YND1, identified in Saccharomyces
cerevisiae are postulated to regulate protein glycosylation in the
Golgi (Abeijon et al., 1993 ; Gao et al., 1999 ). These apyrases control
the turn over of GDP arising from hydrolysis of GTP sugars. In support
of this hypothesis, a yeast strain that is defective in the production
of GDA1 and YND1 was found to grow very slowly and exhibited defects in
cell wall integrity and protein glycosylation (Gao et al.,
1999 ).
Apyrases identified in plants have been implicated to play functional
roles in a variety of different systems. For example, an apyrase
purified from pea nuclei was originally reported to be involved in
phytochrome responses (Chen and Roux, 1986 ; Chen, et al., 1987 ).
Enzymatic activity of this protein was stimulated by
Ca2+/calmodulin. This pea NTPase was more
recently reported to play a role in mediating the uptake of phosphate
from the extracellular matrix (Thomas et al., 1999 ). The pea apyrase
has been found not only in nuclei, but also in the plasma membrane.
Transgenic Arabidopsis plants expressing the pea apyrase showed
enhanced growth compared with the wild type and could utilize exogenous
ATP as a source of inorganic phosphate (Thomas et al., 1999 ). It has
been postulated that an apyrase isolated from potato is involved in
starch biosynthesis (Handa and Guidotti, 1996 ).
A recent report indicated that an apyrase purified from the roots of
the legume Dolichos biflorus, lectin nucleotide
phosphohydrolase (LNP), bound to the lipo-chitin nodulation signals
produced by Bradyrhizobium spp. (Etzler et al., 1999 ). These
lipo-chitin signals are essential for nodulation and trigger the
de novo organogenesis of the root nodule (for review, see Cohn et al.,
1998 ). The D. biflorus apyrase showed highest affinity for
the Nod signals produced by Bradyrhizobium japonicum and
Rhizobium spp. NGR234, bacteria that are able to nodulate
D. biflorus. LNP was localized by immunofluorescence to the
surface of the root hairs, the primary site of rhizobial infection.
Binding of Nod signals to LNP stimulated ATPase activity. Two apyrases
have recently been characterized in soybean, one of which is
transcriptionally activated by rhizobia (Day et al., 2000 ). The protein
product of this gene, GS52, was immunolocalized to Suc gradient
fractions enriched in plasma membrane, suggesting that this protein is
plasma membrane associated. In addition, pretreatment of roots with
antiserum raised against LNP or GS52 inhibited the ability of rhizobia
to nodulate D. biflorus or soybean, respectively (Etzler et
al., 1999 ; Day et al., 2000 ). These data, taken together, suggest that
LNP and GS52, an orthologous protein from soybean, are promising
candidates for Nod signal receptors involved in the nodulation response.
Due to their postulated role in nodulation and possible importance to
plant metabolism we initiated a study to characterize the apyrase genes
found in Medicago truncatula. This plant has been proposed
as a model for the genetic study of legumes and is currently the
subject of intensive investigation (Barker et al., 1990 ; Cook, 1999 ).
Using primers designed from conserved apyrase motifs, four unique
apyrase cDNAs were isolated from M. truncatula. Genetic
mapping analysis indicated that at least three of these genes share
synteny with apyrase genes characterized in soybean. To our knowledge,
this is the first report of synteny between soybean and M. truncatula. Analysis of mRNA expression indicated that M. truncatula apyrases are differentially expressed in various
tissues. Two of these genes are rapidly induced upon rhizobial
inoculation, similar to the expression pattern of a group of genes that
have been postulated to be involved in the nodulation process, i.e.
early nodulins (ENODs). Proteins that are specifically expressed during
nodulation have been termed nodulins. ENODs are expressed within
48 h after rhizobial inoculation. The rapid accumulation of
apyrase mRNA in response to rhizobia classifies these apyrases as
ENODs. Consistent with the possibility that these genes play an
important role in nodulation, apyrase expression was dramatically
reduced in nodulation deficient mutant lines of M. truncatula.
 |
RESULTS |
Identification of a cDNA Encoding a Putative Apyrase
Gene
An M. truncatula cDNA was identified by
touch-down-PCR (TD-PCR) using primers designed from conserved domains
found in a variety of apyrases (Fig. 1).
The 850-bp fragment obtained by TD-PCR was extended using 3'- and
5'-RACE (Frohman et al., 1988 ) to yield a full-length cDNA sequence.
One of the clones generated was designated plasmid pJRC63, which
contains the full-length Mtapy1 cDNA.

View larger version (67K):
[in this window]
[in a new window]
|
Figure 1.
Amino acid sequence comparison of
Mtapy1 with other known apyrase proteins. The boxed regions
represent the four conserved apyrase domains. See text for
details.
|
|
The sequence of Mtapy1 (GenBank accession no. AF288132)
predicts an open reading frame of 466 amino acids, encoding a protein with a calculated molecular mass of 51,600. Hydropathy analysis of the predicted protein sequence indicated that Mtapy1 has
a single strong transmembrane helix of 20 amino acids at the N terminus (data not shown). This transmembrane region was also predicted to be a
cleavable N-terminal signal sequence according to the methods of von
Heijne et al. (1986 ; Emanuelsson et al., 2000 ).
Comparison of the sequence of Mtapy1 with other genes in the
nonredundant National Center for Biotechnology Information protein sequence database using a BLASTP search identified several possible orthologs (Altschul et al., 1997 ). We also identified possible orthologous genes using a dbEST search (Pearson et al., 1997 ). Alignment of Mtapy1 with the sequence of other known genes
in the database revealed that Mtapy1 contained all four of
the putative conserved apyrase domains (Fig. 1; Handa and Guidotti,
1996 ).
Mtapy1 Is Induced Rapidly in Response to
Sinorhizobium meliloti Inoculation
Since the D. biflorus apyrase has been implicated in
nodulation (Etzler et al., 1999 ), northern-blot analysis was
used to see if the level of apyrase mRNA significantly increased upon rhizobial inoculation. We performed a time course of expression of
Mtapy1 using total RNA isolated from roots of wild-type
M. truncatula line A17 inoculated with S. meliloti strain ABS7M. As seen in Figure
2, Mtapy1 mRNA accumulated
significantly in response to S. meliloti within 3 h
after inoculation.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 2.
Northern blot showing the expression of
Mtapy1 in response to inoculation with S. meliloti wild-type strain ABS7M (top). Total
RNA was isolated from roots inoculated 0, 0.5, 1, 2, 3, 4, 5, and
6 h after inoculation with bacteria. Blots were also probed with
Histone H3 as an RNA loading control (bottom). Each lane was loaded
with RNA isolated from approximately 0.2 g of root tissue. See
text for details.
|
|
Identification of a Second Putative Apyrase Gene from M. truncatula
A search of the dbEST sequence database using the
Mtapy1 sequence identified a distinct apyrase from
a cDNA library made from M. truncatula root hair
tissue (Covitz et al., 1998 ; GenBank accession no. AA660474). Using the
sequence in the database, primers were designed and used in a reverse
transcriptase- (RT) PCR reaction to clone the corresponding cDNA. This
approach yielded a plasmid JRC201 containing a partial cDNA clone of
430 bp. DNA sequence analysis revealed that this PCR fragment was
identical to the sequence found in the dbEST database, but distinct
from Mtapy1. Therefore, this apyrase cDNA was designated
Mtapy2. Sequence analysis was also confirmed by the
identification of a second expressed sequence tag (EST) sequence from a
different EST library (dbEST accession no. AI974272). This EST clone,
pKV01 M6, was kindly provided by Dr. Kate
VandenBosch (Texas A&M University, College Station) and the clone was
sequenced. The overlapping regions in this sequence and the original
EST sequence (accession no. AA660474) indicated that they represent the
same gene, namely, Mtapy2. The additional sequence
information was critical for subsequent phylometric analyses.
