|
Plant Physiol, June 2001, Vol. 126, pp. 861-874
Seed-Specific Over-Expression of an Arabidopsis cDNA Encoding a
Diacylglycerol Acyltransferase Enhances Seed Oil Content and Seed
Weight1
Colette
Jako,
Arvind
Kumar,
Yangdou
Wei,
Jitao
Zou,
Dennis L.
Barton,
E. Michael
Giblin,
Patrick S.
Covello, and
David C.
Taylor*
Seed Oil Biotechnology Group, National Research Council of Canada,
Plant Biotechnology Institute, 110 Gymnasium Place, Saskatoon,
Saskatchewan S7N 0W9, Canada
 |
ABSTRACT |
We recently reported the cloning and characterization of an
Arabidopsis (ecotype Columbia) diacylglycerol acyltransferase cDNA (Zou
et al., 1999) and found that in Arabidopsis mutant line AS11, an ethyl
methanesulfonate-induced mutation at a locus on chromosome II
designated as Tag1 consists of a 147-bp insertion in the
DNA, which results in a repeat of the 81-bp exon 2 in the Tag1 cDNA. This insertion mutation is correlated with an
altered seed fatty acid composition, reduced diacylglycerol
acyltransferase (DGAT; EC 2.3.1.20) activity, reduced seed
triacylglycerol content, and delayed seed development in the AS11
mutant. The effect of the insertion mutation on microsomal
acyl-coenzyme A-dependent DGAT is examined with respect to DGAT
activity and its substrate specificity in the AS11 mutant relative to
wild type. We demonstrate that transformation of mutant AS11 with a
single copy of the wild-type Tag1 DGAT cDNA can
complement the fatty acid and reduced oil phenotype of mutant AS11.
More importantly, we show for the first time that seed-specific
over-expression of the DGAT cDNA in wild-type Arabidopsis enhances oil
deposition and average seed weight, which are correlated with DGAT
transcript levels. The DGAT activity in developing seed of transgenic
lines was enhanced by 10% to 70%. Thus, the current study confirms
the important role of DGAT in regulating the quantity of seed
triacylglycerols and the sink size in developing seeds.
 |
INTRODUCTION |
Seed triacylglycerol
(TAG) biosynthesis is located in the endoplasmic reticulum with
glycerol-3-phosphate and fatty acyl-coenzyme A (CoAs) as the primary
substrates. There are three acyltransferases and a phosphohydrolase
involved in the plant storage lipid bioassembly, namely
glycerol-3-phosphate acyltransferase (GPAT, EC 2.3.1.15), lyso-phosphatidic acid acyltransferase (LPAT, EC 2.3.1.51), phosphatidate phosphohydrolase (PAPase, EC 3.1.3.4), and diacylglycerol acyltransferase (DGAT, EC 2.3.1.20). The three acyltransferases catalyze the stepwise acylation of the glycerol backbone with the final
step being the acylation of sn-1,2-diacylglycerols (DAGs) by
DGAT to form TAGs, a biochemical process generally known as the Kennedy pathway (Kennedy, 1961 ; Barron and Stumpf, 1962 ; Stymne and
Stobart, 1987 ). The acyl-CoA dependent acylation of
sn-1,2-DAG as catalyzed by DGAT is the only enzyme in the
traditional Kennedy pathway that is exclusively committed to TAG biosynthesis.
In developing and germinating seeds of oilseed plants, TAG accumulation
and DGAT activity have been shown to associate with the endoplasmic
reticulum (high-speed microsomal fraction) (Cao and Huang, 1986 ;
Stobart et al., 1986 ; Stymne and Stobart, 1987 ; Frentzen, 1993 ;
Settlage et al., 1995 ; Lacey and Hills, 1996 ). The biochemical
properties of microsomal DGAT have been examined in a number of plant
systems (Frentzen, 1993 ), including developing seeds (Cao and Huang,
1987 ; Bernerth and Frentzen, 1990 ; Vogel and Browse, 1996 ) and embryo
cultures (Taylor et al., 1991 , 1992 ; Weselake et al., 1991 ; Little et
al., 1994 ) of Brassica napus. In general, studies with
developing seeds indicate that DGAT activity increases rapidly during
the active phase of oil accumulation and then decreases markedly as
seed lipid content reaches a plateau (Tzen et al., 1993 ; Weselake et
al., 1993 ).
A number of studies with both mammalian (Mayorek et al., 1989 ; Tijburg
et al., 1989 ) and plant (Ichihara et al., 1988 ; Perry and Harwood,
1993a , 1993b ; Settlage et al., 1995 ; Perry et al., 1999 ) systems have
suggested that DGAT may catalyze a rate-limiting reaction in TAG
bioassembly. For example, developing seeds of B. napus L.,
cv Shiralee, have been shown to produce significant levels of DAG
during the active phase of oil accumulation (Perry and Harwood, 1993a ,
1993b ). More recently, using light/dark treatments in this cultivar, it
has been shown that during conditions of high lipid accumulation, the
amounts of Kennedy pathway intermediates phosphatidate, and
diacylglycerol increase significantly. During this time, the DGAT
activity is the lowest of the four Kennedy pathway enzymes. The
alteration in carbon flux resulted in changes to the acyl quantity of
the DAG pool but not other intermediates (Perry et al., 1999 ). The data
collectively suggest that the DGAT reaction may regulate the flow of
carbon into TAG at times of high lipid accumulation. However, this
hypothesis has not been rigorously tested or reduced to practice by
transgenically altering the expression of a DGAT gene in a
seed-specific manner.
We previously characterized an ethyl methanesulfonate (EMS)-induced
mutant of Arabidopsis, designated AS11, which displayed an altered
fatty acid composition (Katavic et al., 1995 ). AS11 seeds have reduced
levels of the very long chain fatty acid eicosenoic acid (20:1) and
reduced oleic acid (18:1) and accumulate -linolenic acid (18:3) as
the major fatty acid in TAGs. The AS11 mutant has a consistently lower
ratio of TAG/DAG in developing seeds, and it accumulates an elevated
amount of seed DAG, which is the substrate of the DGAT. It was
shown that AS11 had reduced DGAT activities throughout seed development
and thus a reduced TAG content phenotype, providing some evidence that
DGAT may be controlling flux into TAG biosynthesis. Genetic analysis
indicated that the fatty acid phenotype in AS11 is caused by a
semidominant mutation in a nuclear gene, designated Tag1.
The mutation in line AS11 was characterized as a 147-bp insertion in
the chromosome II DNA, which results in a repeat of the 81-bp exon 2 in
the Tag1 transcript. This insertion mutation is correlated
with an altered seed fatty acid composition, a reduced seed TAG
content, reduced DGAT (EC 2.3.1.20) activity, and delayed seed
development, characteristic of the AS11 mutant seed line.
Tag1 was mapped to chromosome II (Katavic et al.,
1995 ).
We recently reported the identification, functional assignment, and
cloning of this DGAT gene, Tag1, from Arabidopsis (Zou et
al., 1999 ; GenBank accession no. AJ238008) through a databank sequence
search and assisted by map-based information. Our data demonstrated
that the encoded product of the Tag1 gene is 41% identical
over a stretch of more than 400 amino acids to the mouse (Cases et al.,
1998 ; GenBank accession no. AF078752) and human (Oelkers et al.,
1998 ; GenBank accession no. AF059202) DGATs and includes a
signature putative diacylglycerol binding motif. The TAG1
gene was shown to encode an acyl-CoA-dependent DGAT by functional
expression of the recombinant protein produced in yeast cells (Zou et
al., 1999 ).
These results were in agreement with concurrent publications describing
the cloning of the Arabidopsis DGAT sequence and functional expression
of the recombinant protein in insect cell cultures (Hobbs et al., 1999 ;
GenBank accession no. AJ131831) and the cloning of the Arabidopsis DGAT
sequence, a similar study of the insertion mutation allele from AS11
(tag 1-1), and the description of a new deletion mutant
ABX45 allele (tag 1-2) as reported by Routaboul et al.
(1999) . The Arabidopsis DGAT sequence is also highly homologous
(approximately 90% amino acid identity) to subsequently published
putative DGAT sequences from B. napus reported by Nykiforuk et al., 1999 (GenBank accession nos. AF155224 and AF164434) and cited
by Weselake and Taylor (1999) , and more recently, a direct GenBank
submission by A.P. Brown, T.P. Schierer, and A.R. Slabas (GenBank
accession no. AAF64065).
Here we report that the Arabidopsis DGAT cDNA can complement the AS11
mutant lipid phenotype, restoring the oil content and acyl composition
to that of wild type (WT). Furthermore, we demonstrate that
over-expression of the acyl-CoA-dependent DGAT in a seed-specific manner in wild-type plants results in augmentation of seed oil deposition and average seed weight.
 |
RESULTS |
Further Study of the AS11 Mutant Line and the Effects of the
Mutation on DGAT Activity, Its Acyl-CoA Substrate Specificity, and Oil
Accumulation
Using microsomal fractions prepared from WT and AS11
mid-green developing seed, we were able to compare the
acyl-CoA-dependent DGAT (EC 2.3.1.20) activity to the resultant oil
content in the mature seed of each line. As shown in Figure
1, there was a strong correlation between
the reduced DGAT activity exhibited in developing seed microsomes of
the AS11 mutant and the reduced oil content in the mature seed of this
mutant line in comparison with WT. Furthermore, the AS11 DGAT activity
relative to that of WT in developing seeds remained
proportionally constant and directly correlated with mature seed oil
content, regardless of whether the acyl-CoA-dependent microsomal DGAT
activity was measured with only the acyl-CoA donor radiolabeled
(14C 18:1-CoA; AS11 DGAT activity = 73% of
WT) or if both the DAG acceptor (14C
sn-1,2 diolein) and acyl-CoA donor
(3H-18:1-CoA) were labeled (AS11 DGAT
activity = 76% of WT).

