|
Plant Physiol, June 2001, Vol. 126, pp. 656-669
The Heme-Oxygenase Family Required for Phytochrome Chromophore
Biosynthesis Is Necessary for Proper Photomorphogenesis in Higher
Plants1
Seth J.
Davis,2
Seong Hee
Bhoo,
Adam M.
Durski,
Joseph
M.
Walker, and
Richard D.
Vierstra*
Laboratory of Genetics, Cellular and Molecular Biology Program, and
the Department of Horticulture, University of Wisconsin, 1575 Linden
Drive, Madison, Wisconsin 53706
 |
ABSTRACT |
The committed step in the biosynthesis of the phytochrome
chromophore phytochromobilin involves the oxidative cleavage of heme by
a heme oxygenase (HO) to form biliverdin IX . Through positional
cloning of the photomorphogenic mutant hy1, the
Arabidopsis HO (designated AtHO1) responsible for much
of phytochromobilin synthesis recently was identified. Using the
AtHO1 sequence, we identified families of
HO genes in a number of plants that cluster into two
subfamilies (HO1- and HO2-like). The
tomato (Lycopersicon esculentum) yg-2 and
Nicotiana plumbaginifolia pew1 photomorphogenic mutants
are defective in specific HO genes. Phenotypic analysis of a T-DNA insertion mutant of Arabidopsis HO2 revealed
that the second HO subfamily also contributes to phytochromobilin
synthesis. Homozygous ho2-1 plants show decreased
chlorophyll accumulation, reduced growth rate, accelerated flowering
time, and reduced de-etiolation. A mixture of apo- and holo-phyA was
detected in etiolated ho2-1 seedlings, suggesting that
phytochromobilin is limiting in this mutant, even in the presence of
functional AtHO1. The patterns of Arabidopsis
HO1 and HO2 expression suggest that the
products of both genes overlap temporally and spatially. Taken
together, the family of HOs is important for phytochrome-mediated
development in a number of plants and that each family member may
uniquely contribute to the phytochromobilin pool needed to assemble
holo-phytochromes.
 |
INTRODUCTION |
The phytochrome (phy) family of
chromoproteins are photoreceptors that play critical roles in mediating
photomorphogenesis in higher plants (Neff et al., 2000 ; Smith, 2000 ).
The functional photoreceptors are homodimers with each subunit
containing the linear tetrapyrrole chromophore, (3E)-phytochromobilin
(P B), attached to an approximately 120-kD polypeptide. P B is
linked to apo-PHY through a thiol-ether bond to a specific Cys, using a
lyase activity intrinsic to the polypeptide. Holo-phys can assume two
stable conformations, a red light (R)-absorbing form (Pr) and a far-red
light (FR)-absorbing form (Pfr), which are photo-interconvertible by
the absorption of R and FR, respectively. By measuring the amount of
Pfr and the ratio of Pr to Pfr, plants assess the intensity, duration,
and spectral quality of the ambient light environment.
Assembly of holo-phys requires coordination of the pathways that
synthesize the PHY polypeptides and the P B chromophore. Whereas the
synthesis of the apoproteins is directed by a family of nuclear genes
(Smith, 2000 ), the synthesis of P B is directed by an enzymatic
cascade in the plastid that begins with 5-aminolevulinic acid (Terry et
al., 1995 ; Terry, 1997 ). The early steps in the P B pathway are
shared with those required to synthesize chlorophyll and heme. The
committed step is the oxidative cleavage of a portion of the heme pool
by a heme oxygenase (HO) to form biliverdin IX (BV). BV is then
reduced to (3Z)-P B by a ferredoxin-dependent bilin reductase
(Frankenberg et al., 2001 ). Finally, (3Z)-P B is isomerized to create
P B; however the phytochromobilin isomerase activity that is
responsible for this 3Z to 3E conversion has not yet been conclusively
demonstrated (Terry, 1997 ). Presumably, P B is then exported to the
cytoplasm where it binds to the newly synthesized apo-phys.
Photomorphogenic mutants have been isolated in a variety of plant
species that individually block either the PHY apoprotein or the
P B-synthetic pathways. For example, Arabidopsis mutations in four of
the five apoprotein-encoding genes have been identified: phyA, phyB, phyD, and phyE
(Somers et al., 1991 ; Parks and Quail, 1993 ; Aukerman et al., 1997 ;
Devlin et al., 1998 , 1999 ). Analysis of these mutants demonstrated that
each phy isoform has distinct and overlapping roles in light-regulated
development (Whitelam and Devlin, 1997 ; Neff et al., 2000 ). A number of
P B synthetic mutants also exist, and as predicted, these mutants
globally decrease the activity of all phy isoforms. Examples include
Arabidopsis long hypocotyl (hy)-1 and
2 (Parks and Quail, 1991 ), Nicotiana plumbaginifola
partly-etiolated-in-white-light
(pew)-1 and 2 (Kraepiel et al., 1994 ),
pea phy-chromophore-deficient (pcd)-1
and 2 (Weller et al., 1996 , 1997 ), tomato (Lycopersicon
esculentum) aurea (au) and
yellow-green (yg)-2 (Terry and
Kendrick, 1996 ), and rice photoperiodic sensitive
(se)-5 (Izawa et al., 2000 ). These mutants have
dramatically reduced levels of P B and consequently holo-phys, and
thus have severely impaired photomorphogenesis.
Analyses of several of the P B-synthetic mutants (hy1,
se5, pcd1, pew1, and yg-2)
suggested that they are specifically deficient in the HO activity(ies)
that synthesize BV. hy1 and pew1 plants can be
phenotypically rescued by feeding mutant seedlings BV (Parks and Quail,
1991 ; Kraepiel et al., 1994 ), whereas etioplast extracts from the
pcd1 and yg-2 mutants are unable to convert heme
to BV but are fully competent in converting BV into (3Z)-P B (Terry and Kendrick, 1996 ; Weller et al., 1996 ). By positional cloning of the
HY1 locus, Davis et al. (1999) and Muramoto et al. (1999) independently determined that HY1 encodes a HO (designated
AtHO1) responsible for much of P B synthesis in
Arabidopsis. Using the AtHO1 sequence, Izawa et al. (2000)
then demonstrated that a specific HO gene (designated here
as OsHO1) is also altered in the rice se-5 mutant.
However, it is known that young seedlings of all the P B mutants
retain residual R/FR sensitivity and, in some cases, they regain much
of their phy-regulated responses as they mature, suggesting that other
sources of P B are available. For example, tomato yg-2 mutants are compromised for most phy responses as young seedlings but
respond more similar to wild type as adult plants (Koorneef et al.,
1985 ; Kendrick et al., 1994 ; van Tuinen et al., 1996 ; Terry and
Kendrick, 1999 ). These new sources could arise from additional HOs or
from alternative pathways for making BV that become more prominent as
plants develop.
To help define the importance of P B to plant photomorphogenesis, we
have continued to characterize the HOs that synthesize the precursor of
this bilin. Using the AtHO1 sequence as a query, we show
here that most higher plants contain multiple HO genes. In
Arabidopsis for example, three more HO genes
(AtHO2-4) were identified in addition to AtHO1.
Analysis of the tomato yg-2 and Nicotiana
plumbaginifolia pew1 mutants demonstrated that each is defective
in a specific HO. To help define the roles of the other
members of the HO gene family, we isolated a T-DNA insertion mutant of AtHO2, the most divergent member of the
Arabidopsis HO family. From phenotypic analysis of
ho2-1, we found subtle phenotypes that resemble those seen
in the hy1 mutant. Collectively the data indicate that HOs
are important for proper photomorphogenesis in a number of plant
species and that the family of HOs may function in concert to generate
the supply of BV needed for holo-phy assembly.
 |
RESULTS |
Identification of HO Genes from Higher Plants
We and others recently identified the HO mainly responsible for
P B synthesis in Arabidopsis through the positional cloning of the
HY1 locus (Davis et al., 1999 ; Muramoto et al., 1999 ). (To
create a unified HO nomenclature within plants that agrees with that
used for HOs from other kingdoms, the various plant genes that encode
HOs were given the designation HO with a prefix that
identifies the species.) However, preliminary analysis of the
Arabidopsis genome indicated that other HO genes are
present, including one (designated AtHO2) only approximately
40 kb away from AtHO1 on chromosome II (Davis et al., 1999 ).
To help define the size and organization of the HO family in
plants and to identify conserved structural features among the
corresponding enzymes, we used the AtHO1 gene as a query to
search by blast all available DNA-sequence databases of higher-plant
species. Against the essentially complete Arabidopsis genome, we
identified numerous related sequences that condensed to four genes,
AtHO1 and 2 and two new genes designated AtHO 3 and 4. Putative HO genes were
identified from other plant species as expressed sequence tag (EST)
cDNAs, including soybean, tomato, wild tomato, potato, ice plant,
Medicago truncatula, Lotus joponicus, corn, rice,
sorghum, barley, wheat, and pine (Fig. 1;
data not shown). The rice HO1 gene, previously called
OsHY1 (and SE5) was recently described (Izawa et al., 2000 ).