M. truncatula Linkage Group 7 Contains an Apyrase Gene
Cluster
Mtapy1 was used as a probe to screen a M. truncatula bacterial artificial chromosome (BAC) library (Nam et
al., 1999 ). Two hybridizing BAC clones, 52G10 and 58 M19, were isolated and confirmed by Southern-blot
hybridization (data not shown). As shown in Figure 3, a larger region of contiguous BAC DNA
was identified by PCR amplification of the BAC library multiplex using
oligonucleotide primers designed from BAC sequence information. Taken
together, DNA sequencing of BAC ends or internal sequencing with
Mtapy1 primers identified five putative genes in this
region, and two retrotransposon-like sequences (Fig. 3; Table
I). Additional sequence information for
the five predicted genes was obtained by a primer walking strategy on
purified BAC DNA or on subcloned BAC DNA fragments. As shown in Table
I, three of these predicted genes have their highest homology to
characterized apyrase genes from legumes. One of these genes was
verified as Mtapy1, based on sequence identity, whereas the
other two were distinct from Mtapy2 and were designated as
Mtapy3 and Mtapy4. The advent of numerous
M. truncatula EST sequences in the National Center for Biotechnology Information GenBank allowed the immediate verification of
Mtapy3 and a thioredoxin-like sequence as transcribed
genes. For Mtapy4 a combination of RT-PCR and 3'-RACE was
used to isolate a 1,017-bp cDNA PCR product (GenBank accession no.
AF288133) that was identical to sequenced regions of the
Mtapy4 genomic clone. Thus, the BAC contig shown in Figure 3
contains a minimum of three apyrase genes with high homology to other
legume arpyases. Similar, but less extensive analysis was conducted
with Mtapy2. In brief, a single BAC clone designated 20K21
was identified by means of hybridization to high-density filter arrays.
BAC end sequencing of 20K21 revealed the presence of a putative gene
with best protein homology to NADPH quinone reductase (Table
I).

View larger version (11K):
[in this window]
[in a new window]
|
Figure 3.
BAC contig map of a region containing a cluster of
apyrase genes. The map indicates the location of the Mtapy1,
Mtapy3, and Mtapy4. The BAC map indicates at least five
genes present in this region, including a putative TFL1 ortholog and
thioredoxin. Two retrotransposon-like sequences were also identified in
this region. The genetic markers 58T and 6T are also present in the
contiguous region surrounding the apyrase cluster, which were useful in
mapping the cluster on the M. truncatula genome.
|
|
Genetic Mapping of Apyrases
To determine the genetic map position of the apyrase cluster
(Mtapy1, Mtapy3, and Mtapy4) and of
Mtapy2, codominant PCR-based cleaved amplified polymorphic
sequence (CAPS) markers were developed. In brief, BAC end sequence
information from BACs 6L13 and 58 M19 (corresponding to the apyrase cluster) and from BAC 20K21
(corresponding to Mtapy2) was used to design oligonucleotide
primers. PCR amplification and sequencing of genomic DNA from M. truncatula mapping genotypes A17 and A20 allowed the development
of three CAPS markers, as detailed in Table
II. As shown in Figure
4, analysis of these CAPS markers on the
basic mapping population of 93 F2 individuals indicated that the apyrase cluster maps to M. truncatula
linkage group 7, whereas Mtapy2 maps to linkage group
4.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 4.
Genetic maps of apyrases from M. truncatula. The maps indicate that the apyrase cluster, including
at least Mtapy1, Mtapy3, and Mtapy4 is
located on linkage group (MtLG) 7 based on analysis of the
map positions of the 58T marker. Mtapy2 was determined to be
located on linkage group 4 based on 6T genetic CAPS marker developed
from sequence analysis of the BAC clone 20K21. An apyrase cluster was
also found on soybean linkage group J (Gm LG-J), based on analysis of
the map positions of two apyrases identified in soybean (i.e. GS50 and
GS52; Day et al., 2000 ). The apyrase cluster in soybean is closely
linked to the B046 RFLP marker, which is orthologous to the 58T/6T
marker in M. truncatula. Thus, the B046 homology is tightly
linked to an apyrase cluster in M. truncatula and soybean.
These data are suggestive of conserved synteny between the two genomes
and are consistent with close ancestry of these two apyrase gene
clusters.
|
|
The position of the M. truncatula apyrase markers is
shown relative to selected core markers on these linkage groups (D.-J. Kim and D.R. Cook, personal communication). Because several of the M. truncatula core markers were developed based on
homology to mapped restriction fragment-length polymorphism (RFLP)
clones from soybean genetic map
(http://ars-genome.cornell.edu/cgi-bin/WebAce/webace?db=3Dsoybase; D.-J. Kim and D.R. Cook, unpublished data), it is
possible to identify putative syntenic relationships between the
M. truncatula and soybean genomes. One such marker
designated DK427-R maps in close proximity to the apyrase cluster
marker 58T (Fig. 4). MtDK427 has homology to soybean RFLP clone B046,
the sequence of which (GenBank accession no. AQ841833) is similar to an
EST from cotton (GenBank accession no. AI727823). In soybean, B046 maps to two loci, including marker B046b on soybean linkage group J. To
ascertain if the M. truncatula apyrase cluster might share a
conserved genome context with previously identified soybean apyrase
genes (Day et al., 2000 ) we conducted a similar analysis with soybean
apyrase genes GS50 and GS52. In brief, a total of nine soybean BAC
clones in three soybean contigs were identified. Two of these contigs
were positive for GS50 and GS52. One of these contigs could be assigned
to a previously described locus on soybean LG-J (Day et al., 2000 )
based on its restriction fragment pattern. The map locations of the
other two apyrase-associated contigs in soybean were not determined. It
is significant that the apyrase locus on soybean LG-J lies in close
proximity to RFLP marker B046, just as in M. truncatula.
Moreover, this contig contains at least two hybridizing fragments, one
showing homology to GS50 only and a second with homology to GS50 and
GS52, indicating a possible apyrase cluster. Thus, the B046 homology is
tightly linked to an apyrase cluster in M. truncatula and
soybean. These data are suggestive of conserved synteny between the two
genomes, and are consistent with close ancestry of these two apyrase
gene clusters.
Phylogenetic Analysis of Apyrases
A recent report indicated that plant apyrases are separated into
two distinct families based on phylogenetic studies (Roberts et al.,
1999 ). It was suggested that LNP-like genes from a number of different
sources were members of a distinct class of apyrases that may be unique
to legumes. We performed a similar phylogenetic analysis with the
apyrase sequences from M. truncatula by aligning 16 partial
sequences of putative plant apyrases, and a yeast protein, GDA1. One
additional EST sequence of a putative apyrase from M. truncatula (MtEST, accession no. AJ388942) that is distinct from
Mtapy1, Mtapy2, Mtapy3, and
Mtapy4 was included in the phylogenetic analysis. A
neighbor-joining tree generated from this alignment shows that there
appear to be at least five subfamilies of apyrases found in plants
(Fig. 5). Subfamily 1 contains
Mtapy1, Mtapy3, Mtapy4, and the newly
identified MtEST. This subfamily also includes the pea
NTPase, LNP from D. biflorus, and GS52, a recently
identified apyrase from soybean (Day et al., 2000 ). Subfamily 2 consists of Mtapy2, an apyrase from Arabidopsis, and an EST
identified in cotton (GhEST). Subfamily 3 consists of a second apyrase
isolated from soybean, GS50 (Day et al., 2000 ), and a second apyrase
from D. biflorus that was identified subsequently to DbLNP
(Roberts et al., 1999 ). Subfamily 4 consists of the potato apyrase
(Handa and Guidotti, 1996 ) and a tomato EST (LeGl1). Subfamily 5 consists of a single gene represented by an EST identified in rice
(OsEST) (GenBank accession no. AU065811). These results support the earlier results of Roberts et al. (1999) , indicating that LNP from
D. biflorus is a member of distinct family of apyrases that are present only in legumes. It is quite interesting that
Mtapy1, Mtapy3, and Mtapy4, which are
all clustered in the M. truncatula genome, are all members
of this apyrase family. It is possible that these genes arose from
duplication events during the evolution of M. truncatula.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 5.
Neighbor-joining tree representing alignment
of apyrases from selected sources. Sixteen partial sequences of plant
apyrases and the yeast protein GDA1 were aligned for analysis. The
apyrases fall into five distinct subfamilies. Mtapy1, Mtapy3,
Mtapy4, a newly identified EST from M. truncatula,
MtEST (GenBank accession no. AJ388942), LNP (accession no. AF139807),
and GS52 (accession no. AF207688; Day et al., 2000 ) fall into the first
class. Mtapy2 was found to fall into subfamily 2, along with
an Arabidopsis apyrase (accession no. AF156783; the second Arabidopsis
apyrase [accession no. AF141671] falls in a similar position, not
shown), and an EST from cotton, GhEST (accession no. AI729322).
Additional sequences include G. soja GS50 (accession no.