View larger version (43K):
[in this window]
[in a new window]
|
Figure 1.
Comparisons of 18:1-CoA-dependent DGAT activity
(values expressed as pmol min 1
mg 1 protein) in microsomes prepared from
developing seeds at the mid-green stage of embryo development in
wild-type and DGAT mutant AS11 lines of Arabidopsis with the seed oil
content in WT and AS11 mature seed (values for oil content expressed as
percentage of dry weight). In single label experiments, 18 µM 14C-oleoyl-CoA (10 nCi nmol
1) was the acyl donor in the absence of
exogenous diolein (*18:1-CoA alone) or in the presence of
exogenous 200 µM unlabeled sn-1,2 diolein
(*18:1-CoA + DAG). In the double label experiment,
3H-labeled oleoyl-CoA was used at a radiospecific
activity of 50 nCi nmol 1 and a final
concentration of 40 µM with
14C-labeled sn-1,2 diolein provided at
a specific activity of 2 nCi nmol 1 and a final
concentration of 200 µM (*18:1-CoA + *DAG).
|
|
The altered fatty acid phenotype in seeds raised questions about
whether the acyl-CoA specificity of the mutant enzyme is affected. A
study of the DGAT acyl-CoA specificity and selectivity (as defined by
Cao and Huang, 1987 ) in WT and AS11 developing seed is shown in Figure
2. It is clear that, although microsomal DGAT activity is reduced in AS11 compared with WT (compare to Fig. 1;
for previous crude homogenate studies, see Katavic et al., 1995 ), the
trend in relative acyl-CoA preference is identical in both WT and AS11
seed lines.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 2.
Comparison of the acyl-CoA preference of the DGAT
in WT and AS11 developing seed (mid-green stage). Seeds of WT and AS11
Arabidopsis were harvested, and homogenates were prepared and DGAT
activity measured as described by Katavic et al. (1995) . In the
comparative specificity studies, the DGAT activity was assayed in the
presence of 18 µM [1-14C]-labeled
18:1-CoA, 18:2-CoA, or 20:1-CoA, supplied individually, and 200 µM unlabeled sn-1,2-diolein. In the
comparative selectivity study equal concentrations (18 µM) of [1-14C]-labeled
18:2-CoA and 20:1-CoA were supplied simultaneously to the seed
homogenates in the presence of 200 µM unlabeled
sn-1,2-diolein. Separation and measurement of the relative
proportions of the radiolabeled TAG products
(18:1/18:1/14C-18:1;
18:1/18:1/14C-18:2 or
18:1/18:1/14C-20:1) was conducted by
reverse-phase radio-HPLC as described by Weselake et al. (1991) .
|
|
Complementation of the Arabidopsis AS11 Mutant Line by
Transformation with the DGAT cDNA
A napin:DGAT plasmid was introduced into Agrobacterium
tumefaciens and used to transform Arabidopsis mutant AS11. A
number of T3 single insert transgenic lines were
isolated that complemented the fatty acid mutant phenotype found in
AS11 (reduced 20:1 and elevated polyunsaturated fatty acids), restoring
the wild-type seed fatty acid profile (Fig.
3A). In addition, many of these same AS11
transgenic lines exhibited oil contents restored to near WT values or
beyond (Fig. 3B). The level of DGAT expression in the AS11 transgenic
lines containing single copies of the napin-driven cDNA generally
correlated well with the restoration of both the oil content and acyl
composition, with line 3-3 being the best, followed by lines 9-1, 19-5, and 14-2, respectively (Fig. 4). There
was no apparent advantage of multiple copy inserts in restoring AS11
seed oil phenotypes to those of WT (data not shown).

View larger version (56K):
[in this window]
[in a new window]
|
Figure 3.
Complementation of the AS11 DGAT mutation with the
WT cDNA leads to a restoration of WT seed oil composition and content.
A, Transformation of Arabidopsis mutant line AS11 with single copies of
the DGAT cDNA under the control of a napin promoter, leads to a
restoration of the WT fatty acid composition in the seed oil of the
transformant lines 3-3, 3-4, 9-1, 14-2, and 19-5. Fatty acid
composition (% [w/w]) was determined on the seed oil extracted from
Arabidopsis WT pSE and AS11 pSE (empty plasmid) control transformants,
non-transformed (nt) WT and n-t AS11 controls, and
T3 seeds of napin:DGAT transgenic lines. B, Seed
oil content of napin:DGAT T3 transgenic AS11
mutant seed lines containing a single insertion of the DGAT cDNA. Oil
content is expressed as percentage of seed dry weight for pSE in WT
(empty plasmid) and n-t WT controls (stippled bars), for pSE in AS11
(empty plasmid) and n-t AS11 controls (black bars), and napin:DGAT AS11
transgenic lines 3-3, 3-4, 9-1,14-2, and 19-5 containing a single copy
of the DGAT cDNA (gray bars). SE bars are indicated
(n = 3-5 replicate analyses performed on seed lots
from each line with 100-200 seeds analyzed/replicate).
|
|

View larger version (62K):
[in this window]
[in a new window]
|
Figure 4.
Northern analysis of TAG1 gene
expression in non-transformed Arabidopsis WT and AS11 lines, a pSE
(empty plasmid) AS11 control transformant, as well as napin:DGAT AS11
T3 transgenic lines 3-3, 9-1,14-2, and 19-5, each
containing a single copy of the DGAT cDNA. Total RNA was extracted from
siliques containing mid-green (G) developing seeds. The TAG1
DNA probe was 32P-labeled by random
priming.
|
|
Over-Expression of the DGAT cDNA in Wild-Type
Arabidopsis
The napin:DGAT plasmid was introduced into A. tumefaciens, used to transform wild-type Arabidopsis, and the
progeny was analyzed as described in "Materials and Methods." Based
on kanamycin selection, 24 primary napin:DGAT transgenic lines were
produced, the T1 plantlets grown to maturity, and
T2 seeds harvested. At the same time 12 independent plasmid only control transgenic (pSE vector without DGAT
insert) lines, as well as non-transformed (n-t) WT and AS11 lines were
propagated and analyzed.
After analysis, seven independent T2 transgenic
lines containing the napin:DGAT construct (lines 2, 9, 10, 16, 21, 23, and 24) were selected for detailed study based on increased oil
deposition on a per seed basis, an increased average 1,000-seed weight,
a strong linear correlation between the two traits (correlation coefficient r = 0.97), and enhanced expression of the
DGAT transcript, compared with a set of pSE in WT and n-t WT control
lines. On a mature seed dry weight basis, oil content increased by
anywhere from 9% to 12% dry weight, representing net overall
increases of 34% to 46%. Analyses of these T2
transgenic lines by 1H-NMR, a non-destructive
method, confirmed a relative increase in oil on a per seed basis of
30% to 40% (data not shown).
From the T2 progeny, segregation analyses were
performed on the T3 generation, and homozygous
lines were identified and subjected to further analysis. The data for
the napin:DGAT transgenic lines were compared with those acquired from
12 independent T3 pSE (empty plasmid) in WT
control plants and an equal number of n-t WT and n-t AS11 control
lines, all grown in the same growth chamber at the same time, in a
random block design. As shown in Figure
5, on a mature seed weight basis, the
homozygous napin: DGAT lines exhibited oil content increases ranging
from 3 to 8 percentage points, representing net overall increases of
11% to 28%, compared with the range exhibited by pSE WT controls.
When comparing homozygous lines containing a single insert (lines 10, 21, 23, and 24) versus multiple inserts (lines 2, 9, 16), with respect
to oil content (compare to Fig. 5), it is noteworthy that the single
insert lines performed quite well. For reasons that are not readily
apparent, the pSE in WT transgenics displayed approximately 2% higher
oil content compared with the n-t WT lines (Fig. 5). It could be that applying the kanamycin selection pressure to the pSE WT controls added
some sort of additional stress that resulted in a slightly higher basal
oil content. Nonetheless, we believe that for true comparison purposes
with respect to oil content, the pSE in WT control lines are the better
controls, because they reduce the risk of over estimating the oil
content increase observed in the napin:DGAT transgenics.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 5.
Transformation of WT Arabidopsis with the DGAT
cDNA under the control of a napin promoter leads to a higher seed oil
content. Homozygous T3 napin:DGAT lines were
sampled in triplicate, each sample consisting of 100 to 200 seeds/sample, accurately counted and weighed. For the plasmid only pSE
in WT transgenic controls and nt-WT and nt-AS11controls, 10 individual
transgenic plants were sampled and individual control seed lots
similarly analyzed. Each error bar indicates SE. Seed oil
content (oil as a percentage of mature seed weight) is shown for
Arabidopsis T3 seeds of pSE (empty plasmid)
control WT transgenics (stippled bars show representative oil content
ranges; solid black bar is the average of oil contents in 10 independent pSE in WT plasmid only controls), nt-WT controls (white
bar), nt-AS11 controls (checkered bar), and homozygous napin:DGAT
transgenic lines with multiple inserts 2-2, 2-5, 9-2, 9-5, and
16-1(hatched bars), and lines with single inserts 10-4, 21-1, 21-6, 23-5, 23-6, 24-1, and 24-3 (gray bars).
|
|
In general, the average 1,000-seed weight in the napin:DGAT homozygous
transgenic lines was usually increased or, as in the case of line 23-6, not significantly affected (Fig.
6).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 6.
Introduction of the napin:DGAT cDNA results in
increases in the average 1,000-seed weight (expressed as milligrams of
weight/1,000 seeds) of Arabidopsis T3 seeds.
