|
Plant Physiol, July 2001, Vol. 126, pp. 1186-1195
Defoliation Induces Fructan 1-Exohydrolase II in Witloof
Chicory Roots. Cloning and Purification of Two Isoforms, Fructan
1-Exohydrolase IIa and Fructan 1-Exohydrolase IIb. Mass Fingerprint
of the Fructan 1-Exohydrolase II Enzymes1
Wim
Van den Ende,*
An
Michiels,
Dominik
Van Wonterghem,
Stefan P.
Clerens,
Joke
De Roover, and
André J.
Van Laere
Department of Biology, Laboratory for Developmental Biology, Botany
Institute, K.U. Leuven, Kasteelpark Arenberg 31, B-3001 Leuven,
Belgium (W.V.d.E., A.M., D.V.W., J.D.R, A.J.V.L.); Laboratoroy for
Neuroendocrinology and Immunological Biotechnology, Zoological
Institute, K.U. Leuven, Naamsestraat 59, B-3001 Leuven, Belgium
(S.P.C.)
 |
ABSTRACT |
The cloning of two highly homologous chicory (Cichorium
intybus var. foliosum cv Flash) fructan 1-exohydrolase cDNAs
(1-FEH IIa and 1-FEH IIb) is described. Both isoenzymes could be
purified from forced chicory roots as well as from the etiolated
"Belgian endive" leaves where the 1-FEH IIa isoform is present in
higher concentrations. Full-length cDNAs were obtained by a combination of reverse transcriptase-polymerase chain reaction (PCR), PCR and 5'-
and 3'-rapid amplification of cDNA ends using primers based on
N-terminal and conserved amino acid sequences. 1-FEH IIa and 1-FEH IIb
cDNA-derived amino acid sequences are most homologous to a new group of
plant glycosyl hydrolases harboring cell wall-type enzymes with acid
isoelectric points. Unlike the observed expression profiles of chicory
1-FEH I, northern analysis revealed that 1-FEH II is expressed when
young chicory plants are defoliated, suggesting that this enzyme can be
induced at any developmental stage when large energy supplies are
necessary (regrowth after defoliation).
 |
INTRODUCTION |
The most prominent storage
carbohydrate in the plant kingdom is starch, but fructan (a Fru
polymer) is used as a storage compound in about 15% of flowering plant
species (Hendry, 1993 ). Inulin-type fructans consists of linear -
(2 1) linked fructofuranosyl units and occur mainly in dicotyledonous
species, among which Jerusalem artichoke and chicory (Cichorium
intybus) are the most extensively studied species. Levan consists
of linear - (2 6) linked fructofuranosyl units, but more complex
and branched fructan types (graminan) are common in monocotyledonous
species (Shiomi, 1989 ; Livingston et al., 1993 ).
Besides acting as a reserve carbohydrate, fructan might fulfill also
other functions such as stress protectant (drought and cold) or
osmoregulator (Hendry, 1993 ; Livingston and Henson, 1998 ; Pilon-Smits
et al., 1995 ; Hincha et al., 2000 ), but the molecular mechanism behind
these putative roles is still obscure. Unlike starch, fructans are
water-soluble and are believed to be localized in the vacuole (Frehner
et al., 1984 ; Wiemken et al., 1986 ). However, the exclusive vacuolar
localization of fructan metabolism has recently been questioned
(Livingston and Henson, 1998 ).
Inulin synthesis involves two distinct enzymes: Suc:Suc 1-fructosyl
transferase (1-SST) and fructan:fructan 1-fructosyl transferase (1-FFT;
Edelman and Jefford, 1968 ). Additional enzymes are required for the
synthesis of more complex branched-type fructan, e.g. fructan:fructan
6G fructosyl transferase and Suc:fructan
6-fructosyl transferase (Vijn and Smeekens, 1999 ). Fructan breakdown is
catalyzed by fructan exohydrolase (FEH; G Fn + H2O G F(n 1) + F with n > 1) essentially transferring a
Fru moiety to a water molecule as acceptor. Only a few plant FEH
enzymes have been purified to electrophoretic homogeneity. They include
fructan 1-exohydrolase I (1-FEH I) and 1-FEH II from chicory (Claessens
et al., 1990 ; De Roover et al., 1999a ), a 1-FEH from Jerusalem
artichoke (Marx et al., 1997a ), a fructan 6-exohydrolase from
Lolium perenne (Marx et al., 1997b ), and a FEH that
preferentially hydrolyzes (2 6) (oat, Henson and Livingston,
1996 ) or (2 1) linkages (barley; Henson and Livingston,
1998 ).