AF207687; Day et al., 2000 ), D. biflorus Dbapyrase
(accession no. AF156781), potato apyrase (accession no. U58597), tomato
EST cLED13N21 (accession no. AI488720), rice OsEST, (accession no.
AU065811), and the S. cerevisiae GDA1 (accession no.
6320793).
|
|
A further phylogenetic analysis was performed with the apyrases from
M. truncatula to study their evolutionary relationships. To
infer the phylogeny of the Mtapy genes, amino acid sequences of deduced LNP proteins were aligned to the amino acid sequences of
Mtapy1-4 using CLUSTALW (Thompson et al., 1994 ). An apyrase from Arabidopsis was also included in the alignment as an out-group. The results of this analysis showed that Mtapy1,
Mtapy3, and Mtapy4 all group together with the
LNP sequences, whereas Mtapy2 is more closely related to the
out-group apyrase from Arabidopsis (Fig. 6). The appearance of multiple copies of
M. truncatula apyrase sequences in the LNP clade
strongly implies that gene duplication may be an ongoing phenomenon in
this apyrase subfamily. To confirm this, a neighbor-joining phylogeny
from rbcL sequences was constructed of closely related
species (Fig. 6). The results showed that the topology of the two trees
is not the same. Whereas the rbcL tree shows a substantial
divergence between Lotus/Glycine/Vigna and Pisum/Medicago (bootstrap support 93%), the LNP clearly
shows the Glycine soja sequence GS52 as the only outgroup
(bootstrap support 100%). In the rbcL tree Lotus
is a sister taxon to the Glycine/Vigna clade, but in the LNP
phylogeny, the Lotus sequence LjLNP is a sister
taxon to a clade formed of three Medicago sequences (Mtapy1, Mtapy3, and Mtapy4) and the
Pisum sequence PsLNP. The conflicts between the
rbcL and LNP trees can be explained as the result of gene
transfer or multiple LNP paralogues that have not yet been sequenced.
Because the LNP tree clearly shows three Medicago LNP
paralogues (Mtapy1, Mtapy3, and Mtapy4),
undiscovered paralogues in other legume species would be the preferred
explanation over gene transfer.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 6.
The evolution of the LNP proteins has been
markedly different from the evolution of the rbcL sequences from
closely related species. LNP protein phylogeny (left) was inferred by
the neighbor-joining method using a 188-amino acid alignment of LNP
proteins out-grouped using the apyrase from Arabidopsis (accession no.
AF156783; identical results were obtained using a second Arabidopsis
apyrase [accession no. AF141671], not shown). Sequences shown are
Mtapy2 (this study), GS52 (Day et al., 2000 ), D. biflorus LNP (accession no. AF139807), Lotus japonicus
LNP (accession no. AF156780), Mtapy4 (this study), pea LNP (accession
no. Z32743), and Mtapy1 and Mtapy3 (this study). RbcL DNA phylogeny
(right) was also inferred by the neighbor-joining method using a
1,310-nucleotide alignment of rbcL DNA sequences out-grouped using the
rbcL of Arabidopsis (accession no. U91966). Other sequences shown are
from Lotus corniculatus (accession no. U74213), soybean
(accession no. Z95552), cowpea (accession no. Z95543), pea (accession
no. X03853), and alfalfa (accession no. X04975). Bootstrap values out
of 100 bootstrap replicates are shown at nodes of both trees.
|
|
MtApy1 and Mtapy4 Are Transiently Induced
after Inoculation with S. meliloti
Due to the high degree of sequence similarity shared between the
apyrases identified in M. truncatula, we wanted to identify which of the genes were induced upon rhizobial inoculation. As shown in
Figure 7, RT-PCR results using
gene-specific primers showed that the level of Mtapy1
transcript significantly increased within 3 h after inoculation.
These data are consistent with our previous northern results using a
radiolabeled Mtapy1 probe (Fig. 2). Quantification of the
data shown in Figure 7A showed that the level of Mtapy1
increased approximately 3-fold within 6 h postinoculation (Fig.
7B). Likewise, similar results were obtained using gene specific
primers for Mtapy4 (Fig. 7A). Quantification of these data
indicated that Mtapy4 induction by inoculation is only
slightly less than Mtapy1 (Fig. 7B). In the cases of
Mtapy1 and Mtapy4, induction after inoculation is
transient. The highest levels of expression were seen 3 to 6 h
postinoculation with expression declining to basal levels by 12 to
24 h after inoculation.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 7.
A, RT-PCR analysis of the level of mRNA
expression of apyrase genes in response to wild-type S. meliloti strain ABS7M. RNA was collected
from roots 0, 3, 6, 12, 24, and 48 h post-rhizobial inoculation.
Actin primers were included in each reaction as a loading control. See
text for details. B, Quantification of the data shown in A. The
relative level of expression was determined by the following
calculation: (total counts apyrase/total counts actin) × 100 = relative expression. The SD between relative
expression values for two separate experiments was less than
10%.
|
|
In contrast to these results, the level of Mtapy2 mRNA was
not significantly enhanced upon rhizobial inoculation (Fig. 7A). In
these experiments Mtapy3 mRNA was not detected, consistent with the lack of expression of this gene in roots (see below).
Apyrase Genes Are Differentially Expressed in M. truncatula Tissues
To analyze the tissue-specific expression of apyrase genes in
M. truncatula we used gene-specific primers and RT-PCR to
analyze mRNA levels in various tissues. We isolated total RNA from the roots, hypocotyls, and cotyledons of 5-d-old seedlings, and from the
stems, leaves, and flowers of 5-week-old plants. These plants were
vernalized at 4°C for 14 d to shorten the flowering time. In
addition, we isolated total RNA from 10-d-old nodules that were
harvested from plants inoculated with wild-type S. meliloti strain 1021.
As shown in Figure 8,
Mtapy1 was expressed predominantly in roots, hypocotyls, and
nodule tissue. Mtapy4 was also expressed in root and nodule,
but also showed significant expression in cotyledons, stem, and flower.
No expression was found in hypocotyl tissue. Mtapy2 mRNA was
detected in roughly equivalent amounts in all tissues.
Mtapy3 showed the highest level of tissue specificity, showing appreciable expression only in flower tissue, with lesser amounts found in stem and nodule tissue. Consistent with previous RT-PCR results (see above), Mtapy3 mRNA was not detected in
root tissue.

View larger version (50K):
[in this window]
[in a new window]
|
Figure 8.
A, RT-PCR analysis of the expression of apyrase
genes from M. truncatula in various tissues. R, Five-day-old
roots; Hyp, 5-d-old hypocotyls; Cot, 5-d-old cotyledon; S, 6-week-old
stems; Lf, 6-week-old leaves; Fl, 6-week-old flowers; Nod, nodules
isolated 10 d post-inoculation with wild-type S. meliloti strain 1021. Actin primers were included in each reaction
as a loading control. See text for details. B, Quantification of the
data shown in A. The relative level of expression was determined by the
following calculation: (total counts apyrase/total counts actin) × 100 = relative expression. The SD between
relative expression values for two separate experiments was less than
10%.
|
|
Apyrase Expression Is an Early Nodulation Event
If apyrases are important to the nodulation response, then plant
mutants defective in nodulation may also show reduced or altered
apyrase expression. Moreover, such nodulation mutants can be used to
determine when, during nodule ontogeny, a gene is expressed. Therefore,
we analyzed Mtapy1 expression in three genetically distinct
non-nodulation mutants of M. truncatula (Prabhu, 1998 ). As
described in Table III, use of these
mutants allowed for the analysis of apyrase expression at distinct,
development time points during early nodulation. For example, these
mutants were either nonresponsive to the bacterial symbiont (i.e. very early, mutant dmi1), blocked for formation of nodule
primordia (i.e. a later step, mutant pdl1), or in the
formation and/or maintenance of epidermal cell infection (i.e. a step
subsequent to primordium formation, mutant lin). As shown in
Figure 9, little or no Mtapy1 expression was detected in root tissue isolated from dmi1 or
pdl, as measured by RT-PCR with Mtapy1-specific
primers. As a positive control, Mtapy1 mRNA levels increased
upon inoculation in root tissue isolated from the wild-type M. truncatula line A17 (Fig. 9). Consistent with previous results,
the level of this expression peaked at approximately 6 h and was
undetectable by 12 h postinoculation. The basal level of Mtapy1
expression was also significantly lower than that found in the wild
type. The level of Mtapy1 expression in root tissue from the
lin mutant showed a similar time course to that of the wild
type, although maximal expression was slightly delayed, peaking at
12 h and reaching basal levels by 24 h postinoculation. This
delay in Mtapy1 expression may reflect a slight delay in nodule development in the lin mutant. Analysis of
Mtapy4 expression gave similar results (data not
shown).