Homozygous T3 napin:DGAT lines were sampled in
triplicate, each sample consisting of 100 to 200 seeds/sample
accurately counted and weighed. For the plasmid only pSE controls, 10 individual transgenic plants were sampled and individual control seed
lots similarly analyzed. Each error bar indicates SE. Data
are presented from pSE in WT (empty plasmid) control transgenics (solid
black bar), nt-WT control lines (white bar), nt-AS11 control lines
(checkered bar), homozygous napin:DGAT transgenic lines with multiple
inserts 2-2, 2-5, 9-2, 9-5, and 16-1(hatched bars), and single insert
lines 10-4, 21-1, 21-6, 23-5, 23-6, 24-1, and 24-3 (gray bars).
|
|
The heritability of the high oil trait from the pooled segregating
T2 generation to the average of the corresponding
homozygous T3 progeny is demonstrated in Figure
7 with a linear regression correlation
coefficient of 0.94. In addition, the number of seeds per plant (yield)
was not negatively affected in most of the homozygous T3 transgenic lines (Fig.
8). In fact, many of the lines showed significant increases in seed yield. The two exceptions to this trend
were lines 9-5 and 16-1. However, when the increase in the average
1,000-seed weight for these lines was taken into account (compare with
Fig. 6), the yield per plant compared with that of n-t WT plants as
well as the plasmid only (pSE in WT) average was 90% and 72% for
lines 9-5 and 16-1, respectively.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 7.
Heritability of the high oil trait from the pooled
segregating T2 generation to the average values
for the corresponding selected homozygous T3
progeny, shows a strong linear correlation. , Intercepts for the pSE
in WT control generations; , intercepts for the napin:DGAT
generations.
|
|

View larger version (46K):
[in this window]
[in a new window]
|
Figure 8.
Number of seeds per plant in Arabidopsis n-t WT
controls (n = 6; white bar), six individual pSE in WT
T3 transgenic controls and their average (black
bars), versus homozygous napin:DGAT T3 transgenic
lines with multiple inserts (2-2, 2-5, 9-2, 9-5, and 16-1, hatched
bars), and single insert lines 10-4, 21-1, 21-6, 23-5, 23-6, 24-1, and
24-3 (gray bars).
|
|
Figure 9A shows the relative DGAT
expression levels in mid-developing T3 seeds
(from pooled siliques following propagation of T2
lines). In general, in developing seeds of the napin:DGAT transgenics,
the DGAT transcript was strongly over-expressed compared with the pSE
in WT (plasmid only) control lines. The DGAT transcript intensity was
generally stronger in the napin:DGAT transgenic lines containing
multiple inserts (lines 2, 9, and 16) as compared with single inserts
(lines 10, 21, 23, and 24) (Fig. 9A). The relative DGAT transcript
level correlated quite well with the averaged values from the
corresponding homozygous T3 mature seed lines
with respect to the average seed weight (milligrams per 1,000 seeds,
Fig. 9C), but the correlation was less distinct with oil content (Fig.
9B).

View larger version (61K):
[in this window]
[in a new window]
|
Figure 9.
A, Northern analysis of TAG1 gene
expression in pooled developing T3 seed samples
from Arabidopsis pSE (empty plasmid) WT control transformants, as well
as developing progeny from parent transgenic lines 2, 9, 10, 16, 21, 23, and 24, transformed with the napin:DGAT construct. Total RNA was
extracted from siliques containing mid-green developing seeds. The
TAG1 DNA probe was 32P-labeled by
random priming. B, Correlation of relative DGAT transcript level ( )
with oil content (percentage of mature seed weight); pSE control (black
bar) or napin:DGAT multiple insert (hatched bars) and single insert
(gray bars) transgenics. Values for transgenics represent the average
from the corresponding homozygous T3 progeny as
reported in Figure 5. C, Correlation of relative DGAT transcript level
( ) with average seed weight (expressed as milligram/1,000 seeds);
pSE control (black bar) or napin:DGAT multiple insert (hatched bars)
and single insert (gray bars) transgenics. Values for transgenics
represent the average from the corresponding homozygous
T3 progeny as reported in Figure 6.
|
|
DGAT activity was assessed in microsomal preparations from
early-to-mid-green developing T3 seeds. In a
previous study (Katavic et al., 1995 ) we had determined that the DGAT
activity in WT seeds was highest at these developmental stages. Seed
material was pooled from stage 3 to stage 6 siliques, as defined by Zou
et al. (1996) . Table I shows the DGAT
activities measured in representative napin:DGAT homozygous multiple
copy and single copy lines as well as the corresponding activity in pSE
controls and compares these with the oil content measured in each line.
The DGAT activity in the napin:DGAT transgenic lines was generally
approximately 10% to 70% higher than that observed in the pSE
controls.
View this table:
[in this window]
[in a new window]
|
Table I.
Acyl-CoA-dependent DGAT activity in microsomal
fractions prepared from pooled mid-developing T3 seed
produced from T2 transgenic lines of pSE control and
napin:DGAT transformed Arabidopsis are compared to the seed oil content
of mature T3 transgenic seed lines
Assays were conducted using sn-1,2 diolein and
1-14C oleoyl-CoA as the acyl acceptor and donor,
respectively. Values represent the average of three independent
determinations.
|
|
We recognize both the advantages and limitations imposed by the use of
the ARASYSTEM and concede that seed "yield" is probably more
appropriately addressed in a field context in a crop plant. Nonetheless
the current results with the model oilseed plant Arabidopsis suggest
that in transgenic lines over-expressing the DGAT cDNA, both oil
content and seed yield can be increased substantially.
Whereas wild-type lines containing over-expressed DGAT cDNA affected
oil deposition, there were only small changes in the fatty acid
composition, and the overall proportions of VLCFAs were not increased
significantly (data not shown). Rather, there was a small but
significant decrease in the proportion of total saturates and an
increase in the mono-unsaturates and the 18:1/[18:2 + 18:3] index.
 |
DISCUSSION |
We recently identified a DGAT gene from Arabidopsis and cloned its
corresponding cDNA. We were able to demonstrate that the lesion at a
locus designated Tag1 in mutant line AS11 (Katavic et al.,
1995 ) is an insertion mutation that results in an extra exon 2 sequence
(81-bp) repeat in the AS11 DGAT transcript (Zou et al., 1999 ).
The fact that (a) Tag1 appears to be a single copy gene in
Arabidopsis (Routaboul et al., 1999 ; Zou et al., 1999 ), (b) that there
is no significant difference in DGAT transcript levels in mid-
developing WT and AS11 seed (Zou et al., 1999 ; compare with Fig. 4),
and (c) that the AS11 line exhibits reduced but significant acyl-CoA-dependent DGAT activity (compare with Fig. 1) collectively suggest that the repeat insertion in Tag1 does not totally
abolish the activity of the DGAT gene product. Rather, the altered
fatty acid phenotype of AS11 appears to be an indirect effect of lower DGAT activity rather than, for example, an increased preference of the
DGAT for polyunsaturated C18 fatty acyl-CoAs or a
reduced preference for very long chain acyl-CoAs.
As discussed previously (Zou et al., 1999 ), the DNA aberration observed
in this mutant was unexpected since EMS generally causes point
mutations, as in the case of the recently characterized mutant allele
tag 1-2 from line ABX45 wherein one base (G) at position 180 in exon 1 is deleted (Routaboul et al., 1999 ). Although at that time we
could not rule out the possibility that this AS11 mutant was the result
of a spontaneous mutation event, the study published by Routaboul et
al. (1999) concomittantly and independently confirmed our findings:
AS11 does contain a 147-bp repeat insertion consisting of exon 2 flanked by parts of introns 1 and 2 (Zou et al., 1999 ). EMS-induced
deletions and insertions had been reported in other systems (Mogami et
al., 1986 ; Okagaki et al., 1991 ). However, Poirier et al. (1999)
recently reported the characterization of two new independent EMS
mutant isolates (SK353 in Columbia ecotype and SK54-3 in RLD
ecotype) shown to have similar fatty acid and oil content phenotypes to
that of AS11. Through complementation studies these two new isolates
were shown to be new alleles of Tag1. This recent finding
strongly supports the probability that the insertion event observed in
mutant AS11 was EMS-induced.
It has been reported that, in addition to acyl-CoA-dependent DGAT as
the terminal step in the Kennedy pathway (Kennedy, 1961 ; Barron and
Stumpf, 1962 ), there are additional mechanisms for synthesizing TAGs in
mammals, yeasts, and plants. A DAG transacylase reaction by which a
fatty acyl group may be transferred directly from one diacylglycerol to
a second diacylglycerol acceptor, has been characterized from rat
intestinal microsomes (Lehner and Kuksis, 1993 ). In mammals, a mouse
deletion mutant (Dgat / ) devoid of DGAT
still retained significant TAG synthesis activity, indicating that
DGAT-independent TAG synthesis can occur (Smith et al., 2000 ). In
the yeast Saccharomyces cerevisiae, a gene designated LRO1, a homolog of the mammalian lecithin:cholesterol
acyltransferase (LCAT, EC 2.3.1.43), encodes an enzyme capable of
esterifying diacylglycerol using phosphatidylcholine as the acyl donor.
This novel enzymatic reaction is responsible for the majority of TAG synthesis in the yeast cell during exponential growth (Oelkers et al.,
2000 ).
Pioneering plant research in developing oilseeds has revealed that, in
addition to the traditional DGAT reaction, TAG synthesis can occur in
the absence of acyl-CoA. An acyl-CoA-independent selective channeling
or transfer of acyl moieties from one DAG to another to give TAG, was
reported (Dahlqvist et al., 1997 ; Stobart et al., 1997 ). Dahlqvist et
al. (2000) recently reported the presence of an enzyme in developing
oilseeds of castor and Crepis involved in TAG synthesis via
direct acyl transfer from the sn-2 position of PC to the
sn-3 position of DAG yielding TAG. This enzyme has been
named phospholipid:DGAT (PDAT) and was proposed to be involved in the
accumulation of the high levels of ricinoleic acid and vernolic acid
found in castor (Ricinus communis) and hawk's beard
(Crepis palaestina) TAGs, respectively. It was demonstrated that the enzyme is present in yeast microsomes, and the PDAT-encoding gene (YNR008w) from yeast, an LCAT homolog, was identified. Whereas the
authors also identified a sequence from Arabidopsis, which was more
closely related to the yeast PDAT than to any of the cloned LCATs,
there was no data reported on cloning or expression of the putative
Arabidopsis PDAT.