The cDNAs for soybean GmHO1 and GmHO3, tomato
LeHO1 and 2, pine PtHO1, and sorghum
SbHO1 and 2 were sequenced in their entirety.
With the exception of soybean GmHO1 and 3 and
sorghum SbHO1, all these HO cDNAs were predicted
to contain the entire coding region. None appeared to be allelic
variants, suggesting that each clone represents an independent
gene.

View larger version (124K):
[in this window]
[in a new window]
|
Figure 1.
Amino acid sequence comparisons of various plant
HOs. Identical and similar residues are in reverse type or gray boxes,
respectively. The diamond identifies the predicted cleavage site for
the chloroplast-transit peptide. The black triangles denote the
beginning of the region in LeHO1 altered in the tomato
yg-2aud mutant and the T-DNA insertion site
in Arabidopsis ho2-1. The black and white circles mark the
histidines considered to be important for heme-iron binding and
catalysis and for protein stability, respectively. Sequences include
Arabidopsis (ectotype Col) AtHO1 (AF132475), AtHO2
(AF132475), AtHO3 (AF320022), and AtHO4 (AF320023); soybean
GmHO1 (AF320024) and GmHO3 (AF320025); rice
OsHO1 (C28969); sorghum SbHO1 (AF320026) and
SbHO2 (AF320027); pine PtHO1 (AF320030); and
tomato (cv Money-Maker) LeHO1 (AF320028) and
LeHO2 (AF320029). The XXX in the sequences of
GmHO1, GmHO3, and SbHO1 denotes the
ends of the inferred polypeptide sequence from their truncated
cDNAs.
|
|
As shown in Figure 1, amino acid sequence comparisons revealed that all
plant HOs have a non-conserved N-terminal extension of various lengths
that is followed by a approximately 220-amino acid region of high
similarity. The ChloroP algorhythm (Emanuelsson et al., 1999 ) predicted
that many of these N-terminal extensions encode transit peptides (data
not shown), consistent with the plastid location of HO activity in
plants (Terry et al., 1993 ; Muramoto et al., 1999 ). Following the
predicted transit-peptide is a region of substantial conservation that
is similar to the HO catalytic domain from animals, algae, and
cyanobacteria (Ortiz de Montelano and Wilks, 2001 ). Animal HOs have
hydrophobic C-terminal extensions that serve to anchor the enzymes to
microsomal membranes (Schuller et al., 1999 ). No such extensions were
evident in the plant counterparts, implying that they behave as soluble proteins.
Close examination of the plant HO sequences revealed that they cluster
into two subfamilies related to either AtHO1 or
AtHO2 (Figs. 1 and 2B). The
HO1 subfamily included Arabidopsis AtHO1, 3, and 4, soybean
GmHO1 and GmHO3, tomato LeHO1, sorghum
SbHO1, rice OsHO1, and pine PtHO1.
Representatives of the AtHO2 subfamily included Arabidopsis
AtHO2, tomato LeHO2, and sorghum
SbHO2. The main difference between the HO1 and 2 subfamilies
is a 34- to 55-amino acid spacer in the HO2s that replaces a small,
moderately conserved block of HO1 sequence (Fig. 1). The HO2 spacer is
rich in Glu and Asp and/or small amino acids (Gly, Ala, Val, and Ser), suggesting that it forms a flexible, solvent-exposed loop. The HO2
group also contains a potentially important change at the active site.
For animal HOs, a positionally conserved His is required for heme-iron
binding and subsequent oxidative cleavage (Ortiz de Montelano and
Wilks, 2001 ). This His is also retained in all algal and cyanobacterial
HOs and members of the plant HO1 subfamily but is replaced by an Arg in
the plant HO2 subfamily (Fig. 1). A second His needed for the
structural integrity of animal HOs (Ortiz de Montelano and Wilks, 2001 )
is present in all higher plant enzymes (Fig. 1).

View larger version (39K):
[in this window]
[in a new window]
|
Figure 2.
Genomic organization and phylogenetic
relationships of plant HOs. A, Genomic organization of Arabidopsis
AtHO1-4, rice OsHO1, and tomato LeHO1.
Boxes and lines denote coding regions and introns, respectively. Intron
lengths are not to scale. Numbers refer to the nucleotide-sequence
length of each domain. The gray boxes denote the positions of the
putative transit peptide sequences. The black and gray vertical lines
identify the locations of the histidines required for heme-iron binding
and protein structure, respectively. DNA sequence surrounding the
position of the yg-2aud mutation is
indicated and aligned with the wild-type LeHO1 sequence from
the AC cultivar. B, Phylogenetic comparisons of plant HOs with those
from animals, algae, and cyanobacteria. The distance along the
horizontal axis separating two sequences is proportional to their
sequence divergence. Plant HO sequences are from Figure 1. Others
include Synechocystis (Syn) HO1 (GenBank
accession no. D90091) and HO2 (GenBank accession no. D90912), R. violacea (Rv) HO1 (GenBank accession no. AF000717),
P. purpurea (Pp) HO (GenBank accession no.
P51271), and human (Hs) HO1 (GenBank accession no. P09601)
and HO2 (GenBank accession no. P30519).
|
|
Genomic Organization of Plant HO Genes
The genomic sequences of the four Arabidopsis HO genes
and the tomato LeHO1 and rice OsHO1 genes were
assembled and compared with their respective cDNAs to determine gene
organization. The coding regions of four of the five (the exception
being AtHO1, which contains only two introns) are
interrupted by three introns whose splicing boundaries are positionally
conserved (Fig. 2A). Moreover, the coding regions of the last three
exons of AtHO2, AtHO3, AtHO4,
LeHO1, and OsHO1 are the same length in each gene (224, 108, and 93 bp). Although AtHO1 contains only three
exons, its third exon is the exact sum (201 bp) of the third and fourth exons (108 + 93 bp) of the other plant HOs (Fig. 2A). The
similarity of this organization from widely divergent plants suggests
that plant HO genes arose early in higher plant evolution by
gene duplication events. Further, evolutionary pressures have
apparently maintained the exact sequence-length conservation seen in
the latter exons of plant HOs. Following the duplications
and divergence that created the Arabidopsis HO1 subfamily,
the AtHO1 gene presumably then lost its third intron.
The Evolutionary Relationships of Plant HOs to Those from Other
Organisms
A phylogenetic tree was constructed using all available
higher-plant HOs, two HOs from the cyanobacterium
Synechocystis sp. PCC 6803 (Cornejo et al., 1998 ), one each
from the alga Porphyra purpurea and Rhodella
violacea (Richaud and Zabulon, 1997 ), and two human HOs (Platt and
Nath, 1998 ). The results from the tree (Fig. 2B) confirmed expectations
based on visual inspection of the derived polypeptide sequences
(see Fig. 1) that plants have two subfamilies of HO genes,
HO1-like and HO2-like. Members of the
HO1 subfamily were detected in moncots, dicots, and a
gymnosperm with multiple forms present in Arabidopsis, suggesting that
this family is widespread in higher plants with each species
potentially containing multiple members. In contrast, members of the
HO2 subfamily were detected thus far only in angiosperms
with a single member present in Arabidopsis, suggesting that this
family arose more recently in plant evolution. Plant HOs as a group
appear to be distantly related to HOs from animals, alga, and
cyanobacteria. Their predicted evolutionary distance from
cyanobacterial HOs suggests that, contrary to expectations, plant HOs
did not originate from a cyanobacterial precursor during the symbiotic
evolution of the chloroplast. Alternative origins include retention of
a HO progenitor from the nuclear or mitochondrial genomes.
The Tomato yg-2 and N. plumbaginifolia pew1
Photomorphogenic Mutants Have Lesions in HOs
The tomato yg-2 mutants are phenotypically compromised
for a number of phy-regulated photoresponses. In addition to the
partially-etiolated phenotype of adult plants (as seen by their
yellow-green color; Fig. 3A), young
yg-2 seedlings have longer hypocotyls, repressed opening of
the apical hook, delayed cotyledon development, and attenuated
anthocyanin accumulation in R or white light (Fig. 3A; data not shown;
Koorneef et al., 1985 ; van Tuinen et al., 1996 ; Terry and Kendrick,
1999 ). Given the similarity of some yg-2 phenotypes to those
of Arabidopsis hy1 and the observations that yg-2
plants lack detectable HO activity (Terry and Kendrick, 1996 ), we
considered it likely that the yg-2 plants contain a lesion
in a HO gene. The most likely candidate would be
LeHO1, an ortholog of AtHO1 (Fig. 1).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 3.