View larger version (76K):
[in this window]
[in a new window]
|
Figure 9.
Northern-blot analysis of the level of expression
of Mtapy1 in wild-type and EMS-mutagenized lines of M. truncatula. Total RNA was purified from roots of the A17 wild-type
line at 0, 3, 6, 12, 24, 48, 72, 96, 120, and 168 h
postinoculation with wild-type S. meliloti strain
ABS7M. Total RNA was purified from the roots of
dmi, pdl, and lin plants at 0, 6, 12, 24, 72, and 120 h postinoculation with wild-type S. meliloti strain ABS7M. Blots were first
probed with an Mtapy1-specific probe and then reprobed with
a histone probe as a loading control.
|
|
 |
DISCUSSION |
Many of the very early nodulation responses generated in legume
roots by rhizobial inoculation (including the induction of a nodule
structure) can also be elicited by treatment with the appropriate,
purified lipo-chitin nodulation signal (for review, see
Dénarié et al., 1996 ; Long, 1996 ; Minami et al., 1996 ; Cohn et al., 1998 ). Nodulation signals act with high specificity at very low
concentrations and, therefore, they are thought to mediate their
effects through interaction with a specific, protein receptor. The
search for such a receptor is an area of intensive research.
A promising candidate for a Nod signal receptor is the apyrase protein
isolated from the roots of the legume D. biflorus, LNP. This
protein was shown to be localized on the root hair surface and to bind
Nod signals from rhizobia capable of nodulating D. biflorus
(Etzler et al., 1999 ). Moreover, binding of the Nod signal to the
apyrase stimulated ATPase activity, suggesting a possible mode for
signal transduction. In addition, an orthologue of LNP characterized
from soybean, GS52, was localized to the plasma membrane of soybean
roots (Day et al., 2000 ). One striking result from work with LNP and
the soybean orthologue was the demonstration that antiserum raised
against either protein inhibited the ability of rhizobia to nodulate
their respective hosts, D. biflorus and soybean. These data
suggest that apyrases play a critical role in the early events of
nodulation. It is unfortunate that D. biflorus is a
little-studied legume with limited information available on its
nodulation properties, genetics, preferred symbiont, etc. Although
soybean is well characterized, the large genome size and the fact that
it is an ancestral tetraploid make genetic analysis of this plant difficult.
M. truncatula has recently been touted as a promising model
plant for genetic studies of legumes (Barker et al., 1990 ; Cook, 1999 ).
A number of laboratories worldwide are now working to develop this
plant as a model system. The accumulating information on M. truncatula should be an aid to studies of nodulation. Therefore, we undertook a study to examine the apyrase genes of this plant as an
initial step in defining the role of these proteins in the nodulation response.
Four apyrase genes were isolated. Due to the close sequence similarity
among these genes we utilized gene-specific primers and RT-PCR to
examine mRNA expression levels. Consistent with a possible role in
nodulation, mRNA levels of Mtapy1 and Mtapy4 were
rapidly elevated upon inoculation of roots with S. meliloti. The expression pattern of these two genes classifies them as ENODs. There are only two other examples of legume genes that respond this
quickly to rhizobia (Pichon et al., 1992 ; Journet et al., 1994 ;
Cook et al., 1995 ). The gene encoding ENOD12 has been reported to be
inducible by rhizobia within 1 h after rhizobial inoculation (Pichon et al., 1992 ; Horvath et al., 1993 ; Journet et al.,
1994 ). At present, there is no known biochemical function for
the Pro-rich ENOD12 protein. In fact, a M. truncatula
subspecies that does not express ENOD12 is not affected in
its ability to nodulate (Csanádi et al., 1994 ). One ENOD that
does have a proposed function is rip1
(Rhizobium-induced peroxidase). Rip1 mRNA was
transiently induced in M. truncatula roots within 3 h
after S. meliloti inoculation (Cook et al., 1995 ). This
expression pattern is similar to what was seen for Mtapy1
and Mtapy4. Rip1 has been postulated to play a role in
oxidative processes that occur very early in the nodulation response
(Cook et al., 1995 )
RT-PCR analysis of gene expression shows that induction of
Mtapy1 and Mtapy4 after S. meliloti
inoculation is transient, reaching a peak of expression 3 to -6 h
postinoculation, but returning to basal levels in 12 to 24 h.
These results are similar to what has been recently found for the
expression pattern of a soybean apyrase, GS52 (Day et al., 2000 ). The
expression of this gene was transiently increased in response to
inoculation with the soybean symbiont, B. japonicum within
6 h after inoculation. If these apyrases are indeed Nod signal
receptors, it seems at first counterintuitive to see the level of
expression of these genes increase in response to their agonist (i.e.
rhizobia). However, these results are consistent with several reports
of the activation of receptor genes in response to agonist addition in
other systems (Eriksson et al., 1991 ; Ng et al., 1997 ; Helmrath et al.,
1998 ; Kisselgof and Oettgen, 1998 ; Perera et al., 1999 ).
Analysis of the level of expression of Mtapy1 and
Mtapy4 in response to inoculation with rhizobial mutants
indicated that S. meliloti strains that are not able to
produce Nod signals did not significantly affect the level of
transcription of Mtapy1 or Mtapy4 (data not
shown). These data suggested that only rhizobia that are able to
produce Nod signals are able to induce the transcription of apyrases in
M. truncatula. However, further experiments are necessary to
make any conclusions about specific bacterial factors that might affect
apyrase mRNA expression.
The data indicate that Mtapy2 and Mtapy3 are not
induced in response to rhizobial inoculation. However, the
Mtapy2 gene was identified as an EST sequence from a cDNA
library generated from mRNA isolated from M. truncatula root
hair tissue. The root hairs are the site of rhizobial infection and,
therefore, this location would be consistent with a role in nodulation.
Although Mtapy3 mRNA expression was not detected in roots,
there was appreciable expression in nodule tissue. In fact, the tissue
expression pattern of Mtapy3 found in nodules and
flowers is similar to the expression pattern found for the ENOD gene,
ENOD40 (Crespi et al., 1994 ). Since the focus of this work was on early
nodulation events, Mtapy3 expression was not extensively examined.
Sequencing and genetic mapping placed Mtapy1,
Mtapy3, and Mtapy4 close together on linkage
group 7 of the M. truncatula genome. These three genes are
found on the same BAC contig. Southern hybridization data of this BAC
contig is consistent with the presence of three apyrase genes (data not
shown), although we cannot rule out the possibility of additional
apyrase genes with reduced nucleotide homology in this cluster. PCR
analysis indicated that Mtapy2 was not present on this BAC
contig, but instead Mtapy2 hybridized strongly to BAC 20K21
that mapped to M. truncatula linkage group 4.
Apyrase genes have also been characterized from soybean (Day et al.,
2000 ). Hybridization of these apyrases to high-density BAC filters
indicates that, as we have determined for M. truncatula, the
legume-specific apyrase genes are also clustered in the soybean genome
(N.D. Young, unpublished data). Moreover, genetic mapping data
demonstrated that in M. truncatula and soybean, these
homologous apyrase clusters are tightly linked to a conserved genetic
marker with homology to cotton EST AI727823. The finding of a conserved genetic locus that contains a cluster of apparently legume-specific apyrase genes provides the first indication of conserved genome structure between crop and model legume systems, and it should provide
the basis for more detailed analysis of the conservation of this gene
family within the legume subfamily Papilionoideae.