Nowadays, food and non-food industries are eagerly looking for new
compounds like fructan and its derivatives or modified starches (Heyer
et al., 1999 ). Inulin is now widely recognized as a health-improving
compound when added to various foods as low-calorie sweetener, dietary
fiber, or fat replacer (Fuchs, 1991 ). It is suggested that a daily
intake of low amounts already generates a bifidogenic and antitumor
effect (Roberfroid et al., 1998 ; Taper et al., 1999 ).
We found sharp 1-FEH activity increases in mature chicory roots after
cold induction in the field or in cold rooms (Van den Ende and Van
Laere, 1996 ), but also in young fructan-containing chicory roots that
were defoliated or received high nitrogen nutrition after a period of
nitrogen starvation (De Roover et al., 1999b ; Van den Ende et al.,
1999 ). However, it was not clear what particular enzyme (1-FEH I and/or
1-FEH II) was induced at what particular stage since it is not possible
to distinguish between 1-FEH I and 1-FEH II activities in crude
extracts (De Roover et al., 1999a ). To resolve this issue, the cloning
of the respective 1-FEH cDNAs would allow a detailed study of the
expression of the respective genes throughout several developmental
stages and under different stress conditions. Next to chicory 1-FEH I
cDNA (Van den Ende et al., 2000a ), the 1-FEH II cDNAs are, to our
knowledge, the first plant FEH cDNAs described. This is in severe
contrast to the cDNAs from plant fructan biosynthetic enzymes of which
a large number have been cloned already (for review, see Vijn and
Smeekens, 1999 ). Also, a large number of microbial FEH cDNAs are known
(Burne et al., 1999 ; Kang and Kim, 1999 and refs. therein).
Plant FEHs are expected to be more homologous to plant invertases than
to plant fructosyl transferases since invertases and FEHs use water and
not fructan or Suc as a fructosyl acceptor. Moreover, for several plant
species it was demonstrated that a multigenic family of invertases
occurs that contains silent genes or genes that are expressed at very
particular places and/or during particular developmental stages (Unger
et al., 1994 ; Godt and Roitsch, 1997 ; Tymowska-Lalanne and Kreis, 1998 ;
Sturm, 1999 ). For all these reasons we first derived information at the
protein level (purification and N-terminal sequence analysis) and used this information in the first steps of our cloning strategy.
In this paper we focus on the analysis and cloning of two 1-FEH II
isoforms from witloof chicory roots, which are used for the production
of the vegetable "Belgian endives."
 |
RESULTS |
Purification of 1-FEH IIa and IIb and N-Terminal
Analysis
De Roover et al. (1999a) described the purification of 1-FEH II.
In their final fraction, a single 64-kD band was found on SDS-PAGE.
However, later N-terminal amino acid sequencing on this band was
ambiguous, indicating that this fraction was not pure. By performing an
additional Uno S cation exchange step at pH 5.2 on this fraction and
analyzing the fractions 29 through 40 by activity and
A280 measurements (Fig.
1), we demonstrate here the presence of
two different isoforms in the fraction obtained by De Roover et al.
(1999a) . The two independent enzymatically active isoforms were fully
separated and were termed 1-FEH IIa and 1-FEH IIb. In etiolated leaves
of Belgian endives, 1-FEH IIa is present at a higher concentration, but
has a lower specific activity than 1-FEH IIb (Fig. 1). For forced
roots, comparable results were obtained except that overall enzyme
concentrations were lower. Automated Edman degradation on the two
independent FEH II isoforms revealed the following N-terminal
sequences: QQIEQPYRTGYHFQP for 1-FEH IIa (Uno S fraction 36) and
QQIQQPYRTGYHFQP for 1-FEH IIb (Uno S fraction 32).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 1.