In the current study, we performed an experiment wherein the microsomal
fractions prepared from WT and AS11 developing seed were assayed for
PDAT activity in reaction mixtures containing labeled sn-1
palmitoyl-, sn-2 [1-14C]oleoyl-PC,
and sn-1,2 diolein. A small amount of radiolabeled TAG was
produced. Our results with Arabidopsis are similar to those observed
for sunflower microsomes by Dahlqvist et al. (2000) ; that is, when
sn-2 14C-oleoyl-radiolabeled PC is
supplied, the apparent PDAT activity is quite low. The low amount of
radiolabeled TAG produced in our "PDAT" reactions precluded an
accurate stereospecific analysis to assess whether there had been
transfer of the sn-2 labeled oleoyl moiety from PC to the
sn-3 position of DAG to give sn-3 oleoyl-labeled
TAG. Furthermore, when we performed the experiment using
sn-1 palmitoyl-, sn-2
[1-14C] linoleoyl-PC, we could not detect any
significant PDAT activity in either WT or AS11 microsomes. Given our
previous work, which showed that in AS11 TAGs, the proportion of 18:2
in the sn-3 position was 31% compared with only 8% in WT
(Katavic et al., 1995 ), one would expect that if an
alteration in a PDAT-type of reaction was responsible for the AS11 acyl
composition phenotype, it would have been apparent with this
experiment. Thus, whereas our results are inconclusive as to whether an
acyl-CoA-independent PDAT activity exists in Arabidopsis based on our
measurement of radiolabeled TAG, the putative acyl-CoA-independent
PDAT activity in WT and AS11 microsomes was similar (approximately 0.7 pmol min 1 mg 1 protein)
and significantly lower, by an order of magnitude, than the WT DGAT activity.
There have also been very different acyl-CoA-dependent DGATs identified
from Mortierella and S. cereviseae (Lardizabal et al., 2000 ). These have no significant homology (6%-14% identity overall) to any of the plant DGATs isolated thus far and do not, for
example, contain a signature DAG binding motif or significant stretches
of conserved amino acid residues. However, an Arabidopsis homolog to
the yeast gene cloned by Calgene (putative protein accession no. CAB
63016) recently has been reported, which has 21% overall identity and
29% identity over a stretch of 243 amino acids, to the yeast DGAT. To
date, there have been no data reported on the relative level of
expression of this "DGAT homolog" in Arabidopsis nor a confirmation
of its gene product as a functional DGAT.
Nonetheless, ectopic expression of the fungal, yeast, or other plant
DGATs, or manipulation of PDAT expression in certain oilseed plants may
provide additional glimpses into the malleability of TAG bioassembly
processes in oilseeds.
While we acknowledge that additional mechanisms for TAG synthesis (e.g.
PDAT) may exist in Arabidopsis, the apparent WT and AS11 PDAT
activities are essentially identical, but also very low, suggesting
that there is no differential contribution of such alternate mechanisms
to the phenotype observed in AS11. Rather, the results from our
biochemical comparisons of the AS11 and WT microsomal
acyl-CoA-dependent DGAT activity and specificity strongly suggest that
the reduction in AS11 oil content is largely attributable to the
reduced DGAT activity of the mutated AS11 TAG1 gene product. Previously
(Zou et al., 1999 ), we suggested a mechanism whereby such a reduced
DGAT activity in AS11 may result in the altered acyl composition
observed in AS11 seed TAGs (i.e. a reduction in monounsaturated [e.g.
18:1 and 20:1] and an enrichment in polyunsaturated [e.g. 18:3]
fatty acyl moieties).
The accumulated biochemical and molecular biological data known for the
Arabidopsis DGAT and related acyl-CoA-dependent acyltransferases provide a glimpse of the structure-function relationships involved. In
sequences of GPATs and LPATs there is a motif designated box I that
contains the conserved sequence XHXXX(X)D (Frentzen and Wolter, 1998 ). Via site-directed mutagenesis studies in
LPATs, the box I motif has been suggested to be an important part of
the active site, in particular, the conserved His and Asp residues. It
has been suggested that the His residue abstracts a proton from the
hydroxy group of the acyl acceptor (LPA) and thereby facilitates its
nucleophilic attack on the thioester bond of the acyl donor (acyl-CoA).
The closely spaced Asp residue has been suggested to stabilize the
positive charge on the His imidazole ring (Frentzen and Wolter, 1998 ).
In the DGAT sequences examined, the consensus sequence
N(S/A/G)R(L/V)(I/F/A)(I/L)EN(L/V) has been
identified (Fig. 10). We propose that
the invariant Arg (R) and Glu (E) residues in DGATs could perform
similar functions to those of the basic His (H) and acidic Asp (D)
residues, respectively, found in GPATs and LPATs. It is notable that
the amino acid sequence predicted for human acyl-CoA:cholesterol
acyltransferase genes (Yang et al., 1997 ; GenBank accession nos. L21934
and AF059203) also have RLXXXE motifs that align
in the vicinity of the DGAT motif (data not shown).

View larger version (36K):
[in this window]
[in a new window]
|
Figure 10.
Alignment of DGAT sequences (and GenBank
accession nos.) from Arabidopsis (AJ238008 and AJ131831), B. napus (AF155224), Nicotiana tabacum (AF129003), mouse
(AF078752), human (AF059202), and Caenorhabditis
elegans (Z75526) in the region covering the insertion repeat found
in mutant AS11. The conserved R and E residues, indicated by an
asterisk, are proposed to constitute key residues at the active site. A
proposed "box I" type of motif, which is conserved in all DGAT
sequences reported thus far (and analogous to the motif found in other
acyl-CoA acyltransferases) is underlined.
|
|
It is significant that there is a concensus amino acid
sequence for an acyl-CoA binding motif
(116RTRESPLSSDAIFKQSHAG134) immediately upstream (and ending with the first four residues) of the
AS11 exon 2 repeat insertion mutation site (Weselake et al., 2000 ). If
our proposal is correct, the exon 2 repeat in mutant AS11 yields a
protein altered with respect to its active site region. This could
result in perturbed access of substrates to the active site, an altered
interaction of the box I motif with the diacylglycerol binding site
(Zou et al., 1999 ), an altered topology proximal to the acyl-oA binding
site, or protein instability, and result in reduced DGAT activity.
Site-directed mutagenesis of the invariant R and/or E in the DGAT
sequence will help to establish if this hypothesis is correct.
To study the effect of DGAT expression in plants, we transformed
wild-type and AS11 Arabidopsis plants with the DGAT cDNA. We have
demonstrated that the insertion mutation in the mutant AS11 DGAT
(resulting in an extra exon 2 sequence in its transcript) can be
complemented by transgenically expressing a single copy of the WT cDNA
in a seed-specific manner in the AS11 background. The fatty acid
composition and oil contents in the AS11 DGAT transformants are
restored essentially to wild-type levels. These experiments are
essential to report because the findings confirm the nature of the
lesion in AS11 and directly tie the AS11 lipid phenotype to this mutation.
It is interesting that even in the AS11 lines complemented with
multiple copies of the napin-driven DGAT cDNA (average oil contents of
26.1% ± 0.3% dry weight; data not shown), the effect on oil content
was not as strong as those observed in the WT single copy napin-driven
DGAT cDNA over-expression transgenics. It may be that in the WT
experiment the endogenous DGAT activity is augmented, whereas in AS11
there is significant competition for substrates between the introduced
wild-type DGAT and the mutated DGAT of lower activity already resident
in the AS11 mutant. This phenomenon clearly needs further investigation.
From a biotechnological viewpoint, it is important that we have
demonstrated that the DGAT cDNA is useful in manipulating DGAT
expression and TAG accumulation in plants. By transforming wild-type
plants with a construct containing the DGAT gene in a sense orientation
under the control of a seed-specific promoter (napin), DGAT activity,
the accumulation of seed oil, and average seed weight were enhanced. In
contrast, the use of a B. napus DGAT cDNA in an anti-sense
orientation under the control of the cruciferin promoter recently has
apparently resulted in a reduction in seed oil content (Shorrosh,
2000 ). Thus, there appears to be some correlation between DGAT
expression levels and oil content. It is surprising that despite what
we had predicted based on the fatty acid composition of mutant AS11
seed oil (Katavic et al., 1995 ), the over-expression of the DGAT and
increased oil content and seed weight were not accompanied by an
increase in proportions of the VLCFAs. The acyl composition of seed oil
from the napin:DGAT T3 transgenics remained
insignificantly different from that found in the pSE (plasmid only) controls.
To our knowledge, this is the first report of enhanced seed oil
deposition and seed weight achieved by over-expression of a DGAT in
plants. The degree to which oil content increases could account for the
observed increases in average seed weight ranged from 40% to 100%. We
previously demonstrated that transformation of Arabidopsis and rapeseed
(B. napus) with a yeast sn-2 acyltransferase (LPAT) resulted in seed oils with increased proportions of 22:1 and
other very long-chain fatty acids and significant increases in seed oil
content and average seed weight (Zou et al., 1997 ; Marillia et al.,
2000 ). These results have been confirmed in two transgenic field trials
(Katavic et al., 2001 ). Taken together, both results suggest a
certain plasticity in the developing seed with respect to increasing
the quantity of TAG deposited and, in some way perhaps by signaling,
the overall sink size and resultant seed weight. Clearly in many cases
a proportion of the added seed weight must be due to increases in e.g.
oleosin or seed storage protein biomass.