If apyrases play an important role in the nodulation response, then
plant mutants defective in nodulation may show an altered profile of
apyrase expression. Use of such mutants also allowed us to examine
apyrase expression in relation to distinct developmental events during
early nodulation. Northern analysis of ethyl methane sulfatonate- (EMS)
generated, nodulation-defective lines of M. truncatula
identified mutants defective in apyrase expression. Little or no
Mtapy1 mRNA expression was seen in root tissue from the
pdl or dmi mutants. dmi1 is nearly
devoid of symbiotic responses, lacking bacterial infection and
formation of nodule primordia, and has been proposed to function in
transduction of the Nod signal (Catoira et al., 2000 ), whereas the
pdl mutant develops numbers of infections comparable with
wild-type plants, but fails to develop nodule primordia. In contrast to
dmi1 and pdl, the lin mutant develops
visible nodule primordia, but has a reduced infection phenotype. The
numbers of infection events in lin are reduced relative to
wild type, and those infections that do form are arrested soon after
infection thread initiation. Thus, the observation that symbiotic
expression of Mtapy1 is absent in dmi1 and
pdl, but present in lin suggests that
Mtapy1 expression is correlated with the formation of nodule
primordia, but is apparently independent of rhizobial infection. The
low expression of Mtapy1 in the absence of inoculation in
the dmi1 and pdl mutant lines indicates that these mutants are not only defective in the induction of apyrase expression, but also in basal expression. Therefore, it would appear
that the same signaling circuitry involved in inducible Mtapy1 expression are also involved in maintaining a basal
level of expression. It is interesting that genetic mapping data
indicates that the apyrase cluster shown in Figure 3 is located within
2 cM of the pdl locus (data not shown). Therefore, it is
possible that the apyrase genes are clustered in an area of the
M. truncatula genome that contains other symbiotically
relevant loci.
A role for apyrases in early nodulation has been suggested previously
by Etzler et al. (1999) and Day et al. (2000) . In particular, a
subclass of apyrase genes with uniquely high homology among legumes is
implicated in the perception of the Nod signal. Here we have determined
that M. truncatula contains multiple apyrase genes. It is
interesting that several members of the legume-specific clade of
apyrases are clustered in the M. truncatula genome, and transcripts for each of these apyrase genes can be detected in nodules
by northern-blot analysis or by surveys of nodule derived ESTs in
M. truncatula. Two of these apyrases, designated
Mtapy1 and Mtapy4, are rapidly induced upon
rhizobial inoculation of roots, thus classifying these genes as ENODs.
The differential expression of Mtapy1 in dmi/pdl
in relation to lin establishes a correlation between
expression of Mtapy1 and nodule morphogenesis. Future
studies of this important gene family should benefit from the advent of
an intensively studied model legume system such as M. truncatula, and the opportunities provided by an increasingly well-characterized genome (Cook, 1999 ) and facile transformation technologies (Trieu et al., 2000 ).
 |
MATERIAL AND METHODS |
Culture Media and Growth Conditions
Escherichia coli strains were grown and
maintained on Luria-Bertani medium (Sambrook et al., 1989 ) at 37°C.
Sinorhizobium meliloti strains were grown and maintained
on tryptone-yeast extract (TY) medium (Somasegaren and Hoben, 1994 ) at
30°C. Antibiotics used in this study for selection and plasmid
maintenance were 100 µg mL 1 ampicillin, 50 µg
mL 1 kanamycin, or 10 µg mL 1 tetracycline.
Plant Material and Growth Conditions
Prior to germination Medicago truncatula seeds
were scarified by treatment with concentrated
H2SO4 for 8 min, rinsed thoroughly with sterile
distilled water, and treated with 5% (v/v) hypochlorite for 3 min. Following thorough rinsing, the seeds were imbibed in sterile
distilled water for 3 to 4 h at room temperature. Treated seeds
were placed into sealed Petri plates on moist filter paper at 4°C in
the dark for at least 48 h and were then transferred to room
temperature in the dark for 24 h. Germinated seedlings were
transferred to growth pouches (Mega International, Minneapolis) or to
aeroponic chambers (Lullien et al., 1987 ; Gallusci et al., 1991 ).
Seedlings were grown in inorganic nutrient medium (Lullien et al.,
1987 ) under a 16-h day/8-h night cycle (22°C light/18°C dark).
Bacterial Inoculation of Plants
Prior to plant inoculation, bacteria were grown to late log
phase in TY medium (Somasegaran and Hoben, 1994 ) supplemented with
appropriate antibiotics. Bacteria were then centrifuged, washed, and
resuspended in sterile distilled water. Bacteria were added directly to
nitrogen-deficient plant nutrient solution (Lullien et al., 1987 ) in
the aeroponic chambers. Nodulation was rapid and uniform under these
conditions. Plants were grown under a 16-h-light (22°C)/8-h-dark
(18°C) cycle.
For inoculation of plants grown in plastic growth pouches, bacteria
were grown to log phase in TY medium and an aliquot was transferred to
fresh medium to monitor growth. Bacterial cultures were grown to an
OD600 of 1.0, centrifuged, washed, and then resuspended in
inorganic nutrient medium (Lullien et al., 1987 ) to yield
107 cells mL 1. Each plant was inoculated with
1 mL of the bacterial suspension. Nodulation was also rapid and uniform
under these conditions.
RNA Isolation
Plant tissue samples were frozen in liquid nitrogen and stored
at 80°C until use. RNA was isolated using a protocol modified (Cook
et al., 1995 ) from the guanidine-HCl extraction protocol (described in
Sambrook et al., 1989 ). The purified RNA pellet was resuspended in
RNase-free, diethyl pyrocarbonate- (Sigma, St. Louis) treated sterile
distilled water and stored at 80°C until use.
TD-PCR
For the initial cloning of the M. truncatula
apyrase cDNAs using TD-PCR (Don et al., 1991 ), degenerate primers
were designed from conserved apyrase motifs present in the pea (Hseih
et al., 1996 ), potato (Handa and Guidotti, 1996 ), D.
biflorus (Etzler et al., 1999 ), and soybean apyrases (Day et
al., 2000 ). Primers were used in a final concentration of 0.2 µM in all reactions. The primers used for TD-PCR were as
follows: TD-apyrase forward, 5'-ATTGATGGAACCCAAGAAGG -3'; and
TD-apyrase reverse, 5'-GGYAAAGMTGATATGGCTTC-3' (Y = C/T; M = A/C). The conditions were as follows: 94°C, 1 min; X°C, 2 min; and
72°C, 3 min, where X represents changing annealing temperatures. The
annealing temperature was steadily decreased by 2°C every 3 cycles
starting at 60°C and ending at 42°C. PCR products were visualized
by agarose gel electrophoresis and ethidium bromide staining (Sambrook
et al., 1989 ).
Cloning of PCR Products
PCR products of the expected size were cloned into the
TA-cloning vector pCR2.1 using a TA Cloning Kit
(Invitrogen, Carlsbad, CA), or into the TOPO cloning vector
(Invitrogen) following the manufacturer's instructions. In certain
cases ligation products were cloned using the P-GEM-T-EASY kit
(Promega, Madison, WI) and transformed into E. coli
strain JM109 according to Sambrook et al. (1989) . Plasmid DNA was
isolated using the alkaline lysis method (Sambrook et al., 1989 ) or
using the Wizard Plus Mini Prep Kit (Promega). Plasmid DNA was digested
with EcoRI restriction endonuclease (Promega) and was
analyzed by gel electrophoresis (Sambrook et al., 1989 ). DNA sequencing
of cloned PCR products was performed at the University of Tennessee
Molecular Biology Resource Facility using an ABI 373 DNA sequencer
(Perkin-Elmer, Foster City, CA) with the ABI Prism Dye Terminator Cycle
Sequencing reaction kit. In all cases, both strands of at least two
independent clones were sequenced.
Isolation of a Full-Length cDNA Encoding Mtapy1
Extension of the cDNA ends of the 850-bp Mtapy1
product was performed using the 5'- and 3'-RACE kit (Gibco-BRL,
Gaithersburg, MD), according to the manufacturer's
protocol. For extension of the 3' end, the primer 3'apy1 GSP1 was
employed: 3'-RACEGSP1, 5'-TGCTCGTTGATGGATTTGGC-3'. For extension of the
5' end, the following primers were employed: 5'apy1GSP1,
5'-ACCTTCATAATCTCAGCTCG-3'; and 5'apy1GSP2, 5'-CTCCAAGATCCATTACTCCC-3'.
Cloning and sequencing of the PCR generated products was performed as
described above.
After sequence analysis of the 5'- and 3'-RACE products, primers were
designed to amplify the predicted coding region from the start (first
in frame ATG) to the stop codon. Primers used for amplification of the
full-length cDNA were 5'-Mt46fullORFE and 3'-Mt46fullORFE,
respectively. The primers were used in an RT-PCR reaction as described
above using 0.2 µM of each primer and 2 units of
Pfu DNA polymerase (Stratagene, La Jolla, CA). The
reaction was carried out as described above, except a single annealing
temperature of 52°C was used. Cloning and sequencing were performed
as described above.