Purification of chicory 1-FEH IIa and IIb. Protein
content profile ( ) and 1-FEH II activity profile ( ) of the
different fractions obtained during final Uno S chromatography at pH
5.2. 1-FEH activity was measured by the Fru production from 3% (w/v)
inulin.
|
|
Cloning Strategy
Partial chicory 1-FEH IIa and IIb cDNAs were obtained by
performing reverse transcriptase- (RT) PCR using N-terminal sequencing information (P1, P2, and P3) combined with an antisense primer conserved within 1-FEH I and cell wall-type invertases (P5, Van den
Ende et al., 2000a ). After subcloning, two types of very homologous (but not identical) clones were obtained. Using this sequencing information, new (specific and/or phosphorylated) primers were derived
for performing 5'- and 3'-RACE RT-PCR and semi-nested PCR (Fig.
2A, for details, see also "Materials
and Methods"). Specific 5'- and 3'-outer primers and a proofreading
DNA polymerase were used to amplify the whole cDNAs (2 kb in length).
Both cDNAs encode a polypeptide of 581 amino acids. The coding region
is preceded by a very short 5'-untranscribed part and followed by longer 3'-untranslated regions (304 bp for 1-FEH IIa and 251 bp for
1-FEH IIb).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 2.
Cloning of chicory 1-FEH IIa and IIb. A, Schematic
representation of the 1-FEH IIa and IIb cDNAs from chicory. Both cDNAs
contain a single open reading frame (Start-Stop) of 1,743 bp. The first
part of this open reading frame is a putative signal sequence (black)
of 104 bp. 3'- and 5'-untranslated parts are also present (line).
Primers used during RT-PCR, PCR, 5'-, and 3'-RACE RT-PCR are indicated
with arrows (for details, see "Materials and Methods"). Probes were
prepared by using the primers P14-P15 (1-FEH IIa) or P14-P16 (1-FEH
IIb). B, Alignment of the deduced amino acid sequences of chicory root
1-FEH IIa, 1-FEH IIb, and 1-FEH I. The posttranslationally removed
signal sequences are indicated (underlined and bold). Potential
glycosylation sites are double underlined. For 1-FEH IIa and IIb,
tryptic fragments found after quadrupole-time of flight (Q-TOF)
mass spectrometry/mass spectroscopy (MS/MS) analysis are
indicated (bold). Consensus line: asterisks indicate identical
residues, colons indicate conserved subsitutions, and periods indicate
semi-conserved substitutions.
|
|
The deduced amino acid sequences for chicory 1-FEH IIa, 1-FEH IIb, and
1-FEH I are presented in Figure 2B. Comparison of the cDNA-derived
amino acid sequences with the experimentally determined N-terminal
sequences (see higher), as well as the unambiguous identification of
the amino terminal tryptic fragments by collision-induced dissociation
(CID) MS/MS (Tables I and
II), demonstrates that the primary
translation products have a 38-amino acid signal peptide that is
post-translationally removed. The cDNA-derived isoelectric points (pIs)
of chicory 1-FEH IIa and IIb are calculated at 5.24, which perfectly
fits with isoelectric focusing-PAGE and chromatographic behavior (De
Roover et al., 1999a ). Furthermore, the mature 1-FEH IIa and IIb
proteins contain three potential glycosylation sites (N-X-S/T; see Fig.
2B). The calculated molecular mass of the mature 1-FEH II enzymes (61 kD) is slightly lower than the estimated 64 kD from SDS-PAGE, but this
can be explained by the effective glycosylation being present at least
on two out of three potential glycosylation sites (Table I).
View this table:
[in this window]
[in a new window]
|
Table I.