Phenotypic comparison of the tomato
yg-2aud and N. plumbaginifolia
pew1 mutants. A, Wild-type (WT) and
yg-2aud tomato plants grown for 2 weeks
under continuous R (left) or for 4 weeks in a greenhouse under natural
lighting (right). B, Complementation of the pew1 mutation by
introducing Arabidopsis AtHO1. The pew1 mutant
and three T1 lines of pew1
independently transformed with a genomic fragment encompassing
AtHO1 (labeled 1-3) were grown for 2 months under
continuous white light.
|
|
To test whether LeHO1 is defective in the yg-2
mutants, the LeHO1 locus was PCR amplified from genomic DNA
isolated from the cv Ailsa Craig (AC) wild type and the AC-derived
yg-2aud mutant and the products were
directly sequenced. For the coding region, the LeHO1 gene
sequence from the AC variety matched exactly with the corresponding
LeHO1 cDNA sequence derived from the cv Money-Maker tomato
variety presented in Figure 1. Comparing the LeHO1
sequence from the AC wild type with that of the
yg-2aud mutant revealed a 51-bp deletion
and a 1-bp insertion within the coding region, 303 bp downstream of the
initiation codon (Fig. 2A). This alteration in
yg-2aud predicted a LeHO1
protein that was missing the C-terminal 178 amino acids (78% of the
mature protein) and had a foreign sequence of 23 amino acids
(ANWFMILWKELWKRLLFLSVSFS) added. Given the importance of the C-terminal
region for the activity of animal HOs (Ortiz de Montelano and Wilks,
2001 ) and the fact that even less pronounced truncations of
AtHO1 abrogate its function in the Arabidopsis hy1 mutants (Davis et al., 1999 ; Muramoto et al., 1999 ), the
yg-2aud mutant likely represents a null
allele of LeHO1.
In many respects, the N. plumbaginifolia pew1 mutant is
phenotypically similar to Arabidopsis hy1 and tomato
yg-2, including an etiolated stature and a yellow-green
color for mature plants grown under photoperiodic or continuous light
(Fig. 3B; data not shown; Kraepiel et al., 1994 ). Because a near
wild-type phenotype can be restored when pew1 plants are fed
BV, it is likely that the mutation affects one or more HOs (Kraepiel et
al., 1994 ). To test this directly, we tried to PCR-amplify N. plumbaginifolia HO genes from wild type and pew1 using
degenerate primers homologous to conserved regions within the plant
HO family. Despite repeated attempts using a number of
primer combinations with both genomic and reverse transcriptase (RT)
DNA preparations, we were unable to amplify any HO sequences.
As an alternative, we examined whether introduction of the Arabidopsis
AtHO1 gene would complement the pew1 mutation. A
genomic fragment, encompassing the entire AtHO1 coding
region and substantial portions of the 5'- and 3'-flanking regions, was
introduced into the pew1 mutant, and the resulting
T1 plants were phenotypically analyzed. We
previously showed that this construction could phenotypically rescue
the Arabidopsis hy1 mutant (Davis et al., 1999 ). As can be
seen in Figure 3B, multiple pew1 plants independently
transformed with the AtHO1 gene lost their etiolated
phenotype and became dark green with compressed internodes, the
expected phenotype of wild-type N. plumbaginifolia. This
restoration indicated that the pew1 mutant is likely
deficient in one or more HOs. Moreover, it showed that the regulatory
elements necessary for AtHO1 expression were sufficiently
active in N. plumbaginifolia to supply an adequate level of
HO protein for normal photomorphogenesis.
Isolation of the ho2-1 Mutation in Arabidopsis
Both the presence of multiple HO genes (Fig. 1) and the
retention of some phy responses in the absence of one HO (Kraepiel et
al., 1994 ; Terry and Kendrick, 1996 ; Davis et al., 1999 ; Muramoto et
al., 1999 ; Izawa et al., 2000 ; Figure 3) suggested that one or more
additional HOs contribute to P B synthesis in plants. To test this
possibility, we examined the role of Arabidopsis AtHO2, the
most distantly related HO with respect to AtHO1 (Fig. 2B)
through characterization of the corresponding mutant. This ho2-1 mutant was identified via a PCR-based search of a
population of T-DNA mutagenized Arabidopsis ecotype Wassilewskija (WS)
for insertions within the AtHO2 gene (Krysan et al., 1999 ).
The NPTII gene within the T-DNA disrupting AtHO2
conferred kanamycin resistance, thus facilitating future selection of
ho2-1 plants. This resistance segregated as a single
dominant locus with a 3:1 segregation ratio when heterozygous
ho2-1 plants were selfed, indicating that the line likely
contained a single insertion. Sequence analysis revealed that the T-DNA
interrupted the 98th codon such that translation of the
AtHO2 sequence ended 9-residues downstream of the predicted Arg active site (Fig. 1). Given the strong effects caused by similar mutations in the Arabidopsis and tomato HO1 loci
hy1 and yg-2aud (see above), we
considered it likely that ho2-1 is a null allele.
Effects of the ho2-1 Mutation on
Photomorphogenesis
Phenotypic analysis of the ho2-1 mutant revealed that
the AtHO2 protein, like AtHO1, also contributes
to the proper photomorphogenesis of Arabidopsis, but has a more subtle
role. One of the more obvious defects in hy1 plants missing
AtHO1, which led to its isolation (Koornneef et al., 1980 ),
is an elongated hypocotyl when grown under continuous R or FR (Parks
and Quail, 1991 ; Davis et al., 1999 ). As shown in Figure
4, increased fluences of R or FR
substantially repressed hypocotyl growth of young wild-type Col
seedlings. In contrast, the hy1-100 seedlings (in the Col
background) showed near complete insensitivity and continued to
elongate regardless of the light fluence. For the ho2-1
mutant, the effect of light on hypocotyl elongation was less dramatic,
but reproducible. As compared with the wild-type WS background,
ho2-1 seedlings were slightly less sensitive to R and FR,
especially at the higher fluences tested (Fig. 4). The etiolated
ho2-1 seedlings also retained partially closed cotyledons
when grown under low fluences of R or FR (data not shown), a phenotype
also observed with hy1 seedlings (Chory et al.,
1989 ).

View larger version (49K):
[in this window]
[in a new window]
|
Figure 4.
Effect of increasing fluence rates of R or FR on
hypocotyl elongation of hy1-100 and ho2-1
Arabidopsis. Seedlings were germinated on agar and irradiated with
various fluences of continuous R or FR. After 6 d, the hypocotyl
lengths were measured. Each bar represents the average hypocotyl length
(±SD) of approximately 15 seedlings. The
respective wild-type parental ecotype of each mutant is included for
comparison (Col for hy1-100 and WS for
ho2-1).
|
|
As ho2-1 plants developed under white-light growth
conditions, it became obvious that they had smaller rosette leaves and were slightly chlorotic as compared with wild-type plants (Fig. 5; Table
I). Similar, but more dramatic phenotypes
have been well described for hy1 plants (Chory et al.,
1989 ). Chlorosis of hy1 is caused by both a reduction in
total chlorophyll (Chl) and an alteration in the ChlA to B ratio, and
by a lower number of chloroplasts per cell. To quantitate this
chlorotic effect, ho2-1 and hy1-100 plants and
their respective WS and Col parents were grown for 3 weeks under a
long-day photoperiod, and then the levels of ChlA and B were measured.
As expected, hy1 plants had markedly reduced levels of both
ChlA and B (15% of wild type) and a skewed ratio of ChlA to B (Table
I). Although not affected to the same extent, ho2-1 plants
also had reduced levels of total chlorophyll (91% of wild type), but
the ratio of Chl A to B was essentially unchanged (Table I). While a
lower number of chloroplasts per cell was seen in hy1-100,
the number of chloroplasts per cell was unaffected in the
ho2-1 plants (Table I), suggesting that the change in Chl
was caused primarily by a decrease in Chl content.

View larger version (62K):
[in this window]
[in a new window]
|
Figure 5.
Phenotype of light-grown Arabidopsis
hy1-100 and ho2-1 seedlings. The respective
wild-type parental ecotype of each mutant is included for comparison
(Col for hy1-100 and WS for ho2-1). Plants were
grown for 3 weeks under white light with a short-day photoperiod.
|
|
The transition of vegetative to reproductive development in Arabidopsis
is controlled by multiple phys and hence is sensitive to mutations that
effect the synthesis of either the PHY apoproteins or P B (Murtas and
Millar, 2000 ; Neff et al., 2000 ; Smith, 2000 ). For example, it has been
well documented that hy1 plants flower earlier than
wild-type (Chory et al., 1989 ) (Table I). Because hy1 and
ho2-1 plants grow slower than their respective wild types, floral transition cannot be accurately quantified by time but must be
quantified by developmental parameters such as the number of rosette
leaves generated before bolting (Amasino, 1996 ; Michaels and Amasino,
1999 ). Using this criterion, we found that ho2-1 plants also
flowered earlier than wild-type in both long days and short days (Table
I). For example, under short days the hy1-100 plants
initiated flowering at 25 leaves versus 45 leaves for the Col parent.
The ho2-1 plants initiated flowering at 28 leaves versus 35 leaves for the WS parent.
In an attempt to isolate an Arabidopsis mutant deficient in both
AtHO1 and AtHO2, we tried to construct a double
homozygous line bearing both the hy1-100 and
ho2-1 alleles. To overcome the fact that AtHO1
and 2 are within 40 kb of each other on chromosome II (Davis
et al., 1999 ), we generated an F1 hybrid with
hy1-100 and ho2-1 in repulsion. Then the
F2 progeny were searched for those with long
hypocotyls in white light (homozygous for the hy1-100
mutation) and kanamycin resistant (homo- or heterozygous for the
ho2-1 T-DNA insertion). Despite repeat attempts and analysis of >500,000 F2 progeny, no lines displaying this
phenotype, and thus having the hy1-100 mutation potentially
coupled to ho2-1, were identified. Whether this failure
indicates that the phenotype of hy1/hy1 ho2-1/+ plants are
different from hy1/hy1 plants or that germ cells or plants
missing both AtHO1 and 2 are inviable is not yet known.