Not unexpectedly, there was not necessarily a direct linear correlation
between the relative transcript level (compare with Fig. 9A), the
degree of DGAT activity enhancement, and oil content (Fig. 9B; Table
I). The correlation between the latter two parameters was not high (a
scatter plot of the data from Table I, the
r2 value = 0.11; data not shown). The
relationship between these measures of altered metabolism at the
transcript, enzyme activity, and oil content levels is clearly complex
and will require more detailed study: There may be tight control of
transcript stability that would not necessarily be evident in our
sampling window. As well, it is difficult to directly determine the
embryo stage for sampling. Pooling siliques 7 through 18 may dilute the
peak value for DGAT activity (on a per milligram protein basis) and result in an apparently lower DGAT rate. The napin promoter may also
contribute by broadening the period of DGAT expression and oil
deposition. In addition, there is perhaps some degree of
post-transcriptional regulation affecting DGAT activity. Nonetheless,
it can be said that all lines with increased DGAT transcript did
exhibit increased DGAT activity and an increase in oil content.
It is tempting, metabolically, to speculate that increases in DGAT
activity may lower the size of the acyl-CoA pools, thereby signaling a need for enhanced fatty acid synthesis (e.g. enhancement of
ACCase activity).
In summary, the current results in Arabidopsis and recent studies of
DGAT expression in tobacco (Bouvier-Navé et al., 2000 ) have
important implications for the modification of other crops through
biotechnology by altering DGAT expression. Some of the manipulations
that may be possible using DGAT genes or parts thereof include seeds
with increased or decreased oil content, seeds containing oils with an
enhanced diacylglycerol content, seed oils with an altered acyl
composition, plants producing larger or heavier seeds, plants
exhibiting an enhanced or altered capacity to accumulate TAGs, or other
storage compounds in other organs (e.g. tubers, roots, leaves). Clearly
the next wave of research will entail altering the expression of DGAT
in commercial oilseed crops. Such studies will allow one to determine
the critical role of DGAT in regulating carbon flux into TAGs and the
effect of such manipulations on overall oil deposition, average seed
weight, and seed yield in a field context.
 |
MATERIALS AND METHODS |
Substrates and Reagents
[1-14C]Oleic acid (56 mCi mmol 1) and
[1-14C]linoleic acid (55.6 mCi mmol 1) were
purchased from NEN
ResearchProducts(Mississauga,Ontario,Canada). [1-14C]Eicosenoic acid (55 mCi mmol 1),
1-palmitoyl-2-oleoyl phosphatidylcholine (58 mCi mmol 1),
1-palmitoyl-2-linoleoyl [1-14C-linoleoyl]
phosphatidylcholine (58 mCi mmol 1), and diolein
[1-14C-oleoyl] (55 mCi mmol 1) were
purchased from American Radiolabeled Chemicals (St. Louis). [9,10-3H]Oleic acid (8 Ci mmol 1) was
purchased from Amersham Pharmacia Biotech (Quebec). Labeled fatty acids
were converted to the corresponding acyl-CoA thioesters using the
method described by Taylor et al. (1990) . Specific activities were
adjusted as required by diluting with authentic unlabeled standards.
Unlabeled acyl-CoAs, ATP, CoASH, polar lipid standards, and most other
biochemicals were purchased from Sigma (St. Louis). Neutral lipid
standards were obtained from NuChek Prep (Elysian, MN), whereas FAME
standards were supplied by Supelco Canada (Oakville, Ontario, Canada).
The sn-1,2-diolein from 14C-labeled diolein
[1-14C oleic] (55 mCi mmol 1) and
unlabeled diolein (already enriched in the sn-1,2
isomer) were both further purified by thin layer chromatography
(TLC) on 10% (v/v) borate-impregnated TLC plates
and the isolated sn-1,2 isomer emulsified in HEPES
buffer the presence of 0.2% (v/v) Tween 20 as described by
Taylor et al. (1991) . Mixed TAG and diacylglycerol standards for gas
chromatography, which were not commercially available, were
synthesized from the corresponding di- or mono-acylglycerols by
condensation with the appropriate acyl chloride and purified as
described by Taylor et al. (1991) . HPLC-grade solvents (Omni-Solv, BDH
Chemicals, Toronto) were used throughout these studies.
Plant Material
The Arabidopsis mutant line AS11 was generated and characterized
relative to WT Arabidopsis ecotype Columbia as described by Katavic et
al. (1995) . Arabidopsis ecotype Columbia WT, mutant AS11 (AS11 seeds
were deposited at the American Type Culture Collection, ATCC Deposit
No. PTA 1013) and all napin:DGAT transgenic lines were grown in the
same growth chamber, at the same time, at 22°C with a diurnal
photoperiod of 16-h light (120 µE m 2 s 1)
and 8-h dark. For consistency in comparison, especially with respect to
the reproducibility of oil content and seed weight measurements,
transgenic lines were always grown along with n-t WT and AS11, and
plasmid only WT (pSE WT) and AS11 (pSE AS11) controls, in the same
chamber and at the same time. The Arasystem (Lehle Seeds, Tuscon, AZ),
a plastic cone, and cylinder support system was used throughout these
studies to isolate individual transgenic lines and facilitate seed
harvesting from all lines.
Lipid Analyses in AS11, WT, and DGAT Transgenic Lines
Total lipid extracts (TLEs) and lipid class analyses in WT and
the AS11 mutant and determination of oil content and composition in all
seed lines were performed as described previously (Taylor et al., 1991 ,
1992 ; Katavic et al., 1995 ; Zou et al., 1997 ). In all cases, the data
represent the averages of four to eight determinations.
In some cases, relative seed oil content was also measured by magic
angle sample spinning 1H-NMR, according to the method of
Rutar (1989) . Analyses were conducted with 50-seed samples of intact
wild type and AS11 seeds using a Bruker AM wide-bore spectrometer
(Bruker Analytische Masstechnik, Silberstreifen, Germany) operating at
360 MHz. To reduce anisotropic line broadening, the seed sample was
rotated at 1 kHz in a zirconium rotor oriented 54.7° to the magnetic
field. The integration response for resonances attributable to
liquid-like oil were summed, and the value for transgenic seed was
recorded relative to the response for the WT control seed sample, the
latter set at a value of 1.00.
Preparation of Microsomal Fractions and DGAT and PDAT
Assays
Two-hundred siliques (pooled silique stages 3-6 inclusive, as
described by Zou et al., 1996 ) were harvested from n-t WT, n-t AS11,
pSE in WT control, and napin:DGAT transgenic lines. Developing seeds
(early-to-mid-green stage) were harvested and immediately powdered with
liquid nitrogen in a mortar and pestle. Grinding medium (100 mM HEPES-KOH, pH 7.4 containing 0.32 M Suc, 1 mM EDTA, and 1 mM dithiothreitol) was
immediately added, and grinding continued on ice for 3 min. The
slurried cell free homogenate was filtered through two layers of
Miracloth (Calbiochem, La Jolla, CA), and centrifuged at
10,000g for 20 min using a centrifuge (model RC5C, Sorvall/Mandel Scientific Co., Guelph, ON, Canada) equipped with an
SS-34 rotor. The supernatant was then recentrifuged at
105,000g for 1 h on a Sorvall Ultra Pro 80 ultracentrifuge using an SW 40Ti rotor. The supernatant was discarded,
the 105,000g microsomal pellet fraction was resuspended
in a minimum volume of grinding medium, and the preparation was
disbursed by probe sonication on ice for 2 min in 30-s cycles using a
Labsonic 2,000-U probe sonicator (B. Braun Biotech, Allentown, PA) on
the low setting. The concentration of protein was then determined by
the method of Bradford (1976) , and relative microsomal protein
concentrations were normalized by adjusting the volume of each
preparation with grinding medium.
Acyl-CoA-dependent DGAT activity (EC 2.3.1.20) assays were conducted at
pH 7.4 with shaking at 100 revolutions min 1 in a water
bath at 30°C for 30 to 60 min. Assay mixtures (500 µL final volume)
contained microsomal protein (100-200 µg), 90 mM
HEPES-NaOH, 0.5 mM ATP, 0.5 mM CoASH, 1 mM MgCl2, 200 µM
sn-1,2 diolein in 0.02% (v/v) Tween 20, and 18 µM or 40 µM acyl-CoA. In most cases, the
acyl-CoA donor was 14C-labeled and supplied at a
radiospecific activity of 10 nCi nmol 1 and a final
concentration of 18 µM. In double label DGAT assays, 3H-labeled oleoyl-CoA was used at a radiospecific activity
of 50 nCi nmol 1 and a final concentration of 40 µM with 14C-labeled sn-1,2
diolein provided at a specific activity of 2 nCi nmol 1
and a final concentration of 200 µM.
Acyl-CoA-independent phospholipid:DGAT (PDAT) activity was tested
essentially as described by Dahlqvist et al. (2000) at 30°C for 60 min in the presence of 18 µM
1-palmitoyl-2-[1-14C-oleoyl] phosphatidylcholine (58 mCi
mmol 1) or 1-palmitoyl-2-[1-14C-linoleoyl]
phosphatidylcholine (58 mCi mmol 1) as the acyl donor, 200 µM sn-1,2 diolein in 0.02% (v/v) Tween 20 as the acyl acceptor, and 200 µg of microsomal protein in
100 mM HEPES-NaOH, pH 7.4, containing 0.5 mM
ATP, 0.5 mM CoASH, 1 mM MgCl2 in a
final reaction volume of 500 µL. All assays were conducted in
triplicate, and each experiment replicated twice.
All acyltransferase reactions were terminated by the addition of
CH2Cl2:iso-propanol (1:2),
phases were separated, and labeled TAGs were isolated and purified by
TLC on siliga gel G plates developed in hexane:diethyl ether:acetic
acid (70:30:1 v/v/v), as described by Taylor et al. (1991) . The
radiolabeled TAG spots were visualized on a Bioscan AR-2,000 radio-TLC
scanner using Win-Scan 2D software (Bioscan, Washington, D.C.) and the
bands scraped and quantified on a liquid scintillation counter.