Fragment ions detected in Q-TOF after tryptic digest
of 1-FEH IIa, with calculated matches to theoretical digest of virtual
cDNA derived protein, and confirmation of identity by tandem MS/MS
sequencing
Glycosylation sites NX(S/T) are presented in bold. The position of the
fragments in the mature 1-FEH IIa protein are indicated.
|
|
View this table:
[in this window]
[in a new window]
|
Table II.
Fragment ions detected in Q-TOF after tryptic
digest of 1-FEH IIb, with calculated matches to theoretical digest of
virtual cDNA derived protein, and confirmation of identity by tandem
MS/MS sequencing
Glycosylation sites NX(S/T) are presented in bold. The position of the
fragments in the mature 1-FEH IIb protein are indicated.
|
|
The 1-FEH IIa Gene also Contains the Typical Invertase
Mini-Exon
Most invertases (Sturm, 1999 ) contain a mini-exon (exon 2) that
encodes for the tripeptide DPN of the conserved motif W(I/M) NDPNG
(Pons et al., 1998 ). For chicory 1-FEH IIa we performed PCR on genomic
DNA by using a combination of undegenerated versions of primers P1 and
P5, followed by nested PCR with primers P3 and P5. This resulted in a
genomic fragment that was subcloned and sequenced at its 5' part. The
fragment contained the 3' part of the first exon, followed by a first
AT-rich (62%) intron of 264 bp, the 9-bp mini-exon 2, and finally,
part of a second intron (not fully sequenced). Similar data were
obtained for chicory 1-FEH I (not shown).
Homology to Other Glycosyl Hydrolases
As observed for chicory 1-FEH I (Van den Ende et al., 2000a ), the
cDNA-derived amino acid sequences of 1-FEH IIa and IIb are more
homologous to cell wall invertases (43%-59% identical amino acids)
than to vacuolar invertases (40%-41% identical) and fructan biosynthetic enzymes (33%-39% identical). Homologies to microbial fructan hydrolases are much lower (13%-24% identical). 1-FEH IIa and
IIb are 94% homologous. Homology to chicory 1-FEH I is much lower:
51% for 1-FEH IIa and 50% for 1-FEH IIb.
An unrooted radial tree of some members of cell wall-type glycosyl
hydrolases is presented in Figure 3. Four
distinct groups can be discerned: the first group (I) contains
monocotyledonous and mainly basic cell wall invertases. The
second group (II) contains dicotyledonous, basic cell wall-type
invertases. A third group (III) also contains dicotyledonous and mainly
basic cell wall-type invertases, but there is one exception: an acid
cell wall invertase from Arabidopsis (CW INV5). A fourth group (IV)
contains monocotyledonous and dicotyledonous enzymes, and harbors the
three chicory 1-FEH cDNAs. Within this group, all members have an
acidic pI.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 3.
Unrooted phylogenetic tree containing cell
wall-type invertase-like cDNA-derived amino acid sequences. Four groups
can be discerned. I, Maize cell wall invertase (CW INV) 1, 2, and 3;
and wheat CW INV. II, Broad bean CW INV1; carrot CW INV 1, 2, and 3;
potato CW INV1, E, and F; tomato CW INV5; and Arabidopsis CW INV2 and
3. III, Arabidopsis CW INV, CW INV1, and 5; broad bean CW INV2; pea CW
INV; and Chenopodium rubrum CWINV 1 and Fragaria × ananassa CW INV; IV, Maize CW INV4; rice CW INV; Arabidopsis
fructosidase; and chicory 1-FEH I, IIa, and IIb. pIs, as well as cDNA
names or accession numbers, are given between brackets in the figure.