Assembly of the phyA Holoprotein Is Compromised in
ho2-1
The collective phenotypes of the ho2-1 plants suggested
that they, like the hy1 plants, have reduced levels of
holo-phys caused by a decrease in P B synthesis. For hy1,
the reduction is dramatic, as these plants lack detectable holo-phyA,
despite containing high levels of the apoprotein (Parks et al., 1989 ;
Parks and Quail, 1991 ). However, for ho2-1, the effect is
likely to be more subtle consistent with the milder phenotypic changes.
In an attempt to detect apo-PHYs, crude extracts prepared from
etiolated seedlings of the mutant and wild-type lines were
subjected to SDS-PAGE followed by an in-gel zinc-induced
fluorescence assay to quantitate the amount of holo-phys that contain a
bound P B chromophore, and by immunoblot analysis to measure the
levels of the phyA protein (Bhoo et al., 1997 ). Because phyA is the
predominant phy in etiolated seedlings, its measurement essentially
reflects that of the total phy pool (Quail et al., 1995 ; Whitelam and
Devlin, 1997 ). As shown in Figure 6, A
and B, etiolated hy1-100 seedlings had high levels of the
PHYA polypeptide but undetectable levels of holo-phy containing bound
P B. In contrast, ho2-1 seedlings had significant levels of holo-phy containing P B, but this level was reduced relative to
that of the wild-type WS parent. When equal amounts of phyA protein (as
determined by immunoblot analysis) were subjected to SDS-PAGE, a 20%
reduction in the level of holo-phy containing P B was evident (Fig.
6, A and B). A similar attenuation in the assembly of the other
Arabidopsis holo-phys (phyB-E) is expected, but was not
examined.

View larger version (56K):
[in this window]
[in a new window]
|
Figure 6.
Detection of apo-phyA in ho2-1
seedlings. A, Detection of the phyA protein and bound P B chromophore
in wild-type ecotype WS (WT), hy1-100, and ho2-1
seedlings. Crude extracts were prepared from 4-d-old etiolated
seedlings and subjected to immunoblot analysis with the anti-phyA
monoclonal antibody O73D (top) or assayed for bound P B by
zinc-induced fluorescence (lower). B, Quantitation of the levels of
bound P B per phyA protein. Signals obtained from A were quantitated
by densitometric scans of the gels. Values (±SD)
were expressed relative to those from WT. C, R-light induced
degradation of phyA in etiolated seedlings of WT and ho2-1.
Etiolated seedlings were irradiated continuously with R. At various
times, crude extracts were prepared and subjected to immunoblot
analysis with the anti-phyA monoclonal antibody O73D; an equal amount
of seedlings (grams fresh weight) was analyzed for each sample.
|
|
It has been shown previously that the PHYA apoprotein is stable, but
the holoprotein is rapidly degraded when converted to Pfr (Clough and
Vierstra, 1997 ). We consequently used this stability as an indirect
test to confirm the presence of apo-PHYs in the ho2-1
background. Dark-grown WS wild-type, ho2-1, and
hy1-100 seedlings were irradiated continuously with R, and
at various times the amount of phyA polypeptide was assayed by
immunoblot analysis. Consistent with previous studies (Parks et al.,
1989 ), phyA was rapidly degraded in wild-type Arabidopsis seedlings
with almost all removed within 8 h after the onset of R, whereas
apo-PHYA remained stable in the hy1-100 seedlings (Fig. 6C
and data not shown). For ho2-1 seedlings, phyA degradation
was observed after R, but its overall rate was noticeably slower than
that of wild-type (Fig. 6C). This attenuation was especially evident
4 h after the onset of R when the residual levels of the phyA
polypeptide were 4 to 5 times higher than that observed for wild type.
The slower degradation rate in the ho2-1 mutant background
is indicative of a phyA pool containing a mixture of apo- and
holo-protein. We also noticed that most of the phyA protein in the
ho2-1 seedlings was degraded following prolonged R
irradiations (Fig. 6C). This effect may indicate that the pool of
apo-PHYA eventually acquired P B by recycling previously bound P B
or from new synthesis.
Expression of Arabidopsis HO1 and 2 and
Overlaps
To help understand how both AtHO1 and 2 contribute to P B synthesis and thus holo-phy assembly, the
expression patterns of the two genes were compared. Fusions of the
AtHO1 and 2 promoters with the coding region of
-glucuronidase (GUS) were introduced into Arabidopsis and the
expression patterns observed by histochemical staining for GUS
(Jefferson et al., 1987 ; Thoma, et al., 1996 ). To ensure that all 5'
regulatory sequences were included, the promoter regions used began
immediately after the translation stop codon of the upstream annotated
gene and ended at the start codon of AtHO1 or 2.
The 5'-HO2-GUS reporter was introduced into the
wild-type Col and the hy1-100 backgrounds, and the
5'HO1-GUS reporter was introduced into the
wild-type WS and the ho2-1 backgrounds to examine the
potential effects that each HO (and indirectly the resulting holo-phys)
may have on the expression of the other HO gene.
The GUS staining patterns of 5'-HO1-GUS and
5'-HO2-GUS in etiolated and green seedlings are
shown in Figure 7. In general, the
expression patterns overlapped considerably, but in all cases 5'-HO1-GUS consistently gave higher staining,
consistent with the predicted higher expression of the corresponding
gene. Etiolated seedlings harboring either transgene stained for GUS in
most tissue types including seed coat, cotyledons, apical hook, and
hypocotyls (Fig. 7). Highest staining was observed in the vasculature
and the hypocotyl/root junction and associated root hairs. Little or no
staining was observed in the roots and root tips. This overall pattern
was similar to that reported for the overlapping expression patterns of
the PHYA and B transcripts with the notable
exception that the PHY genes also are actively expressed in
roots, especially in the root tips of etiolated plants (Somers and
Quail, 1995 ; Neff et al., 2000 ). For green seedlings, widespread GUS
staining was also observed for AtHO1 and 2 (Fig.
7). Pronounced staining of the leaf and cotyledon vasculature was
evident. Highest expression was in the root and tissues surrounding the
shoot apex. Whereas, newly initiated roots tips showed high expression,
much weaker expression was seen in the tips as the roots elongated
(Fig. 7).

View larger version (77K):
[in this window]
[in a new window]
|
Figure 7.
Expression patterns of AtHO1 and
2 using promoter-GUS fusions. The coding region for GUS,
under the control of either the AtHO1 or the
AtHO2 promoter, was introduced into wild-type WS
(AtHO1) or wild-type Col (AtHO2). Plants were
stained for GUS activity using the substrate 5-bromo-4-chloro-3-indolyl
-D-GlcUA; staining times for AtHO2
plants were increased to provide staining equivalent to that of
AtHO1 plants. Top, Ten-day-old light-grown plants. Insert
shows a magnification of a root tip. Bottom, Etiolated 4-d-old
seedlings. Arrows point to cotyledons (cot), hypocotyls (hy), leaf
(lf), roots (r), root tip (rt), and seed (sd).
|
|
When either 5'-HO1-GUS or
5'-HO2-GUS was introduced into the homozygous
ho2-1 or hy1-100 backgrounds, respectively, a
similar distribution of GUS staining among the various tissues was
detected (data not shown). The overall levels of expression for
5'-HO1-GUS were indistinguishable for the WS and
ho2-1 backgrounds. However, we noticed from comparing
multiple independently transformed lines that expression of
5'-HO2-GUS was markedly reduced in
hy1-100 plants as compared with corresponding Col wild type
(data not shown), suggesting that AtHO1 (and indirectly
phys) is required for optimal AtHO2 expression.
 |
DISCUSSION |
HOs are an important family of enzymes required for synthesis of
the phy-chromophore P B and thus proper photomorphogenesis in plants.
We show here that a number of higher plants contain a family of HOs
that are highly related to each other, and by a lesser extent, to those
in cyanobacteria, algae, and animals. In individual plant species, HOs
are encoded by a small gene family; in Arabidopsis, four HO
genes are present. Consistent with biochemical data, sequence analysis
suggests that all the plant HOs are soluble and likely localized in
plastids. The approximately 220-amino acid catalytic domain from each
plant enzyme is strongly similar to mammalian HOs, suggesting that
plant HOs assume the same three-dimensional structure as that of human
HO1 (Schuller et al., 1999 ).