Cloning of Mtapy2
To compare the full sequence of Mtapy1 with known
sequences in the database, a BLAST search was performed (Altschul et
al., 1997 ). When compared with the EST database dbEST (Pearson et al., 1997 ), it was discovered that a very similar gene had been described from the roots of M. truncatula (Covitz et al., 1998 ;
accession no. AA660474). The available sequence was used to
generate primers for use in an RT-PCR reaction. The following primers
were used: 5'-Mt46-2, 5'- GGGGCAACTGCAGGTTTAAGGGC-3'; and 3'-Mt46-2, 5'-GAGCCAGATAAGATACACGGG-3'. The product of PCR was a 450-bp fragment that showed 85% sequence similarity to Mtapy1, and was
designated Mtapy2.
BAC Clone Isolation and Manipulation
BAC clones of M. truncatula genotype A17 were
identified by means of hybridization to high-density filter arrays
obtained from the Clemson University Genomics Institute
(http://www.genome.clemson.edu), or by PCR screening of a multiplexed
DNA copy of the BAC library as described by Nam et al. (1999) . BAC end
sequencing was performed on whole BAC clones using the ABI PRISM BigDye
Primer Cycle Sequencing reaction kit and oligonucleotide primers
complementary to the pBeloBAC11 vector ("left primer,"
AACGCCAGGGTTTTCCCAGTCACGACG; "right primer,"
ACACAGGAAACAGCTATGACCATGATTACG). Internal sequencing of selected
regions of BAC clones was performed by a primer walking strategy on
whole BAC clones or on DNA fragments subcloned into pBluescript
(Stratagene). The BAC contig shown in Figure 3 was extended by
multiplex PCR using primers designed to amplify sequences corresponding
to the outermost BAC ends.
Genetic markers were developed based on BAC end sequence information
obtained from BAC clones with homology to characterized M.
truncatula apyrase cDNA products or to the soybean RFLP clone B046. In brief, oligonucleotide primers (Table II) were designed based
on the corresponding BAC end sequence information and were used to PCR
amplify and sequence genomic DNA from M. truncatula genotypes A17 and A20. Comparing differences in restriction enzyme patterns between the parental genotypes identified restriction enzyme
polymorphisms. The resulting CAPS markers were mapped on a population
of 93 F2 progeny from a genotype A17 × A20 cross (Penmetsa and Cook, 2000 ). Polymorphic DNAs were resolved on a 1.5%
(w/v) agarose gel and were visualized by ethidium bromide staining.
Primers, PCR conditions, and restriction enzyme information is given in
Table II. DNA was extracted from the mapping population by means of the
Nucleon Phytopure kit (Amersham Life Sciences, Buckinghamshire,
UK), according to manufacturer's instructions.
Soybean BAC Library Screening with GS50 and GS52
An 8× redundant soybean BAC library was spotted onto
high-density nylon membranes at the Clemson University Genomics Center (Clemson, SC). 32P-labeled probes of GS50 and GS52 were
generated using the Random Primers DNA Labeling System (Gibco-BRL) and
the BAC filters were hybridized as described in Danesh et al.
(1998) .
Placing BAC Contigs onto the Soybean Genetic Map
GS50 and GS52 hybridizations potentially revealed more than one
location in the soybean genome. For this reason positive BACs were
sorted into contigs and those corresponding to previously mapped
apyrase loci were determined. BAC DNA was purified using Polyfiltronic
96-well Uni-Filter 800s (Whatman, Clifton, NJ), as recommended by the
manufacturer. All clones that were positive with GS50 or GS52 along
with genomic DNA from the parents of an recombinant inbred mapping
population described previously (Concibido et al., 1996 ) were digested
with the restriction enzyme originally used to map GS50 (Day et al.,
2000 ). Southern blots were then hybridized with radiolabeled GS50 and
GS52 to visualize corresponding restriction fragments. BACs were
grouped into contigs based on similar banding patterns and those BACs
corresponding to the originally mapped locus were identified by
comparing the digestion patterns.
Phylogenetic Analysis of M. truncatula Apyrase
Genes
For the tree generated in Figure 5, protein sequences were
aligned using CLUSTALW (Thompson et al., 1994 ) under default
parameters. End gaps were trimmed, leaving a 214-amino acid multiple
sequence alignment for phylogenetic inference. Translations of EST
sequences were generated for TFASTX3 (Pearson et al., 1997 ; alignments
with Db-LNP, AF139807).
LNP protein sequences and rbcL DNA sequences were
aligned using CLUSTALW (Thompson et al., 1994 ), running under default
parameters. For both alignments, end gaps were trimmed. The final
alignment for the LNP protein sequences contained 188 amino acid
positions; the final alignment for the rbcL sequences
contained 1,310 nucleotide positions. DNA and protein distances were
inferred using the DNADIST and PROTDIST programs of the PHYLIP package
(version 3.5c, J. Felsenstein, Department of Genetics, University of
Washington, Seattle), respectively. Bootstrap and neighbor-joining
analysis were performed using the SEQBOOT and NEIGHBOR programs, also
from the PHYLIP package. Both trees in Figure 6 were rooted by the out-group Arabidopsis sequences.
Northern-Blot Analysis
Total root RNA was isolated from roots at various times between
0 and 6 h after inoculation with S. meliloti strain
ABS7. Total RNA was electrophoresed on denaturing 1% (w/v) agarose
formaldehyde gels and blotted as described by Sambrook et al. (1989) .
Each lane was loaded with RNA equivalent to 0.2 g fresh weight of
root tissue. The blot was probed with a 32P-labeled
full-length Mtapy1 cDNA probe, stripped, and then
reprobed with Histone H3 from M. truncatula. In all
cases probes were radiolabeled with 32P using random primer
labeling (Promega). Hybridizations were performed at 60°C followed by
successive washings as previously described (Day et al., 2000 ).
RT-PCR Analysis of Gene Expression
Total RNA was collected from 5-d-old roots, hypocotyls, and
cotyledons, from 6-week-old stems, leaves, and flowers, and 10-d-old nodules using the guanidine-HCl method described above. Total root RNA
was also isolated from M. truncatula A17 plants
inoculated with S. meliloti ABS7M at 0, 3, 6, 12, 24, and 48 h postinoculation.
Due to the high degree of sequence similarity between all of the
putative apyrases from M. truncatula, a PCR-based
approach was used to distinguish the expression of the
different genes. Gene-specific primers were designed from
the available sequence of all of the genes from regions of sequence
divergence and from the 3'-untranslated regions. The primers used in
these reactions were as follows: 5'Mt46fullORFE,
5'-GGAATTCATGGTCTTACTTTGGCAAAACACC-3'; 3'Mt46fullORFE,
5'-GGCTTAAGTTAAACAAAATACATCATTCG-3'; Mtapy1 GS forward,
5'-CTGGGGCTAATTTTAATGGATGC-3'; Mtapy1 GS reverse,
5'-GTGGTACCCTCAATAGAAAAAACATGTCGG-3'; Mtapy2 GS forward,
5'-GATGCTGATGCGGTTACAGTGTTG-3'; Mapy2 GS reverse, 5'-CCATGGCAGCCTCAGACTCA-3'; Mtapy3 GS forward,
5'-GGTCACACATAATTCTCCCAACCC-3'; Mtapy3 GS reverse,
5'-GCAGCGTTAAACTTGAGCG-3'; Mtapy4 GS forward, 5'-GTTCAGTAACAGAAGTACCCTCAACG-3'; and Mtapy4 GS reverse,
5'-CACCTACTGTAATCTCTTTTCGTGGAC-3'.
These primers were first used in PCR reactions against
reverse transcribed total RNA isolated from pooled M.
truncatula line A17 tissues. The PCR products generated were
cloned, sequenced to confirm gene identity, and subsequently used as
hybridization probes for Southern analysis. RT-PCR reactions were
performed as previously described (Day et al., 2000 ). In all of the
reactions, primers designed to amplify actin were included as internal
controls in each tube. The sequence of the actin primers were as
follows: 5'Mt ACTIN, 5'-GCAGATGCTGAGGATATTAACCCC-3'; 3' Mt ACTIN,
5'-CGACCACTTGCATAGAGGGAGAGG-3'.
The RT-PCR products were separated by gel electrophoresis, blotted, and
hybridized with the appropriate 32P-labeled cDNA probe
(Sambrook et al., 1989 ). Blots were first probed with the respective
apyrase genes, stripped, and reprobed with actin as an internal
control. All blots were counted for total radioactivity using an
Instant Imager (Packard Instrument Co., Meriden, CT). The total counts
of apyrase probe hybridization were divided by total counts of actin
probe hybridization to yield a ratio of the relative intensity of
hybridization of apyrase. The value obtained was multiplied by 100 to
yield a value referred to as relative expression.