The scale bar indicates a distance value of 0.1.
|
|
Q-TOF Analyses on 1-FEH IIa and IIb Tryptic
Fragments
Theoretical tryptic digests on the cDNA-derived 1-FEH
IIa and IIb protein sequences yielded 48 peptides for both isoforms (designated T1-T48 from N to C terminus). The two independent 1-FEH
IIa (Uno S fraction 36) and 1-FEH IIb (Uno S fraction 32) isoforms were
gel purified. Masses of ZipTip-eluted tryptic peptides were determined
by Q-TOF and were compared (Tables I and II) with the masses of
theoretical peptides (with the consideration of one possible missed
cleavage site). All except four masses detected matched, within the
acceptable mass measurement error of ±1 D, with one of the theoretical
fragments (Tables I and II). CID MS/MS analysis yielded a number of
sequence tags (Mann and Wilm, 1994 ), which proved the identity of the
tryptic peptides (Tables I and II). Special attention was given to the
unexplained 1,066.5 [2+], 892.05 [3+], and 1,234.25 [3+]
fragments. After fragmentation they all proved to be glycosylated
peptides. One of these fragments (892.05 [3+]) contains one missed
cleavage site (Table I). These fragments fit perfectly well with two
out of three potential N-glycosylation sites (see Fig. 2B). Further detailed analysis revealed the carbohydrate composition of the respective glycosyl rests (Tables I and II).
1-FEH II Expression
1-FEH IIa and IIb cDNAs are very homologous (92% identity
at the DNA level) and hence, no specific probes could be developed to
differentiate between the two isoforms (cross-hybridization of probes
during Southern analysis at 68°C, data not shown). Therefore, during
northern analysis we only used a 1-FEH IIa probe. We verified that
1-FEH IIa and 1-FEH I probes did not cross-hybridize (not shown). From
Figure 4A, it is clear that chicory 1-FEH
II is abundantly expressed in leaves of Belgian endives, but also in
the cold-stored (vernalized) and forced chicory roots, whereas no
signals were found in leaves and roots of very young chicory plants.
The pattern is different from 1-FEH I, which is mainly expressed in
cold-stored roots and not at all in Belgian endive leaves.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 4.
Expression of chicory 1-FEH genes. A, Northern
blot containing RNA from a 7-week-old chicory root, a 7-week-old
chicory leaf, a mature chicory root after 1 week of cold storage, and a
forced chicory root after 3 weeks of forcing. B, Northern blot
containing RNA from mature field-grown chicory roots between September
10 and November 5 and subsequent storage for 3 weeks in cold room
(arrow indicates start of storage). Sampling dates are presented on the
figure. C, Northern blot containing 10 µg RNA from the roots of
control and defoliated young plantlets. Chicory root 1-FEH I, IIa, and
18S rRNA were used as probes.
|
|
In field-grown roots throughout the growing season, the expression
pattern of chicory 1-FEH II is similar to that of 1-FEH I, although
expression seems to be induced at a later stage of development. The
strongest signals for 1-FEH I and 1-FEH II mRNA were obtained when
plants were defoliated and roots were stored in a cold room for 1 week
(Fig. 4B).
Figure 4C shows the expression of chicory 1-FEH I and II after
defoliation of young chicory plants. No expression of 1-FEH I and 1-FEH
II could be detected in roots of control plants. However, in roots of
defoliated plants, expression of 1-FEH IIa was rapidly initiated (after
1 d), whereas no expression of 1-FEH I became apparent. Because
plant regrowth after defoliation was slow, 1-FEH IIa expression
remained high until d 15 after start and only declined on the last
sampling date.
 |
DISCUSSION |
In this paper we describe the isolation of two highly homologous
cDNAs encoding chicory root 1-FEH IIa and IIb. We purified the two
independent isoforms from Belgian endive leaves (Fig. 1) and from
forced chicory roots to deduce their N-terminal protein sequences and
perform molecular mass analyses on their tryptic fragments. For
cloning, the use of N-terminal and conserved degenerate primers proved
a successful strategy to isolate partial 1-FEH II cDNAs. 5'- and
3'-RACE RT-PCR were used to obtain the complete 1-FEH II cDNAs (Fig.
2). Q-TOF MS/MS analyses on the two independent 1-FEH II isoforms
(Tables I and II) convincingly demonstrated the link between the cDNAs
obtained and the biologically active 1-FEH II enzymes (Fig. 1) by
approving 35% (FEH IIa) or 21% (FEH IIb) of the cDNA-derived sequence
information (Tables I and II; Fig. 2B).