Because the various higher-plant HO mutants retain some phy
responsiveness, especially as the plants mature, it has been proposed that alternative sources of BV exist (Terry and Kendrick, 1996 ; Davis
et al., 1999 ; Izawa et al., 2000 ). We can now explain this effect, at
least in part, by the presence of multiple HO isoforms, each with
potentially different roles or expression patterns. Studies using
promoter-GUS fusions indicate that two HO genes from Arabidopsis (AtHO1
and 2) are expressed simultaneously in a pattern that often parallels
those of PHYA and B (Somers and Quail, 1995 ),
indicating that they both can be important sources of P B for
holo-phy assembly. Phylogenetic analyses suggest that higher plant
HOs arose from a common progenitor that then generated the
various members by gene duplication and divergence. During this
evolution, a second type of HO emerged
(HO2-like). To date, we have found members of the
HO2 subfamily only in moncotyledonous and dicotyledonous
species, suggesting perhaps that this HO type is restricted
to flowering plants. Although not yet tested, we assume that
HO2s will convert heme to BV given their strong similarity to members of the HO1 family and our observations that the Arabidopsis ho2-1 mutant has detectable amounts of apo-phy.
The HO2 subfamily members contain two possibly important changes that
could affect their activity, a substitution of an Arg for a His at the
putative heme-iron-binding site (Ortiz de Montelano and Wilks, 2001 )
and an insertion of a hydrophilic and predicted flexible domain just
distal to this active site. Using the structure of human HO1 as a
template (Schuller et al., 1999 ), we expect that this insertion in HO2
sequences forms a solvent-exposed extended loop (data not shown).
Whether these sequence changes affect the catalytic activity or
specificity of the enzyme is not clear. For other HOs, it has been
shown that specific types can use different sources of reducing power
during cleavage of the heme -methene bridge. For example,
AtHO1 from Arabidopsis and a chloroplast HO from the alga
Cyanidium caldarium are ferrodoxin-dependent (Cornejo et
al., 1998 ; Muramoto et al., 1999 ), whereas the microsomal HOs from
animals require NADPH cytochrome-c reductase (Ortiz de Montelano and
Wilks, 2001 ). Thus, it is conceivable that plant HO2s use a different
reductant than that used by the HO1-like enzymes. The sequence
differences, alternatively, could allow the HO1 and HO2 protein
subfamilies to interact with distinct regulatory factors in a way that
provides differential control of the enzymes (e.g. activity in the
light versus the dark). We also note that the N-terminal extensions for
the HO2 sequences are rich in prolines and hydrophillic amino acids,
residues not commonly found in transit peptides. Thus the plastid
location of HO2s remains in question.
Previous studies by us and others showed that the Arabidopsis
hy1 and the rice se5 (Izawa et al., 2000 )
photomorphogenic mutants are defective in specific HO genes.
Here, we extend the importance of HOs with the observations
that tomato yg2 and N. plumbaginifolia pew1
mutants are also deficient in HO activity. Whereas, the
yg-2aud mutation was mapped to the
LeHO1 gene, a defect in one or more HOs in pew1
was inferred by complementation of the pew1 phenotype with
wild-type Arabidopsis HO1. Although the pew1
mutation could be within a trans-acting factor that regulates
HO expression, a more likely possibility is that the
pew1 mutation inactivates a prominent HO gene,
based on the similarity of the phenotype to that of HO
mutants in other plant species (Chory et al., 1989 ; Parks and Quail,
1991 ; Terry and Kendrick, 1996 ; Izawa et al., 2000 ). As Arabidopsis
HO1 complements pew1, we predict that this prominent N. plumbaginifolia HO is orthologous to
AtHO1.
It is interesting that hy1, se5, and
yg-2 (and possibly pew1) bear defects in members
of the HO1 subfamily, suggesting that this subfamily (and
possibly the affected HO1 genes in particular) is
responsible for much of the BV synthesis in plants. In support, levels
of holo-phy are undetectable in the hy1-100 and
se5 backgrounds (Fig. 6; Izawa et al., 2000 ), indicating
that very low levels of P B are synthesized in these mutants. A more
dominant role also can be inferred from the genomic organization and
expression levels of HO1- versus HO2-like genes.
Whereas, Arabidopsis contains three members of the HO1
subfamily, it only has a single HO2 gene. The relative
abundance of AtHO1 sequences in the EST databases, intensity
of mRNA signals by RNA gel-blot analysis, and GUS staining of plants
bearing AtHO1- or AtHO2-promoter GUS fusions also
indicate that the AtHO1 gene in particular is expressed more
strongly than AtHO2 (data not shown; Fig. 7). cDNAs for both
AtHO3 and 4 have been detected by RT-PCR of
Arabidopsis mRNA, indicating that these members of the Arabidopsis
HO1 subfamily are also expressed. Sequence comparisons
suggest that the encoded AtHO3 and 4 proteins are also
plastid localized, but their relative contributions to total HO
activity and their expression patterns are not yet known. The observation that little holo-phyA accumulates in hy1-100
mutant seedlings, lacking just AtHO1, implies that
AtHO3 and 4 must have a more specialized role(s)
in P B synthesis in Arabidopsis. One possibility is that
AtHO3 and 4 are expressed in root tips, a tissue
known to contain active phys but appears to express AtHO1 and 2 poorly. The identification of mutants in
AtHO3 and 4 will be critical toward answering
this question.
Although previous data indicated that AtHO1 has a prominent
role in P B synthesis and proper photomorphogenesis, our data from
the Arabidopsis ho2-1 mutant indicates that the
AtHO2 subfamily is also important. Subtle, but reproducible
attenuation of a variety of photomorphogenic responses controlled by
phys was evident in homozygous ho2-1 plants. These defects
included reduced hypocotyl photosensitivity, reduced leaf size,
accelerated flowering time, and decreased chlorophyll accumulation.
These pleiotropic phenotypes were observed in etiolated seedlings, and
in young and more mature green plants, indicating that AtHO2
has roles throughout the Arabidopsis life cycle.
The exact role(s) of AtHO2 are not yet clear. That the
ho2-1 phenotypes appear similar (although less dramatic) to
those of hy1 plants (this study; Chory et al., 1989 ; Parks
and Quail, 1991 ; Davis et al., 1999 ; Muramoto et al., 1999 ), indicates
that AtHO1 and 2 may have overlapping functions in the same
physiological processes. Certainly the detection of a pool of apo-PHYA
not bearing chromophore in ho2-1 plants indicates that
AtHO2 also contributes directly or indirectly to the pool of
P B used to assembly holo-phys. However, given that holo-phys are
undetectable in hy1 plants containing a functional
AtHO2, it is clear that AtHO2 cannot compensate
for a loss of AtHO1 and thus serves a non-redundant
function. One possibility is that AtHO1 and 2 have
tissue/cell-specific functions. However, we consider this unlikely
given the substantial overlap of their expression patterns. Others
include distinct subcellular locations, different modes of regulation,
and/or biochemical functions other than or in addition to P B
synthesis. Given that the N-terminal extensions for the HO2 family do
not fit the typical transit peptide sequence, it remains possible that
HO2s are not plastid localized. Moreover, sequence differences at and
surrounding the active site could reflect distinct enzymatic
properties. For example, one HO could be activated by or require a
reductant produced by the photosynthetic light reactions (e.g.
ferrodoxin/thioredoxin) (Schürman and Jacquot, 2000 ), whereas the
other could be constitutively active and/or require a reductant made in
both the light and dark. And finally, we cannot rule out the
possibility that HO1 and 2 have completely different biochemical
functions. For example, one could be responsible for most of P B
synthesis, whereas the other could play a role in the metabolism of
chlorophyll and/or other tetrapyrroles.
The discovery that AtHO1 and 2 have overlapping,
yet distinct roles in P B biosynthesis and phy-regulated
photomorphogenesis illustrates the importance of chromophore abundance
in regulating photoreceptor activity. Further characterization of
AtHO2 should reveal interesting physiological
functions for this enzyme. For instance, it will be worth investigating
what role(s) AtHO2 have in other phy-regulated responses,
including shade-avoidance, anthocyanin production, setting the
circadian clock, and plant senescence (van Tuinen et al., 1996 ; Neff et
al., 2000 ; Smith, 2000 ;). One obvious genetic experiment is to
phenotypically analyze mutants homozygous for both hy1 and
ho2. However, we have been unable to assemble this
combination, possibly due to the extremely close linkage of the two
genes (Davis et al., 1999 ). It is clear that the complete contribution
of the HO gene family to plant photomorphogenesis will be
revealed only through the analysis of loss-of-function alleles at each
of the HO loci singly and in combinations.
 |
MATERIALS AND METHODS |
Isolation and Analysis of HO Genes from Plants
Plant HO genes were identified by searching the
EST databases at http://www.ncbi.nlm.nih.gov/BLAST using the Blast
computer algorithm (Altschul et al., 1990 ) for translated sequences
related to AtHO1 (Davis et al., 1999 ; Muramoto et al.,
1999 ). cDNAs for soybean GmHO1 and 3,
tomato LeHO1 and 2, pine
PtHO1, and sorghum SbHO1 and
2 were provided by Genome Systems (St. Louis), Clemson University Genomic Institute (Clemson, SC), Dr. Ross Whetten (North Carolina State University, Raleigh, NC), and Dr. Marie-Michéle Cordonnier-Pratt (University of Georgia, Athens, GA), respectively. The
complete sequence of each cDNA was determined using Big-Dye Chemistry
(Perkin Elmer, Foster City, CA). The genomic sequences for
AtHO3 and AtHO4 in Arabidopsis ecotype
Columbia-0 (Col) were identified by blast searches at
http://www.Arabidopsis.org/blast. Their cDNAs were isolated by RT-PCR
from a cDNA pool prepared from rosette-leaf total RNA using the
AtHO3 oligonucleotides CTCAATTCGTGTGTGTGTATGTTGCAG and
CTATTGAAGATCTGAAGGTTTATGAATC and the AtHO4
oligonucleotides TATTGCAGTTTGCGTGTCTATTAGATTGC and
CTTTTTGTTGCCACCGGAAGCTCATCAC. These primers anneal just outside of the
predicted coding region. The PCR products were sequenced directly.