General Molecular Techniques, DNA and RNA Manipulation, and
Analyses
Isolation of plasmid DNA, restriction digestions, modification
and ligation of DNA, PCR, agarose, PAGE, transformation and culture of
Escherichia coli strains, DNA gel-blot analyses
(Southern, 1975 ), and RNA gel-blot analyses were carried out according
to standard protocols (Sambrook et al., 1989 ).
The Arabidopsis TAG1 DGAT amino acid sequence was compared with
sequences available in databanks using the BLAST program (Altschul et
al., 1990 ).
Construction of DGAT cDNA Transformation Vector for
Seed-Specific Expression
The cloned full-length DGAT cDNA was used as a template for PCR
amplification with the primers DGATXbaI
(CTAGTCTAGAATGGCGATTTTGGA) and DGATXhoI
(GCGCTCGAGTTTCATGACATCGA) to provide new restriction sites on each end
of the sequence. The PCR profile was as follows: 94°C for 1 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 1 min;
and 72°C for 5 min. The PCR product was then ligated into the PCR-2.1
vector (Invitrogen, Carlsbad, CA). A 1.6-kb fragment was excised by a
XbaI/KpnI digestion and ligated into the
corresponding sites of the pSE. The plant transformation vector pSE was
prepared from pRD400 (Datla et al., 1992 ) by introducing a
HindIII/XbaI fragment containing the
B. napus napin promoter (Josefsson et al., 1987 ) and a
KpnI/EcoRI fragment containing the
Agrobacterium nos terminator (Bevan, 1983 ). The 1.6-kb
DGAT cDNA fragment was ligated into
XbaI/KpnI-digested pSE in the sense
orientation. The resulting plasmid was designated napin:DGAT. Hence in
the napin:DGAT construct, the Arabidopsis DGAT cDNA is under the
control of the napin promoter. The construct integrity was confirmed by sequencing.
Transformation of Agrobacterium with Plant DGAT Vector
Constructs
Electrocompetent Agrobacterium cells, GV3101
(pMP90) strain, were prepared as follows. An
Agrobacterium culture was grown 24 to 48 h in 2×
YT Medium (double-strength yeast extract + tryptone; Becton Dickinson,
Sparks, MD), and when the A600
reached 0.5 to 0.7, the cells were chilled on ice and pelleted by
centrifugation (5,000g, 10 min in a glutamate
semialdehyde rotor at 4°C). The pellet was washed in 1, 0.5, and 0.02 volumes of cold 10% (v/v) sterile glycerol and resuspended in
0.01 volume of cold 10% (v/v) glycerol. The electrocompetent
cells were then frozen in liquid N2 and stored at 70°C.
The Agrobacterium cells were transformed by
electroporation with 20 to 50 ng of transforming DNA (napin:DGAT) according to the manufacturer's instructions, plated on a selective medium (Luria-Bertani broth with 50 µg mL 1 kanamycin),
and incubated for 48 h at 28°C. Single transformed cells were
grown for 16 h (28°C, 225 rpm) in 5 mL Luria-Bertani broth with
50 µg mL 1 kanamycin and 25 µg mL 1
gentamycin. DNA extraction and purification were performed with a
Qiaprep Spin Miniprep kit (Qiagen, Valencia, CA). The fidelity of the
construct was rechecked by DNA sequencing before plant transformation.
Transformation of Arabidopsis
Seeds of Arabidopsis ecotype Columbia WT and mutant AS11
(Katavic et al., 1995 ) were grown at 22°C under fluorescent
illumination (120 µE m 2 s 1) in a
16-h-light/8-h-dark regime. Four to six plants typically were raised in
a 10 cm2 pot in moistened Terra-lite Redi-earth (W.R. Grace
and Company, Ajax, Ontario, Canada). To prevent the soil mix in the pot
from falling into the inoculation media, soil was mounded as a platform with seeds sown on top, and the whole pot covered by a nylon window screen and secured by a rubber band. To grow
Agrobacterium, a 5-mL suspension in Luria-Bertani medium
containing 50 µg mL 1 kanamycin and 25 µg
mL 1 gentamycin was cultured overnight at 28°C. The day
before infiltration, this "seed culture" was divided into four
flasks containing 250 mL of Luria-Bertani medium supplemented with 50 µg mL 1 kanamycin and 25 µg mL 1
gentamycin. These culture were grown overnight at 28°C. Plants were
vacuum infiltrated in an Agrobacterium suspension when
the first flowers started opening.
The transformation was performed as described by Clough and Bent
(1998) , using Silwet L-77 at a concentration of 0.005% in the dipping solution. The next day, the plants were uncovered, set
upright, and allowed to grow for approximately 4 weeks in a growth
chamber under continuous light conditions as described by Katavic et
al. (1995) . When the siliques were mature and dry, seeds were harvested
and selected for positive transformants.
Selection of Putative Transformants (Transgenic Plants) and
Analysis of Transgenic Plants and Seed Weights
For each construct, seeds were harvested in bulk. Seeds were
surface-sterilized by submerging them in a solution containing 20%
(v/v) bleach and 0.01% (v/v) Triton X-100 for 20 min,
followed by three rinses with sterile water. Sterilized seeds were then plated by resuspending them in sterile 0.1% (w/v) phytagar at room temperature (approximately 1 mL phytagar for every 500-1,000 seeds), and then applying a volume containing 2,000 to 4,000 seeds onto
150 × 15-mm kanamycin selection plate. Plates were incubated for
2 d in the cold without light and then grown for 7 to 10 d in
a controlled environment (22°C under fluorescent illumination [120
µE m 2 s 1] in a 16-h-light/8-h-dark
regime). The selection media contained one-half Murashige Skoog
Gamborg medium, 0.8% (w/v) phytagar, 3% (w/v)
Suc, 50 µg mL 1 kanamycin, and 50 µg mL 1
timentin. Petri dishes and lids were sealed with a Micropore surgical
tape (3M Canada, Inc., London, ON, Canada). After 7 to 10 d, drug-resistant plants that had green leaves and well established roots within the medium were identified as T1
transformants, and at the 3- to 5-leaf stage selected transformants
were transplanted into flats filled with heavily moistened soil mix.
Transformants were grown to maturity, and mature seeds (T2
generation as defined in Katavic et al., 1994 ) were harvested from
individual plants and further analyzed or propagated. Segregation
analyses were performed on T2 plantlets screened on
kanamycin to determine whether there were single (expected ratio of
resistant:susceptible plantlets = 3:1) or multiple copies of the
napin:DGAT transgene. Homozygous single and multiple insert
T2 lines exhibiting enhanced oil deposition and DGAT
expression compared with one-dozen plasmid-only control transgenics
were propagated to give T3 seed lines, for which further data on oil content, average seed weight, and yield per plant were
collected. Average seed weights were determined from pooled T2 or individual T3 segregant seed lots and
based upon six to eight individual samplings of 150 to 250 seeds/sample, with the seeds of each replicate being accurately counted
on an Electronic Dual Light Transilluminator (Ultra Lum, Paramount,
CA), using Scion Image software (Scion Corporation, Frederick, MD).
Weights of these samples were then individually recorded.
DNA and RNA Isolation from Transformants: Southern and Northern
Analyses
Genomic DNA was isolated from individual T1 plants
following the protocol of Dellaporta et al. (1983) . A PCR amplification using the paired primers described previously for the DGAT cDNA or for
the DGAT gene, was performed to confirm the presence of the cDNA in the
T1 transformants. Southern analyses (Southern, 1975 ) were
performed to further confirm and select those transformants containing
single or multiple copies of the inserted fragment. DNA samples were
digested with restriction enzymes BglII, resolved by
electrophoresis on a 1% (w/v) agarose gel, and Southern
blotting performed using a nylon filter (Hybond N+,
Amersham) according to Sambrook et al. (1989) . The DGAT cDNA fragment,
labeled with -[32P]dCTP (NEN/Mandel Scientific Co.,
Guelph, ON, Canada) using the Random Primer DNA labeling kit
(Life Technologies/Gibco-BRL, Cleveland) was used as a probe.
Hybridization was performed at 60°C according to Church and Gilbert
(1984) . The filter was then exposed to X-OMAT-AR film (Kodak,
Rochester, NY).
Northern analyses of DGAT transcripts in both control and transgenic
lines were performed as follows: Using the method of Lindstrom and
Vodkin (1991) , total RNA was extracted from developing T3
seeds at the mid-green stage of development (as defined previously by
Katavic et al., 1995 ; Zou et al., 1996 ). RNA samples were denatured with formaldehyde and separated on 1.2% (v/v)
formaldehyde-agarose gels. Ten to 40 µg of total RNA was loaded, and
the amount of RNA per lane was calibrated by the ethidium
bromide-staining intensity of the rRNA bands. The DGAT DNA probe was
32P-labeled by random-priming according to protocols of the
manufacturer (Life Technologies/Gibco-BRL), and the blots were
hybridized with 32P-labeled Arabidopsis DGAT cDNA under
stringent conditions (60°C). Relative intensities of hybridization
signals in autoradiograms from northern analyses were measured with an
Ultra Lum Electronic Dual Light Transilluminator using Scion Image software.
 |
ACKNOWLEDGMENTS |
The authors thank B. Panchuk, D. Schwab and Dr. L. Pelcher of
the PBI DNA Technologies Unit for sequencing and primer synthesis, Dr.
J. Giraudat for the gift of the Arabidopsis silique-specific cDNA
library, B. Chatson for the 1H-NMR analyses, L. Steinhauer
for additional technical assistance, and K. Yao and D. Hunter for
constructing the pSE vector. Critical reviews of this manuscript were
kindly provided by Drs. A.J. Cutler and F. Georges.
 |
FOOTNOTES |
Received February 8, 2001; accepted March 12, 2001.