Screening of Nodulation-Deficient Mutant Lines of M. truncatula
Penmetsa and Cook (2000) described an efficient EMS mutagenesis
of M. truncatula. Based on screening of the resulting
progeny numerous nodulation mutants were identified, including several lines affected for symbiotic development (Penmetsa and Cook, 1997 ; Catoira et al., 2000 ; R.V. Penmetsa and D.R. Cook, unpublished data).
Three genetically separable mutants with distinct non-nodulation phenotypes (Table III) were used for analysis of apyrase gene
expression by RT-PCR as described above. The wild-type
M. truncatula A17 and nodulation defective lines
pdl, dmi1, and lin were
grown aeroponically and inoculated with wild-type S.
meliloti strain ABS7. At each time point, a 5-cm section of
root was sampled surrounding the zone of nodulation. RNA isolation,
northern blotting, and hybridizations were performed as described previously.
 |
ACKNOWLEDGMENTS |
The authors would like to thank Marilynn Etzler
for providing the sequence of the D. biflorus
apyrase prior to publication. We would also like to thank Kate
VandenBosch for kindly providing us with the EST clone pVK0-1 M6.
 |
FOOTNOTES |
Received October 19, 2000; accepted December 4, 2000.
1
This work was supported by the U.S. Department
of Energy (grant no. DE-FG02-97ER20260 to G.S.) and by the National
Science Foundation (grant no. 9872664 to D.R.C. and N.D.Y.).
*
Corresponding author; e-mail gstacey{at}utk.edu; fax
865-974-4007.
 |
LITERATURE CITED |
-
Abeijon D, Yanagisawa K, Mandon EC, Hausler A, Moreman K, Hirshchberg DB, Robbins PW
(1993)
Guanosine diphosphatase is required for protein and sphingolipid glycosylation in the Golgi lumen of Saccraromyces cerevisiae.
J Biol Chem
122: 307-323
-
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ
(1997)
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res
25: 3389-3402
[Abstract/Free Full Text]
-
Barker D, Bianchi S, Blondon F, Dattee Y, Duc G, Essad S, Flament T, Gallusci T, Genier G, Guy P
(1990)
Medicago truncatula, a model plant for studying the molecular genetics of the Rhizobium-legume symbiosis.
Plant Mol Biol Rep
8: 40-49
-
Catoira R, Galera C, de Billy F, Journet EP, Maillet F, Penmetsa V, Rosenberg C, Gough C, Cook D, Dénarié J
(2000)
Identification of four genes of Medicago truncatula controlling steps in Nod factor transduction.
Plant Cell
12: 1647-1665
[Abstract/Free Full Text]
-
Chen Y-R, Datta N, Roux SJ
(1987)
Purification and partial characterization of a calmodulin-stimulated nucleoside triphosphatase from pea nuclei.
J Biol Chem
262: 10689-10694
[Abstract/Free Full Text]
-
Chen Y-R, Roux SJ
(1986)
Characterization of nucleoside triphosphatase activity in isolated pea nuclei and its photoreversible regulation by light.
Plant Physiol
81: 609-613
[Abstract/Free Full Text]
-
Cohn J, Day RB, Stacey G
(1998)
Legume nodule organogenesis.
Trends Plant Sci
3: 105-110
[CrossRef]
-
Concibido VC, Young ND, Lange D, Denny RL, Danesh D, Orf JH
(1996)
Targeted comparative genome analysis and qualitative mapping of a major partial-resistance gene to soybean cyst nematode.
Theor Appl Genet
93: 234-241
[CrossRef]
-
Cook D
(1999)
Medicago truncatula: a model in the making!
Curr Opin Plant Biol
2: 301-304
[CrossRef][Web of Science][Medline]
-
Cook D, Dreyer D, Bonnet D, Howell M, Nony E, VandenBosch K
(1995)
Transient induction of a peroxidase gene in Medicago truncatula precedes infection by Rhizobium meliloti.
Plant Cell
7: 43-55
[Abstract]
-
Covitz PA, Smith LS, Long SR
(1998)
Expressed sequence tags from a root-hair-enriched Medicago truncatula cDNA library.
Plant Physiol
117: 1325-1332
[Abstract/Free Full Text]
-
Crespi MD, Jurkevitch E, Poiret M, d'Aubenton-Carafa Y, Petrovics G, Kondorosi E, Kondorosi A
(1994)
enod40, a gene expressed during nodule organogenesis, codes for a non-translatable RNA involved in plant growth.
EMBO J
13: 5099-5112
[Web of Science][Medline]
-
Csanádi G, Szécsi J, Kalo P, Kiss P, Endre G, Kondorosi A, Kondorosi E, Kiss GB
(1994)
ENOD12, an early nodulin gene is not required for nodule formation and efficient nitrogen fixation in alfalfa.
Plant Cell
6: 201-213
[Abstract]
-
Danesh D, Pe Fluela S, Mudge J, Denny RL, Nordstrom H, Martinez JP, Young ND
(1998)
A bacterial artificial chromosome library for soybean and identification of clones near a major cyst nematode resistance gene.
Theor Appl Genet
96: 196-206
[CrossRef][Web of Science]
-
Day RB, McAlvin CB, Loh JT, Denny RL, Wood TC, Young ND, Stacey G
(2000)
Differential expression of two soybean apyrases: one of which is an early nodulin.
Mol Plant-Microbe Interact
13: 1053-1070
[Web of Science][Medline]
-
Dénarié JF, Debellé F, Promé JC
(1996)
Rhizobium lipo-chitooligosaccharide nodulation factors: signaling molecules mediating recognition and morphogenesis.
Annu Rev Biochem
65: 503-535
[CrossRef][Web of Science][Medline]
-
Don RH, Cox PT, Wainwright BJ, Baker K, Mattick JS
(1991)
Touchdown PCR to circumvent spurious priming during gene amplification.
Nucleic Acids Res
19: 4008
[Free Full Text]
-
Edwards FA, Gibb AJ
(1993)
ATP: a fast neurotransmitter.
FEBS Lett
325: 86-89
[CrossRef][Web of Science][Medline]
-
Emanuelsson O, Nielsen H, Brunak S, von Heijne G
(2000)
Predicting subcellular localization of proteins based on their N-terminal amino acid sequence.
J Mol Biol
300: 1005-1016
[CrossRef][Web of Science][Medline]
-
Eriksson A, Nister M, Leveen P, Westermark B, Heldin CH, Claesson-Welsh L
(1991)
Induction of platelet-derived growth factor
- and -receptor mRNA and protein by platelet-derived growth factor BB.
J Biol Chem
266: 21138-21144
[Abstract/Free Full Text] -
Etzler ME, Kalsi G, Eqing NN, Roberts NJ, Day RB, Murphy JB
(1999)
A nod factor binding lectin with apyrase activity from legume roots.
Proc Natl Acad Sci USA
96: 5856-5861
[Abstract/Free Full Text]
-
Frohman MA, Duch MK, Martin GR
(1988)
Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer.
Proc Natl Acad Sci USA
85: 8998-9002
[Abstract/Free Full Text]
-
Gallusci P, Dedieu A, Journet EP, Huguet T, Barker DG
(1991)
Synchronous expression of leghaemoglobin genes in Medicago truncatula during nitrogen-fixing root nodule development and response to exogenously supplied nitrate.
Plant Mol Biol
17: 335-349
[CrossRef][Web of Science][Medline]
-
Gao X-D, Kaigorodov V, Jigami Y
(1999)
YND1, a homologue of GDA1, encodes membrane-bound apyrase required for Golgi N- and O-glycosylation in Saccharomyces cerevisiae.
J Biol Chem
74: 21450-21456
-
Handa M, Guidotti G
(1996)
Purification and cloning of a soluble ATP-diphosphohydrolase (apyrase) from potato tubers (Solanum tuberosum).
Biochem Biophys Res Commun
218: 916-923
[CrossRef][Web of Science][Medline]
-
Helmrath MA, Shin CE, Erwin CR, Warner BW
(1998)
Epidermal growth factor up-regulates the expression of its own intestinal receptor after small bowel resection.