Contig assembly and sequence analysis used the fragment assembly system
(University of Wisconsin-Genetics Computer Group, Madison).
Derived amino acid sequences were compared using the GCG program
Pileup, and viewed with Macboxshade (Institute for Animal Health,
Pirbright Surrey, UK). Phylogentic analysis of the HO sequences was
accomplished by using the Growtree program (UW-GCG).
Characterization of Tomato yg-2
The tomato (Lycopersicon esculentum) lines AC and
yg-2aud in the AC background were obtained
from Dr. Matthew Terry (University of Southampton, Southampton, UK).
Seedlings were grown on filter paper and irradiated continuously with R
or grown to adulthood in soil under greenhouse conditions.
To characterize the YG-2 locus (designated here as
LeHO1), genomic DNA was prepared (Davis et al., 1999 )
from the AC wild-type tomato variety and its derived mutant
yg-2aud (Terry and Kendrick, 1996 ; van
Tuinen et al., 1996 ). LeHO1 was PCR amplified from this
DNA using the primers, GGTTAATCTGTCCTTTTCACTTCTC and
ACCTTTCAACCATCCAATGTACAAG, which annealed immediately before the
predicted initiating Met codon and immediately after the predicted translational termination codon of LeHO1, respectively.
The resulting approximately 3.0-kb products were gel purified and
directly sequenced using gene-specific primers that were designed based
on the LeHO1 cDNA sequence.
Transformation of N. plumbaginifolia pew1 with
AtHO1
A 3.3-kb genomic fragment of AtHO1 (Davis et al.,
1999 ) encompassing the entire translated region, 1.1 kb of 5'-flanking
and 0.6 kb of 3'-flanking region was PCR amplified with
Pfu polymerase (Stratagene, La Jolla, CA) from
Arabidopsis (Col ectotype) genomic DNA and cloned into the
EcoRV site of pPZP211 (Hajdukiewicz et al., 1994 ).
N. plumbaginifolia pew1 was obtained from Dr. Marc Jullien (Institut National de la Recherche Agronomique, Versailles, France) (Kraepiel et al., 1994 ). AtHO1 was introduced
into pew1 by Agrobacterium-mediated
transformation of leaf discs with the Agrobacterium
tumefaciens strain ABI (Clough et al., 1999 ). Transformed plants were selected by kanamycin resistance. T1 plants
were grown under continuous white light.
Identification of the Arabidopsis T-DNA Mutant
ho2-1
DNA pools from The University of Wisconsin Biotechnology-Center
T-DNA collection, assembled from approximately 60,000 independent Arabidopsis ecotype WS transformants, were screened by PCR for a T-DNA
insertion within AtHO2. PCR reactions included the gene specific primers, AGTGAAGGCAGCGTCTATCTTGGTC-GTCGG
(HO2-5') and CTGGTGCCGGAAACTGTTAACT-TTAAAACC
(HO2-3'), in combination with the T-DNA left-border (LB)
primer GATGCACTCGAAAATCAGCCAATTTTAGAC and the right border (RB) primer
TCCTTCAATCGTTGCGGTTCTGTCAGTTC (Krysan et al., 1996 ; Krysan et al.,
1999 ). Correct PCR products were confirmed as described (Krysan et al.,
1999 ) by DNA gel-blot analysis using 32P-labeled
AtHO2 sequence as the probe. ho2-1 was
identified in pool 11B-10 using the RB primer in conjunction with the
HO2-3' primer. An individual ho2-1 was
located in plate 2,016. That both the 5'- and 3'-ho2-1
PCR products were amplified with the RB primer indicated that two T-DNA
RBs were present, suggestive of a tandem T-DNA insertion in
AtHO2 with one insert inverted relative to the other.
The ho2-1 line was backcrossed once to the WS wild type,
and in the F2 generation, homozygous ho2-1
plants were identified by PCR. In these ho2-1 plants, an
AtHO2 PCR product was produced using the primers
HO2-3' and RB, but not when the HO2-5'
and HO2-3' primers were used. F3 seeds from
several independent F2 homozygous-mutant plants were bulked
for phenotypic characterization of ho2-1.
Phenotypic Analysis of ho2-1
Arabidopsis ecotypes Col-0 and WS were obtained from Dr. Richard
Amasino (University of Wisconsin, Madison, WI). The
hy1-100 line in the Col background (Davis et al., 1999 )
was obtained from the Arabidopsis Biological Resource Center (Ohio
State University, Columbus, OH). For hypocotyl-growth assays, seeds
were plated on solid one-half-strength Murashige and Skoog medium
without Suc or vitamins (2.2 g L 1 Murashige and Skoog
salts [Life Technologies/Gibco-BRL, Gaithersburg, MD], 2.5 mM 2-[N-morpholino]ethanesulfonic acid, pH
5.7, 0.8% [w/v] agar). These plates were stored in the dark
for 3 d at 4°C and then irradiated continuously with R or FR at
22°C as described (Jordan et al., 1996 ). Hypocotyl lengths after
6 d of growth were measured from computer-scanned images. For
analysis of mature plants, seeds were stratified for 4 d at 4°C
and then sown directly on soil. For flowering-time measurements, plants
were grown at 20°C under approximately 25 µmol m 2
s 1 white light in either a 20-h-light/4-h-dark
photoperiod for long days or an 8-h-light/16-h-dark photoperiod for
short days. For chlorophyll assays, plants were grown in the long-day
photoperiod for 14 d. Chlorophylls were extracted from rosette
leaves by methanol (1 mL/100 mg tissue) and quantitated
spectrophotometrically by the revised method of Porra et al.
(1989) .
phyA Quantification
Arabidopsis seeds were placed on one-half-strength Murashige and
Skoog agar plates, incubated at 4°C for 3 d, and transferred to
approximately 22°C for growth in the dark. After 4 d of growth, the seedlings were frozen at liquid-nitrogen temperatures, ground with
a mortar and pestle, and suspended at 2 mL g 1 fresh
weight in 37.5% (v/v) ethylene glycol, 75 mM
Tris-HCl (pH 8.3, 4°C), 7.5 mM Na4 EDTA, 15 mM NaS2O5, 0.11% (v/v)
polyethylenimine, and 1.5 mM phenylmethylsulfonyl fluoride
(Jordan et al., 1996 ). The resulting extract was clarified by
centrifugation at 16,000g for 30 min, and the soluble
proteins were subjected to SDS-PAGE. Presence of P B was detected in
the gel by zinc-induced fluoresence (Bhoo et al., 1997 ). phyA
polypeptides were detected by immunoblot analysis, using the monoclonal
antibody O73D (Clough et al., 1999 ) in combination with the
goat-anti-mouse immunoglobulin conjugated to alkaline phosphatase
(Kirkegaard and Perry Laboratories, Gaithersburg, MD). Levels of P B
and phyA protein were determined semi-quantitatively by the analysis of
scanned images of the gels and blots using the Bio-Rad
Gel-Documentation System (Hercules, CA) and their optiquant software.
Degradation of phyA was initiated by continuous irradiation of 5-d-old
etiolated seedlings with R (Clough et al., 1999 ).
Expression Patterns of AtHO1 and 2
Fusions of the 5'-flanking sequences of Arabidopsis
HO1 and 2 to the GUS
coding sequence were created in the vector pCAMBIA1391z (Center for the
Application of Molecular Biology to International Agriculture,
Canberra, Australia). For AtHO1, approximately 1.1-kb genomic DNA fragment upstream of the AtHO1 open-reading
frame was PCR-amplified from the BAC F18A8 with the primers,
TCCAATGTCGACATTATGAGTATTATTATTTTTAAATCand CTAAATAGGATCCGGTTTGATCGGAATAG. This PCR product included DNA sequence that began immediately after the proposed stop codon of the upstream gene F18A8.3 and ended at the initiating Met codon of
AtHO1. For AtHO2, an approximately 500-bp
genomic DNA fragment upstream of the AtHO2 open-reading
frame was PCR-amplified from the BAC clone T9J22 with the primers,
TCCAATGTCGACCTAAAGAGATCAATTATTG and AA-GAGAGGATCCGGATTCCGACGACCAAG. This PCR product included DNA sequences that began immediately after
the proposed stop codon of the upstream gene T9J22.21 and ended at the
initiating Met codon of AtHO2. Both products were digested with SalI and BamHI and cloned
into pCAMBIA1391z similarly digested, thus creating the vectors
5'-HO1-GUS and
5'-HO2-GUS, bearing the
GUS coding region downstream of the 5' regulatory sequences of AtHO1 and 2.