Chicory 1-FEH cDNAs group together with cell wall-type enzymes (Fig. 3)
and not with vacuolar invertases and fructosyl transferases (Van den
Ende et al., 2000a ). Genes encoding plant fructan biosynthetic enzymes
(1-SST, 1-FFT, Suc:fructan 6-fructosyl transferase, and fructan:fructan
6G fructosyl transferase) seem to have evolved
from ancestral vacuolar invertase genes by relatively few mutational
changes (Wiemken et al., 1995 ). On the contrary, genes encoding plant
1-FEHs seem to have evolved from an ancestral cell wall invertase gene.
Four subgroups of cell wall invertases become apparent (Fig. 3),
suggesting multiple duplication of the ancestral cell wall invertase
gene. One subgroup containing the chicory 1-FEHs (IV, Fig. 3) can
clearly be discerned from the other groups by their acidic pIs and the presence of putative C-terminal vacuolar-targeting signals (see Van den
Ende et al., 2000a ). This suggests an evolutionary pressure toward the
development of "cell wall-like" vacuolar FEHs and/or invertases.
The reasons why chicory 1-FEHs have evolved from a cell wall-type
ancestral invertase and not from a vacuolar invertase gene are far from
clear. It can be speculated that cell wall invertase genes might have
been better candidates for the development of genuine 1-FEHs, being
capable of using oligo- or polysaccharides instead of Suc as fructosyl
donors. In this regard, it has been demonstrated that native purified
extracellular invertases from carrot show a much higher cleavage rate
for raffinose than carrot vacuolar enzymes (Unger et al., 1994 and
refs. therein). Moreover, it was recently demonstrated that the
different substrate specificity between vacuolar invertases (containing
the conserved WECVD motif) and extracellular invertases (containing the
conserved WECPD motif) was fully determined by a single amino acid
substitution (P to V; Goetz and Roitsch, 1999 ). All members of group IV
(Fig. 3) contain a P in this conserved motif.
By vacuole isolation experiments from protoplasts and enzymatic
activity measurements, it has long been demonstrated that fructan and
fructan metabolizing enzymes, including FEH, are located in the
vacuolar sap (Wiemken et al., 1986 ). However, in a recent report,
fructan and FEH activity were also found in the crown apoplast of
winter oat (Livingston and Henson, 1998 ), suggesting the presence of
FEH outside the cell under certain circumstances. We have purified
chicory 1-FEH IIa and IIb in roughly the same way as the soluble,
vacuolar 1-SST and 1-FFT enzymes (same amount of starting material,
same extraction buffer, removal of cell wall fraction by
centrifugation, and a similar purification strategy) and we found about
the same amount of pure protein. In a similar manner as described for
chicory 1-FEH I (Van den Ende et al., 2000a ), we attempted to purify
the 1-FEH II enzymes from apoplastic fluid (prepared as in Boller and
Métraux, 1988 ; Isla et al., 1999 ) as well as from total root
extracts. No significant amounts higher than could be explained by
cellular leakage were detected in the apoplastic fluid (data not
shown), suggesting that the 1-FEH II enzymes are localized in the vacuole.
These observations are in conflict with the data obtained for INCW4 of
maize, another representative of group IV (Fig. 3) of acidic cell
wall-type enzymes (Kim et al., 2000 ). The authors suggested that INCW4
could be a new type of cell wall invertase present in a free form in
the apoplast, although their results do not fully exclude a vacuolar
localization. Immunocytochemical methods might help corroborating in
the cellular localization the chicory 1-FEH enzymes or other
representatives of group IV (Fig. 3).
The widely used criteria to discriminate between vacuolar and
extracellular enzymes (extracellular enzymes have a basic pI and
vacuolar enzymes have an acid pI; extracellular enzymes have WECPD and
vacuolar enzymes have WECVD; Goetz and Roitsch, 1999 ) perhaps need to
be reconsidered. Besides the different pI and putative vacuolar
localization of group IV glycosyl hydrolases, their genomic
organization resembles that of typical invertases (presence of a
mini-exon in 1-FEH IIa and 1-FEH I, data not shown).