1
This work was supported by the Saskatchewan
Department of Agriculture and Food (grant nos. 96000046 and 19990362).
This is National Research Council of Canada publication no. 43794.
*
Corresponding author; e-mail david.taylor{at}nrc.ca; fax
306-975-4839.
 |
LITERATURE CITED |
-
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ
(1990)
Basic local alignment search tool.
J Mol Biol
215: 403-410[CrossRef][Web of Science][Medline]
-
Barron EJ, Stumpf PK
(1962)
The biosynthesis of triglycerides by avocado mesocarp enzymes.
Biochem Biophys Acta
60: 329-337[Medline]
-
Bernerth R, Frentzen M
(1990)
Utilization of erucoyl-CoA by acyltransferases from developing seeds of Brassica napus (L.) involved in triacylglycerol biosynthesis.
Plant Sci
67: 21-28[CrossRef]
-
Bevan M
(1983)
Binary Agrobacterium vectors for plant transformation.
Nucleic Acid Res
12: 8711-8721[Abstract/Free Full Text]
-
Bouvier-Navé P, Benveniste P, Oelkers P, Sturley SL, Schaller H
(2000)
Expression in yeast and tobacco of plant cDNAs encoding acyl CoA:diacylglycerol acyltransferase.
Eur J Biochem
267: 85-96[Web of Science][Medline]
-
Bradford MM
(1976)
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72: 248-254[CrossRef][Web of Science][Medline]
-
Cao Y-Z, Huang AHC
(1986)
Diacylglycerol acyltransferase in maturing oil seeds of maize and other species.
Plant Physiol
82: 813-820[Abstract/Free Full Text]
-
Cao Y-Z, Huang AHC
(1987)
Acyl coenzyme A preference of diacylglycerol acyltransferase from maturing seeds of Cuphea, maize, rapeseed and canola.
Plant Physiol
84: 762-765[Abstract/Free Full Text]
-
Cases S, Smith JS, Zheng Y-W, Myers HM, Lear SR, Sande E, Novak S, Collins C, Welch CB, Lusis AJ
(1998)
Identification of a gene encoding an acyl CoA: diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis.
Proc Natl Acad Sci USA
95: 13018-13023[Abstract/Free Full Text]
-
Church GM, Gilbert W
(1984)
Genomic sequencing.
Proc Natl Acad Sci USA
81: 1991-1995[Abstract/Free Full Text]
-
Clough SJ, Bent AF
(1998)
Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J
16: 735-743[CrossRef][Web of Science][Medline]
-
Dahlqvist A, Banas A, Stymne S
(1997)
Selective channelling of unusual fatty acids into triacylglycerols.
In
J Sánchez, E Cerdá-Olmedo, E Martinez-Force, eds, Advances in Plant Lipid Research. Universidad de Sevilla, Seville, Spain, pp 211-214
-
Dahlqvist A, Ståhl U, Lenman M, Banas A, Lee M, Sandager L, Ronne H, Stymne S
(2000)
Phospholipid:diacylglycerol acyltransferase: an enzyme that catalyzes the acyl-CoA-independent formation of triacylglycerol in yeast and plants.
Proc Natl Acad Sci USA
97: 6487-6492[Abstract/Free Full Text]
-
Datla RSS, Hammerlindl JK, Panchuk B, Pelcher LE, Keller WA
(1992)
Modified binary plant transformation vectors with the wild-type gene encoding NPTII.
Gene
211: 383-384
-
Dellaporta SL, Wood J, Hicks JB
(1983)
A plant DNA minipreparation: version II.
Plant Mol Biol Rep
1: 19-21
-
Frentzen M
(1993)
Acyltransferases and triacylglycerols.
In
TS Moore Jr, ed, Lipid Metabolism in Plants. CRC Press, Boca Raton, FL, pp 195-230
-
Frentzen M, Wolter FP
(1998)
Plant lipid biosynthesis: fundamentals and agricultural applications.
In
JL Hardwood, ed, Society of Experimental Biology Seminar Series, Vol. 67. Cambridge University Press, New York, pp 247-272
-
Hobbs HD, Chaofu L, Hills M
(1999)
Cloning of a cDNA encoding acyltransferase from Arabidopsis thaliana and its functional expression.
FEBS Lett
452: 145-149[CrossRef][Web of Science][Medline]
-
Ichihara K, Takahashi T, Fujii S
(1988)
Diacylglycerol acyltransferase in maturing safflower seeds: its influences on the fatty acid composition of the triacylglycerol and on the rate of triacylglycerol synthesis.
Biochim Biophys Acta
958: 125-129[Medline]
-
Josefsson L-G, Lenman M, Ericson ML, Rask L
(1987)
Structure of a gene encoding the 1.7S storage protein, napin, from Brassica napus.
J Biol Chem
262: 12196-12201[Abstract/Free Full Text]
-
Katavic V, Friesen W, Barton DL, Gossen KK, Giblin EM, Luciw T, An J,
Zou J-T, MacKenzie SL, Keller WA et al. (2001) Improving erucic
acid content in rapeseed through biotechnology: what can the
Arabidopsis FAE1 and the yeast SLC1-1 genes
contribute? Crop Sci 41: (in press)
-
Katavic V, Haughn GW, Reed D, Martin M, Kunst L
(1994)
In planta transformation of Arabidopsis thaliana.
Mol Gen Genet
245: 363-370[CrossRef][Medline]
-
Katavic V, Reed DW, Taylor DC, Giblin EM, Barton DL, Zou J-T, MacKenzie SL, Covello PS, Kunst L
(1995)
Alteration of fatty acid composition by an EMS-induced mutation in Arabidopsis thaliana affecting diacylglycerol acyltransferase activity.
Plant Physiol
108: 399-409[Abstract]
-
Kennedy EP
(1961)
Biosynthesis of complex lipids.
Fed Pro Fed Am Soc Exp Biol
20: 934-940
-
Lacey DJ, Hills MJ
(1996)
Heterogeneity of the endoplasmic reticulum with respect to lipid synthesis in developing seeds of Brassica napus L.
Planta
199: 545-551
-
Lardizabal KD, Hawkins D, Thompson GA, inventors. January 13, 2000. Diacylglycerol acyltransferase proteins. Patent Application Nos.
PCT/US99/15243 and WO 00/01713
-
Lehner R, Kuksis A
(1993)
Triacylglycerol synthesis by an sn-1,2 (2, 3)-diacylglycerol transacylase from rat intestinal microsomes.
J Biol Chem
268: 8781-8786[Abstract/Free Full Text]
-
Lindstrom JT, Vodkin LO
(1991)
A soybean cell wall protein is affected by seed color genotype.
Plant Cell
3: 561-571[Abstract/Free Full Text]
-
Little D, Weselake RJ, Pomeroy MK, Furukawa-Stoffer T, Bagu J
(1994)
Solubilization and characterization of diacylglycerol acyltransferase from microspore-derived cultures of oilseed rape.
Biochem J
304: 951-958
-
Marillia E-F, Zou JT, Katavic V, Qi Q, Jako C, Barton DL, Friesen W, Giblin EM, Gossen KK, Kumar A
(2000)
Metabolic engineering of Brassica seeds oils: improvement of oil quality and quantity and alteration of carbon flux.
In
AD Arencibia, ed, Plant Genetic Engineering: Towards the Third Millenium. Elsevier Science Publishing, New York, pp 182-188
-
Mayorek N, Grinstein I, Bar-Tana J
(1989)
Triacylglycerol synthesis in cultured rat hepatocytes: the rate-limiting role of diacylglycerol acyltransferase.
Eur J Biochem
182: 395-400[Medline]
-
Mogami K, O'Donnell PT, Bernstein SI, Wright TRF, Emerson CP Jr
(1986)
Mutations of the Drosophila myosin heavy-chain gene: effects on transcription, myosin accumulation, and muscle function.
Proc Natl Acad Sci USA
83: 1393-1397[Abstract/Free Full Text]
-
Nykiforuk C, Laroche A, Weselake RJ
(1999)
Isolation and sequence analysis of a novel cDNA encoding a putative diacylglycerol acyltransferase from a microspore-derived cell suspension culture of Brassica napus L. cv Jet Neuf.
Plant Physiol
120: 99-123
-
Oelkers P, Behar A, Cromley D, Billheimer JT, Sturley ST
(1998)
Characterization of two human genes encoding acyl coenzyme A: cholesterol acyltransferase-related enzymes.
J Biol Chem
273: 26765-26771[Abstract/Free Full Text]
-
Oelkers P, Tinkelenberg A, Erdeniz N, Cromley D, Billheimer JT, Sturley SL
(2000)
A lecithin cholesterol acyltransferase-like gene mediates diacylglycerol esterification in yeast.
J Biol Chem
275: 15609-15612[Abstract/Free Full Text]
-
Okagaki RJ, Neuffer MG, Wessler SR
(1991)
A deletion common to two independently derived Waxy mutations in maize.
Genetics
128: 425-431[Abstract]
-
Perry HY, Bligny R, Gout E, Harwood JL
(1999)
Changes in Kennedy pathway intermediates associated with increased triacylglycerol synthesis in oil-seeds rape.
Phytochemistry
52: 799-804[CrossRef]
-
Perry HY, Harwood JL
(1993a)
Changes in the lipid content of developing seeds of Brassica napus.
Phytochemistry
32: 1411-1415[CrossRef]
-
Perry HY, Harwood JL
(1993b)
Use of [2-3H] glycerol precursor in radiolabelling studies of acyl lipids in developing seeds of Brassica napus.
Phytochemistry
34: 69-73[CrossRef]
-
Poirier Y, Ventre G, Caldelari D
(1999)
Increased flow of fatty acids toward
oxidation in developing seeds of Arabidopsis deficient in diacylglycerol acyltransferase activity or synthesizing medium-chain-length fatty acids.