J Pediatr Surg
33: 229-234
[CrossRef][Web of Science][Medline]
-
Horvath B, Heidstra R, Lados M, Moerman M, Spaink HP, Promé JC, Van Kammen A, Bisseling T
(1993)
Lipooligosaccharides of Rhizobium induce infection-related early nodulin gene expression in pea root hairs.
Plant J
4: 727-733
[CrossRef][Web of Science][Medline]
-
Hseih HS, Tong DG, Thomas C, Roux SJ
(1996)
Light-modulated abundance of an mRNA encoding a calmodulin-regulated, chromatin-associated NTPases in pea.
Plant Mol Biol
30: 135-147
[CrossRef][Web of Science][Medline]
-
Journet EP, Pichon M, Dedieu A, de Billy F, Truchet G, Barker DG
(1994)
Rhizobium maliloti Nod factors elicit cell-specific transcription of the ENOD12 gene in transgenic Alfalfa.
Plant J
6: 241-249
[CrossRef][Web of Science][Medline]
-
Kisselgof AB, Oettgen HC
(1998)
The expression of murine B cell CD23, in vivo, is regulated by its ligand, IgE.
Int Immunol
10: 1377-1384
[Abstract/Free Full Text]
-
Komoszynski M, Wojtczak A
(1996)
Apyrases (ATP diphosphohydrolases, EC 3.6.1.5): function and relationship to ATPases.
Biochem Biophys Acta
1310: 233-241
[Medline]
-
Lullien V, Barker DG, de Lajudie P, Huguet T
(1987)
Plant gene expression in effective and ineffective root nodules of alfalfa (Medicago sativa).
Plant Mol Biol
9: 43-48
-
Long SR
(1996)
Rhizobium symbiosis: Nod factors in perspective.
Plant Cell
8: 1885-1898
[CrossRef][Web of Science][Medline]
-
Marcus AJ, Safier LB
(1993)
Thromboregulation: multicellular modulation of platelet reactivity in hemostasis and thrombosis.
FASEB J
7: 516-522
[Abstract]
-
Minami E, Kouchi H, Cohn JR, Ogawa T, Stacey G
(1996)
Expression of the early nodulin, ENOD40, in soybean roots in response to various lipo-chitin signal molecules.
Plant J
10: 23-32
[CrossRef][Web of Science][Medline]
-
Nam Y-W, Penmetsa RV, Endre G, Kim D, Cook DR
(1999)
Construction of a bacterial artificial chromosome library of Medicago truncatula and identification of clones containing ethylene response genes.
Theor Appl Genet
98: 638-646
[CrossRef][Web of Science]
-
Ng GY, Varghese G, Chung HT, Trogadis J, Seman P, O'Dowd BF, George SR
(1997)
Resistance of the dopamine D2L receptor to desensitization accompanies the up-regulation of receptors on to the surface of Sf9 cells.
Endocrinology
138: 4199-4206
[Abstract/Free Full Text]
-
Pearson WR, Wood TC, Zhang Z, Miller W
(1997)
Comparison of DNA sequences with protein sequences.
Genomics
46: 24-36
[CrossRef][Web of Science][Medline]
-
Penmetsa RV, Cook D
(1997)
A legume ethylene-insensitive mutant hyperinfected by its rhizobial symbiont.
Science
275: 527-530
[Abstract/Free Full Text]
-
Penmetsa RV, Cook DR
(2000)
Production and characterization of diverse developmental mutants of Medicago truncatula.
Plant Physiol
123: 1387-1398
[Abstract/Free Full Text]
-
Perera SC, Ladd TR, Dhadialla TS, Kress PJ, Sohi SS, Retnakaran A, Palli SR
(1999)
Studies on two ecdysome receptor isoforms of the spruce budworm, Choristoneura fumiferana.
Mol Cell Endocrinol
152: 73-84
[Medline]
-
Pichon M, Journet EP, Dedieu A, de-Billy F, Truchet G, Barker DG
(1992)
Rhizobium meliloti elicits transient expression of the early nodulin gene ENOD12 in the differentiating root epidermis of transgenic alfalfa.
Plant Cell
4: 1199-1211
[Abstract/Free Full Text]
-
Prabhu M
(1998)
Characterization of Medicago truncatula mutants defective in infection persistence and defense response during Rhizobium-legume symbiosis. MS thesis. Texas A&M University, College Station
-
Roberts NJ, Brigham J, Wu B, Murphy JB, Volpin H, Philips DA, Etxler ME
(1999)
A Nod factor-binding lectin is a member of a distinct class of apyrases that may be unique to the legumes.
Mol Gen Genet
262: 261-267
[CrossRef][Web of Science][Medline]
-
Sambrook J, Fritsch EF, Maniatis TA
(1989)
Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Sarkis JJ, Salto C
(1991)
Characterization of a syntaptosomal ATP diphosphohydrolases from the electric organ of Torpedo marmorata.
Brain Res Bull
26: 871-876
[CrossRef][Web of Science][Medline]
-
Somasegaran P, Hoben JH
(1994)
Handbook for Rhizobia. Springer-Verlag, New York
-
Thomas C, Sun Y, Naus K, Lloyd A, Roux SJ
(1999)
Apyrase functions in plant phosphate nutrition and mobilizes phosphate from extracellular ATP.
Plant Physiol
119: 543-551
[Abstract/Free Full Text]
-
Thompson JD, Higgins DG, Gibson TJ
(1994)
Clustal W:improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice.
Nucleic Acids Res
22: 4673-4680
[Abstract/Free Full Text]
-
Trieu AT, Burleigh SH, Kardailsky IV, Maldonado-Mendoza IE, Versaw WK, Blaylock LA, Shin H, Chiou T-J, Katagi H, Dewbre GR
(2000)
Transformation of Medicago truncatula via infiltration of seedlings or flowering plants with Agrobacterium.
Plant J
22: 531-542
[CrossRef][Web of Science][Medline]
-
von Heijne G
(1986)
A new method for predicting signal sequence cleave sites.
Nucleic Acids Res
14: 4683-4690
[Abstract/Free Full Text]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
M. Govindarajulu, S.-Y. Kim, M. Libault, R. H. Berg, K. Tanaka, G. Stacey, and C. G. Taylor
GS52 Ecto-Apyrase Plays a Critical Role during Soybean Nodulation
Plant Physiology,
February 1, 2009;
149(2):
994 - 1004.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Riewe, L. Grosman, A. R. Fernie, C. Wucke, and P. Geigenberger
The Potato-Specific Apyrase Is Apoplastically Localized and Has Influence on Gene Expression, Growth, and Development
Plant Physiology,
July 1, 2008;
147(3):
1092 - 1109.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. B. McAlvin and G. Stacey
Transgenic Expression of the Soybean Apyrase in Lotus japonicus Enhances Nodulation
Plant Physiology,
April 1, 2005;
137(4):
1456 - 1462.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Svistoonoff, L. Laplaze, J. Liang, A. Ribeiro, M. C. Gouveia, F. Auguy, P. Fevereiro, C. Franche, and D. Bogusz
Infection-Related Activation of the cg12 Promoter Is Conserved between Actinorhizal and Legume-Rhizobia Root Nodule Symbiosis
Plant Physiology,
October 1, 2004;
136(2):
3191 - 3197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-K. Choi, D. Kim, T. Uhm, E. Limpens, H. Lim, J.-H. Mun, P. Kalo, R. V. Penmetsa, A. Seres, O. Kulikova, et al.
A Sequence-Based Genetic Map of Medicago truncatula and Comparison of Marker Colinearity with M. sativa
Genetics,
March 1, 2004;
166(3):
1463 - 1502.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Steinebrunner, J. Wu, Y. Sun, A. Corbett, and S. J. Roux
Disruption of Apyrases Inhibits Pollen Germination in Arabidopsis
Plant Physiology,
April 1, 2003;
131(4):
1638 - 1647.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-T. Navarro-Gochicoa, S. Camut, A. Niebel, and J. V. Cullimore
Expression of the Apyrase-Like APY1 Genes in Roots of Medicago truncatula Is Induced Rapidly and Transiently by Stress and Not by Sinorhizobium meliloti or Nod Factors
Plant Physiology,
March 1, 2003;
131(3):
1124 - 1136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fedorova, J. van de Mortel, P. A. Matsumoto, J. Cho, C. D. Town, K. A. VandenBosch, J. S. Gantt, and C. P. Vance
Genome-Wide Identification of Nodule-Specific Transcripts in the Model Legume Medicago truncatula
Plant Physiology,
October 1, 2002;
130(2):
519 - 537.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|