Transgenic Arabidopsis was generated by the floral-dip method (Clough
and Bent, 1998 ) with the Agrobacterium tumefaciens
strain ABI harboring the appropriate vector.
5'-HO1-GUS was introduced into the WS
wild-type and ho2-1 backgrounds.
5'-HO2-GUS was introduced into the Col
wild-type and hy1-100 backgrounds. T1 seeds
were plated on Gamborg B5 medium supplemented with Suc and
vitamins, (Life Technologies/Gibco-BRL),
2-[N-morpholino]ethanesulfonic acid (pH 5.7), and
0.7% (w/v) agar. After a 3-d incubation at 4°C, seedlings
were either grown for 4 d in darkness or grown under continuous
fluorescent lighting (approximately 20 µmol m 2
s 1) for 10 d. Seedlings were stained for GUS
activity by incubation in 2 mM 5-bromo-4-chloro-3-indolyl
-D-glucuronic acid as described (Thoma et al., 1996 ).
The resulting blue-stained plants were imaged with a dissecting
microscope. Five to seven independent transformants where analyzed for
each transgene-genotype combination; in all cases, the staining
patterns were similar for each combination.
 |
ACKNOWLEDGMENTS |
We thank Marc Jullien and Matthew Terry for supplying the
pew1 and yg-2aud mutants,
respectively, Ross Wheaton and Marie-Michéle Cordonnier-Pratt for
supplying cDNA clones, and Alex Vener for his assistance in generating
the GUS constructions.
 |
FOOTNOTES |
Received January 23, 2001; returned for revision March 19, 2001; accepted March 23, 2001.
1
This work was supported by the Department of
Energy Division of Basic Energy Sciences (grant no.
DE-FG02-88ER13968), by the Research Division of the College of
Agriculture and Life Sciences (grant no. Hatch-N936 to R.D.V.), and by
a National Institutes of Health predoctoral fellowship (no. 5 T32
GM07133 to S.J.D.).
2
Present address: Department of Biological Sciences,
University of Warwick, Coventry CV4 7AL, UK.
*
Corresponding author; e-mail vierstra{at}facstaff.wisc.edu; fax
608-262-4743.
 |
LITERATURE CITED |
-
Altschul S, Gish W, Miller W, Myers EW, Lipman DJ
(1990)
Basic local alignment search tool.
J Mol Biol
215: 403-410[CrossRef][Web of Science][Medline]
-
Amasino RM
(1996)
Control of flowering time in plants.
Curr Opin Genet Dev
6: 480-487[CrossRef][Web of Science][Medline]
-
Aukerman MJ, Hirschfeld M, Wester L, Weaver M, Clack T, Amasino RM, Sharrock RA
(1997)
A deletion in the PHYD gene of the Arabidopsis Wassilewskija ecotype defines a role for phytochrome D in red/far-red light sensing.
Plant Cell
9: 1317-1326[Abstract]
-
Bhoo SH, Hirano T, Jeong H-Y, Lee J-G, Furuya M, Song P-S
(1997)
Phytochrome photochromism probed by site-directed mutations and chromophore esterification.
J Am Chem Soc
119: 11717-11718[CrossRef]
-
Chory J, Peto CA, Ashbaugh M, Saganich R, Pratt L, Ausubel F
(1989)
Different roles for phytochrome in etiolated and green plants deduced from characterization of Arabidopsis thaliana mutants.
Plant Cell
1: 867-880[Abstract/Free Full Text]
-
Clough RC, Jordan-Beebe ET, Lohman KN, Marita JM, Walker JM, Gatz C, Vierstra RD
(1999)
Sequences within both the N- and C-terminal domains of phytochrome A are required for Pfr ubiquitination and degradation.
Plant J
17: 155-167[CrossRef][Web of Science][Medline]
-
Clough RC, Vierstra RD
(1997)
Phytochrome degradation.
Plant Cell Environ
20: 713-721[CrossRef]
-
Clough SJ, Bent AF
(1998)
Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J
16: 735-743[CrossRef][Web of Science][Medline]
-
Cornejo J, Willows RD, Beale SI
(1998)
Phytobilin biosynthesis: cloning and expression of a gene encoding soluble ferredoxin-dependent heme oxygenase from Synechocystis sp. PCC 6803.
Plant J
15: 99-107[CrossRef][Web of Science][Medline]
-
Davis SJ, Kurepa J, Vierstra RD
(1999)
The Arabidopsis thaliana HY1 locus, required for phytochrome-chromophore biosynthesis, encodes a protein related to heme oxygenases.
Proc Natl Acad Sci USA
96: 6541-6546[Abstract/Free Full Text]
-
Devlin PF, Patel SR, Whitelam GC
(1998)
Phytochrome E influences internode elongation and flowering time in Arabidopsis.
Plant Cell
10: 1479-1487[Abstract/Free Full Text]
-
Devlin PF, Robson PR, Patel SR, Goosey L, Sharrock RA, Whitelam GC
(1999)
Phytochrome D acts in the shade-avoidance syndrome in Arabidopsis by controlling elongation growth and flowering time.
Plant Physiol
119: 909-915[Abstract/Free Full Text]
-
Emanuelsson O, Nielsen H, Von Heijne G
(1999)
A neural network-based method for predicting chloroplast transit peptides and their cleavage products.
Protein Sci
8: 978-984[Web of Science][Medline]
-
Frankenberg N, Mukougawa K, Kohchi T, Lagarias JC
(2001)
Functional genomic analysis of the HY2 family of ferredoxin-dependent bilin reductases from oxygenic photosynthetic organisms.
Plant Cell
13: 425-436[Abstract/Free Full Text]
-
Hajdukiewicz P, Svab Z, Maliga P
(1994)
The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation.
Plant Mol Biol
25: 989-994[CrossRef][Web of Science][Medline]
-
Izawa T, Oikawa T, Tokutomi S, Okuno K, Shimamoto K
(2000)
Phytochromes confer the photoperiodic control of flowering in rice (a short-day plant).
Plant J
22: 391-399[CrossRef][Web of Science][Medline]
-
Jefferson RE, Kavanagh TA, Bevan MM
(1987)
GUS fusions:
-glucuronic acid as a sensitive and versatile gene fusion marker in higher plants.
EMBO J
6: 3901-3907[Web of Science][Medline] -
Jordan ET, Cherry JR, Walker JM, Vierstra RD
(1996)
The amino-terminus of phytochrome A contains two distinct functional domains.
Plant J
9: 243-257[CrossRef][Medline]
-
Kendrick RE, Peters JL, Kerckhoffs LH, van Tuinen A, Koornneef M
(1994)
Photomorphogenic mutants of tomato.
Biochem Soc Symp
60: 249-256[Medline]
-
Koorneef M, Cone JW, Kekens RG, O'Herne-Robers EG, Spruit CJP, Kendrick RE
(1985)
Photomorphogenic responses of long hypocotyl mutants of tomato.
J Plant Physiol
120: 153-165
-
Koornneef M, Rolff E, Spruit CJP
(1980)
Genetic control of light-induced hypocotyl elongation in Arabidopsis thaliana L Heynh.
Z. Pflanzenphysiologie
100: 147-160
-
Kraepiel Y, Jullien M, Cordonnier-Pratt MM, Pratt L
(1994)
Identification of two loci involved in phytochrome expression in Nicotiana plumbaginifolia and lethality of the corresponding double mutant.
Mol Gen Genet
242: 559-565[CrossRef][Web of Science][Medline]
-
Krysan PJ, Young JC, Sussman MR
(1999)
T-DNA as an insertional mutagen in Arabidopsis.
Plant Cell
11: 2283-2290[Free Full Text]
-
Krysan PJ, Young JC, Tax F, Sussman MR
(1996)
Identification of transferred DNA insertions within Arabidopsis genes involved in signal transduction and ion transport.
Proc Natl Acad Sci USA
93: 8145-8150[Abstract/Free Full Text]
-
Michaels SD, Amasino RM
(1999)
FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering.
Plant Cell
11: 949-956[Abstract/Free Full Text]
-
Muramoto T, Kohchi T, Yokota A, Hwang I, Goodman HM
(1999)
The Arabidopsis photomorphogenic mutant hy1 is deficient in phytochrome chromophore biosynthesis as a result of a mutation in a plastid heme oxygenase.
Plant Cell
11: 335-348[Abstract/Free Full Text]
-
Murtas G, Millar AJ
(2000)
How plants tell the time.
Curr Opin Plant Biol
3: 43-46[CrossRef][Web of Science][Medline]
-
Neff MM, Fankhauser C, Chory J
(2000)
Light: an indicator of time and place.
Genes Dev
14: 257-271[Free Full Text]
-
Ortiz de Montelano PR, Wilks A
(2001)
Heme oxygenase structure and mechanism.
Adv Inorg Chem
51: 359-407
-
Parks BM, Quail PH
(1991)
Phytochrome-deficient hy1 and hy2 long hypocotyl mutants of Arabidopsis are defective in phytochrome chromophore biosynthesis.