Plant Physiol
121: 1359-1366[Abstract/Free Full Text] -
Routaboul J-M, Benning C, Bechtold N, Caboche M, Lepiniec L
(1999)
The TAG1 locus of Arabidopsis encodes for a diacylglycerol acyltransferase.
Plant Physiol Biochem
37: 831-840[CrossRef][Web of Science][Medline]
-
Rutar V
(1989)
Magic angle sample spinning NMR spectroscopy of liquids as a non-destructive method for studies of plant seeds.
J Agric Food Chem
37: 67-70[CrossRef]
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning, A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Settlage SH, Wilson RF, Kwanyuen P
(1995)
Localization of diacylglycerol acyltransferase to oil body associated endoplasmic reticulum.
Plant Physiol Biochem
33: 399-407
-
Shorrosh BS, inventor. November 9, 2000. Plant acyltransferases.
International Patent Application No. WO 00/66749
-
Smith SJ, Cases S, Jensen DR, Chen HC, Sande E, Tow B, Sanan DA, Raber J, Eckel RH, Farese RV Jr
(2000)
Obesity resistance and multiple mechanisms of triglyceride synthesis in mice lacking DGAT.
Nat Genet
25: 87-90[CrossRef][Web of Science][Medline]
-
Southern EM
(1975)
Detection of specific sequences among DNA fragments separated by gel electrophoresis.
J Mol Biol
98: 503-517[CrossRef][Web of Science][Medline]
-
Stobart AK, Stymne S, Höglund S
(1986)
Safflower microsomes catalyze oil accumulation in vitro: a model system.
Planta
169: 33-37[CrossRef][Web of Science]
-
Stobart K, Mancha M, Lenman M, Dahlqvist A, Stymne S
(1997)
Triacylglycerols are synthesized and utilized by transacylation reactions in microsomal preparations of developing safflower (Cartharmus tinctorius L.) seeds.
Planta
203: 58-66[CrossRef]
-
Stymne S, Stobart AK
(1987)
Triacylglycerol biosynthesis.
In
PK Stumpf, ed, The Biochemistry of Plants, Vol. 9. Academic Press, New York, pp 175-214
-
Taylor DC, Barton DL, Rioux KP, MacKenzie SL, Reed DW, Underhill EW, Pomeroy MK, Weber N
(1992)
Biosynthesis of acyl lipids containing very-long chain fatty acids in microspore-derived embryos of Brassica napus L. cv. Reston.
Plant Physiol
99: 1609-1618[Abstract/Free Full Text]
-
Taylor DC, Weber N, Barton DL, Underhill EW, Hogge LR, Weselake RJ, Pomeroy MK
(1991)
Triacylglycerol bioassembly in microspore-derived embryos of Brassica napus L. cv Reston.
Plant Physiol
97: 65-79[Abstract/Free Full Text]
-
Taylor DC, Weber N, Hogge LR, Underhill EW
(1990)
A simple enzymatic method for the preparation of radiolabeled erucoyl-CoA and other long-chain fatty acyl-CoAs and their characterization by mass spectrometry.
Anal Biochem
184: 311-316[CrossRef][Web of Science][Medline]
-
Tijburg LB, Geelen MJ, van Golde LM
(1989)
Regulation of the biosynthesis of triacylglycerol, phosphatidylcholine and phosphatidylethanloamine in the liver.
Biochim Biophy Acta
1004: 1-19[Medline]
-
Tzen TC, Cao Y, Laurent P, Ratnayake C, Huang HC
(1993)
Lipids, proteins and structures of seed oil bodies from diverse species.
Plant Physiol
101: 267-276[Abstract]
-
Vogel G, Browse J
(1996)
Cholinephosphotransferase and diacylglycerol acyltransferase: substrate specificities at a key branch point in seed lipid metabolism.
Plant Physiol
110: 923-931[Abstract]
-
Weselake RJ, Laroche A, Taylor DC, Zou J-T
(2000)
Development of Canola Germplasm with Increased Oil Formation Capacity: Final Report to the Alberta Agricultural Research Institute/Farming for the Future Program. Colin Bate Books, Calgary, Canada
-
Weselake RJ, Pomeroy MK, Furukawa TL, Golden JL, Little DB, Laroche A
(1993)
Developmental profile of diacylglycerol acyltransferase in maturing seeds of oilseed rape and safflower and micro-spore-derived cultures of oilseed rape.
Plant Physiol
102: 565-571[Abstract]
-
Weselake RJ, Taylor DC
(1999)
The study of storage lipid biosynthesis using microspore-derived cultures of oilseed rape.
Prog Lipid Res
38: 401-460[Medline]
-
Weselake RJ, Taylor DC, Pomeroy MK, Lawson SL, Underhill EW
(1991)
properties of diacylglycerol acyltransferase from microspore-derived embryos of Brassica napus L.
Phytochemistry
30: 3533-3538[CrossRef]
-
Yang H, Cromley D, Wang H, Billheimer JT, Sturley SL
(1997)
Functional expression of a cDNA to human acyl-coenzyme A: cholesterol acyltransferase in yeast.
J Biol Chem
272: 3980-3985[Abstract/Free Full Text]
-
Zou J-T, Brokx SJ, Taylor DC
(1996)
Cloning of a cDNA encoding the 21.2 kDa oleosin isoform from Arabidopsis thaliana and down-regulation of its expression in a mutant defective in diacylglycerol acyltransferase activity.
Plant Mol Biol
31: 429-433[CrossRef][Web of Science][Medline]
-
Zou J-T, Katavic V, Giblin EM, Barton DL, MacKenzie SL, Keller WA, Hu X, Taylor DC
(1997)
Modification of seed oil content and acyl composition in the Brassicaceae by expression of a yeast sn-2 acyltransferase gene.
Plant Cell
9: 909-923[Abstract/Free Full Text]
-
Zou J-T, Wei Y, Jako C, Kumar A, Selvaraj G, Taylor DC
(1999)
The Arabidopsis thaliana TAG1 mutant has a mutation in a diacylglycerol acyltransferase gene.
Plant J
19: 645-653[CrossRef][Web of Science][Medline]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
A. J. King, W. He, J. A. Cuevas, M. Freudenberger, D. Ramiaramanana, and I. A. Graham
Potential of Jatropha curcas as a source of renewable oil and animal feed
J. Exp. Bot.,
July 1, 2009;
60(10):
2897 - 2905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Weselake, S. Shah, M. Tang, P. A. Quant, C. L. Snyder, T. L. Furukawa-Stoffer, W. Zhu, D. C. Taylor, J. Zou, A. Kumar, et al.
Metabolic control analysis is helpful for informed genetic manipulation of oilseed rape (Brassica napus) to increase seed oil content
J. Exp. Bot.,
October 1, 2008;
59(13):
3543 - 3549.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Lardizabal, R. Effertz, C. Levering, J. Mai, M.C. Pedroso, T. Jury, E. Aasen, K. Gruys, and K. Bennett
Expression of Umbelopsis ramanniana DGAT2A in Seed Increases Oil in Soybean
Plant Physiology,
September 1, 2008;
148(1):
89 - 96.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Leroch, H. E. Neuhaus, S. Kirchberger, S. Zimmermann, M. Melzer, J. Gerhold, and J. Tjaden
Identification of a Novel Adenine Nucleotide Transporter in the Endoplasmic Reticulum of Arabidopsis
PLANT CELL,
February 1, 2008;
20(2):
438 - 451.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Wassom, V. Mikkelineni, M. O. Bohn, and T. R. Rocheford
QTL for Fatty Acid Composition of Maize Kernel Oil in Illinois High Oil x B73 Backcross-Derived Lines
Crop Sci.,
January 16, 2008;
48(1):
69 - 78.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Shockey, S. K. Gidda, D. C. Chapital, J.-C. Kuan, P. K. Dhanoa, J. M. Bland, S. J. Rothstein, R. T. Mullen, and J. M. Dyer
Tung Tree DGAT1 and DGAT2 Have Nonredundant Functions in Triacylglycerol Biosynthesis and Are Localized to Different Subdomains of the Endoplasmic Reticulum
PLANT CELL,
September 1, 2006;
18(9):
2294 - 2313.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Milcamps, A. W. Tumaney, T. Paddock, D. A. Pan, J. Ohlrogge, and M. Pollard
Isolation of a Gene Encoding a 1,2-Diacylglycerol-sn-acetyl-CoA Acetyltransferase from Developing Seeds of Euonymus alatus
J. Biol. Chem.,
February 18, 2005;
280(7):
5370 - 5377.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Mietkiewska, E. M. Giblin, S. Wang, D. L. Barton, J. Dirpaul, J. M. Brost, V. Katavic, and D. C. Taylor
Seed-Specific Heterologous Expression of a Nasturtium FAE Gene in Arabidopsis Results in a Dramatic Increase in the Proportion of Erucic Acid
Plant Physiology,
September 1, 2004;
136(1):
2665 - 2675.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Lin, J. E. Cluette-Brown, and H. M. Goodman
The Peroxisome Deficient Arabidopsis Mutant sse1 Exhibits Impaired Fatty Acid Synthesis
Plant Physiology,
June 1, 2004;
135(2):
814 - 827.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Vigeolas, J. T. van Dongen, P. Waldeck, D. Huhn, and P. Geigenberger
Lipid Storage Metabolism Is Limited by the Prevailing Low Oxygen Concentrations within Developing Seeds of Oilseed Rape
Plant Physiology,
December 1, 2003;
133(4):
2048 - 2060.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. T. Kaup, C. D. Froese, and J. E. Thompson
A Role for Diacylglycerol Acyltransferase during Leaf Senescence
Plant Physiology,
August 1, 2002;
129(4):
1616 - 1626.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|