Plant Cell
3: 1177-1186[Abstract/Free Full Text]
-
Parks BM, Quail PH
(1993)
hy8, a new class of Arabidopsis long hypocotyl mutants deficient in functional phytochrome A.
Plant Cell
5: 39-48[Abstract/Free Full Text]
-
Parks BM, Shanklin J, Koorneef M, Kendrick RE, Quail PH
(1989)
Immunochemically detectable phytochrome is present at normal levels but is photochemically nonfunctional in the hy1 and hy2 long hypocotyl mutants of Arabidopsis.
Plant Mol Biol
12: 425-437[CrossRef]
-
Platt JL, Nath KA
(1998)
Heme oxygenase: protective gene or Trojan horse.
Nat Med
4: 1364-1365[CrossRef][Web of Science][Medline]
-
Porra RJ, Thompson WA, Kriedemann PE
(1989)
Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy.
Biochim Biophys Acta
975: 384-394[CrossRef]
-
Quail PH, Boylan MT, Parks BM, Short TW, Xu Y, Wagner D
(1995)
Phytochromes: photosensory perception and signal transduction.
Science
268: 675-680[Abstract/Free Full Text]
-
Richaud C, Zabulon G
(1997)
The heme oxygenase gene (pbsA) in the red alga Rhodella violacea is discontinuous and transcriptionally activated during iron limitation.
Proc Natl Acad Sci USA
94: 11736-11741[Abstract/Free Full Text]
-
Schuller DJ, Wilks A, Ortiz de Montellano PR, Poulos TL
(1999)
Crystal structure of human heme oxygenase-1.
Nat Struct Biol
6: 860-867[CrossRef][Web of Science][Medline]
-
Schürman P, Jacquot J-P
(2000)
Plant thioredoxin systems revisited.
Annu Rev Plant Physiol Plant Mol Biol
51: 371-400[CrossRef][Web of Science]
-
Smith H
(2000)
Phytochromes and light signal perception by plants: an emerging synthesis.
Nature
407: 585-591[CrossRef][Medline]
-
Somers DE, Quail PH
(1995)
Temporal and spatial expression patterns of PHYA and PHYB genes in Arabidopsis.
Plant J
7: 413-427[CrossRef][Web of Science][Medline]
-
Somers DE, Sharrock RA, Tepperman JM, Quail PH
(1991)
The hy3 long hypocotyl mutant of Arabidopsis is deficient in phytochrome B.
Plant Cell
3: 1263-1274[Abstract/Free Full Text]
-
Terry MJ, Kendrick RE
(1996)
The aurea and yellow-green-2 mutants of tomato are deficient in phytochrome chromophore synthesis.
J Biol Chem
271: 21681-21686[Abstract/Free Full Text]
-
Terry MJ, Kendrick RE
(1999)
Feedback inhibition of chlorophyll synthesis in the phytochrome chromophore-deficient aurea and yellow-green-2 mutants of tomato.
Plant Physiol
119: 143-152[Abstract/Free Full Text]
-
Terry MJ, McDowell MT, Lagarias JC
(1995)
(3Z)- and (3E)-phytochromobilin are intermediates in the biosynthesis of the phytochrome chromophore.
J Biol Chem
270: 11111-11118[Abstract/Free Full Text]
-
Terry MJ, Wahleithner JA, Lagarias JC
(1993)
Biosynthesis of the plant photoreceptor phytochrome.
Arch Biochem Biophys
306: 1-15[CrossRef][Web of Science][Medline]
-
Terry ML
(1997)
Phytochrome deficient mutants.
Plant Cell Environ
20: 740-745[CrossRef]
-
Thoma S, Sullivan ML, Vierstra RD
(1996)
Members of two gene families encoding ubiquitin-conjugating enzymes, AtUBC1-3 and AtUBC4-6, from Arabidopsis thaliana are differentially expressed.
Plant Mol Biol
31: 493-505[CrossRef][Web of Science][Medline]
-
van Tuinen A, Hanhart CJ, Kerckhoffs LHJ, Nagatani A, Boylan MT, Quail PH
(1996)
Analysis of phytochrome-deficient yellow green-2 and aurea mutants of tomato.
Plant J
9: 173-182
-
Weller JL, Terry MJ, Rameau C, Reid JB, Kendrick RE
(1996)
The phytochrome-deficient pcd1 mutant of pea is unable to convert heme to biliverdin IX
.
Plant Cell
8: 55-67[Abstract] -
Weller JL, Terry MJ, Reid JB, Kendrick RE
(1997)
The phytochrome-deficient pcd2 mutant of pea is unable to convert biliverdin IX alpha to 3(Z)-phytochromobilin.
Plant J
11: 1177-1186[CrossRef][Web of Science]
-
Whitelam GC, Devlin PF
(1997)
Roles of different phytochromes in Arabidopsis morphogenesis.
Plant Cell Environ
20: 752-758[CrossRef]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
M. Takano, N. Inagaki, X. Xie, S. Kiyota, A. Baba-Kasai, T. Tanabata, and T. Shinomura
Phytochromes are the sole photoreceptors for perceiving red/far-red light in rice
PNAS,
August 25, 2009;
106(34):
14705 - 14710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Xuan, F.-Y. Zhu, S. Xu, B.-K. Huang, T.-F. Ling, J.-Y. Qi, M.-B. Ye, and W.-B. Shen
The Heme Oxygenase/Carbon Monoxide System Is Involved in the Auxin-Induced Cucumber Adventitious Rooting Process
Plant Physiology,
October 1, 2008;
148(2):
881 - 893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Guo, K. Xia, and Z.-M. Yang
Regulation of tomato lateral root development by carbon monoxide and involvement in auxin and nitric oxide
J. Exp. Bot.,
September 1, 2008;
59(12):
3443 - 3452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Bianchetti, L. Yi, S. W. Ragsdale, and G. N. Phillips Jr.
Comparison of Apo- and Heme-bound Crystal Structures of a Truncated Human Heme Oxygenase-2
J. Biol. Chem.,
December 28, 2007;
282(52):
37624 - 37631.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Ding, M. R. Doyle, R. M. Amasino, and S. J. Davis
A Complex Genetic Interaction Between Arabidopsis thaliana TOC1 and CCA1/LHY in Driving the Circadian Clock and in Output Regulation
Genetics,
July 1, 2007;
176(3):
1501 - 1510.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-s. Su and J. C. Lagarias
Light-Independent Phytochrome Signaling Mediated by Dominant GAF Domain Tyrosine Mutants of Arabidopsis Phytochromes in Transgenic Plants
PLANT CELL,
July 1, 2007;
19(7):
2124 - 2139.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. G. McWatters, E. Kolmos, A. Hall, M. R. Doyle, R. M. Amasino, P. Gyula, F. Nagy, A. J. Millar, and S. J. Davis
ELF4 Is Required for Oscillatory Properties of the Circadian Clock
Plant Physiology,
May 1, 2007;
144(1):
391 - 401.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Ryter, J. Alam, and A. M. K. Choi
Heme Oxygenase-1/Carbon Monoxide: From Basic Science to Therapeutic Applications
Physiol Rev,
April 1, 2006;
86(2):
583 - 650.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Emborg, J. M. Walker, B. Noh, and R. D. Vierstra
Multiple Heme Oxygenase Family Members Contribute to the Biosynthesis of the Phytochrome Chromophore in Arabidopsis
Plant Physiology,
March 1, 2006;
140(3):
856 - 868.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Muramoto, C. Kami, H. Kataoka, N. Iwata, P. J. Linley, K. Mukougawa, A. Yokota, and T. Kohchi
The Tomato Photomorphogenetic Mutant, aurea, is Deficient in Phytochromobilin Synthase for Phytochrome Chromophore Biosynthesis
Plant Cell Physiol.,
April 1, 2005;
46(4):
661 - 665.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Chen, R. Schwab, and J. Chory
Characterization of the requirements for localization of phytochrome B to nuclear bodies
PNAS,
November 25, 2003;
100(24):
14493 - 14498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Protchenko and C. C. Philpott
Regulation of Intracellular Heme Levels by HMX1, a Homologue of Heme Oxygenase, in Saccharomyces cerevisiae
J. Biol. Chem.,
September 19, 2003;
278(38):
36582 - 36587.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Franklin, S. J. Davis, W. M. Stoddart, R. D. Vierstra, and G. C. Whitelam
Mutant Analyses Define Multiple Roles for Phytochrome C in Arabidopsis Photomorphogenesis
PLANT CELL,
September 1, 2003;
15(9):
1981 - 1989.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Muramoto, N. Tsurui, M. J. Terry, A. Yokota, and T. Kohchi
Expression and Biochemical Properties of a Ferredoxin-Dependent Heme Oxygenase Required for Phytochrome Chromophore Synthesis
Plant Physiology,
December 1, 2002;
130(4):
1958 - 1966.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J.H. Sawers, P. J. Linley, P. R. Farmer, N. P. Hanley, D. E. Costich, M. J. Terry, and T. P. Brutnell
elongated mesocotyl1, a Phytochrome-Deficient Mutant of Maize
Plant Physiology,
September 1, 2002;
130(1):
155 - 163.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|