Chicory 1-FEH II is highly expressed in Belgian endive leaves and in
forced roots (Fig. 4A). Throughout the 1998 growing season (Fig. 4B),
1-FEH I was expressed earlier than 1-FEH II in field-grown chicory
roots, but both 1-FEH genes were heavily expressed when roots were
harvested and cold stored. As a consequence, manipulation of fructan
catabolism in commercial chicory roots would not only imply the control
of chicory 1-FEH I, but also of 1-FEH IIa and IIb. Increased FEH
activity results in massive breakdown of fructan and production of Fru
and inulo-n-oses (Van den Ende et al., 1996a , 1996b ). The
latter phenomena are to be avoided for industrial fructan production.
We earlier demonstrated that a sudden 1-FEH activity increase and
fructan breakdown could be induced in young chicory roots after
defoliation (De Roover et al., 1999b ). Due to the loss of photosynthate
(Suc) entering the root, the root has to switch abruptly from a sink to
a source organ since substrates and energy are needed for general
maintenance and for sustaining the leaf meristematic tissues that
remain a strong sink for carbohydrate. We show here that chicory 1-FEH
II and not chicory 1-FEH I is responsible for the observed 1-FEH
activity after defoliation (Fig. 4C). This indicates that 1-FEH II very
likely can be considered as a "survival" enzyme that can be induced
at any physiological stage or whenever energy demands greatly increase.
This can for instance be the case in periods when an increased nitrogen
uptake, reduction and metabolism of nitrogen occur (Van den Ende et
al., 1999 ), or when a fast regrowth is necessary (early spring
regrowth, flowering, or after grazing, mowing, or other physical damage to the photosynthetic apparatus).
From Figure 4, it can be concluded that chicory 1-FEH I and IIa are
regulated in a different way. The 1-FEH II genes might be induced by a
sudden drop of photosynthate (Suc?) entering the root (see also Mino et
al., 1978 ). It is apparent that the same trigger is not able to induce
chicory 1-FEH I, at least not in young roots. It was previously
suggested that cold is an essential trigger for 1-FEH I induction (Van
den Ende et al., 1996b , 2000a ). Although chicory 1-FEH II now has been
shown to provide the energy for leaf regrowth after defoliation, the
role of 1-FEH I induction in mature field-grown chicory roots during
autumn is still obscure since no large energy supplies are necessary at
this moment. In this case it can be speculated that the shift from
higher to lower degree of polymerization fructan by the concerted
action of 1-FEH I and 1-FFT might in some way protect the plants
against frost damage.
Further research is necessary to understand how and why fructan
hydrolases have evolved from cell wall invertases, where they are
localized, and how they are regulated throughout different developmental stages. Other types of FEH, controlled in a different way, may be present in nature, e.g. the FEH that is responsible for the
rapid breakdown of fructan in flower petals driving flower opening by
osmotic forces (Bieleski, 1993 ; Vergauwen et al., 2000 ).
In conclusion, we have cloned two different 1-FEH II cDNAs that encode
two independent enzymatically active 1-FEH II isoforms. The cloning of
chicory 1-FEH II cDNAs is interesting from a scientific and an
agro-economical point of view. Like chicory 1-FEH I, 1-FEH IIa and IIb
are unexpectedly related to cell wall invertases, although a vacuolar
localization is proposed. Our data indicate that chicory 1-FEH I and
1-FEH II are expressed under different conditions and are regulated in
a different way, but further research is necessary to understand the
fine-tuning of the gene expression and regulation. 1-FEH II is strongly
induced in roots after defoliation, suggesting that 1-FEH II can be
considered a "survival" enzyme that is induced at times when energy
demands largely increase.
 |
MATERIALS AND METHODS |
Plant Material
Chicory (Cichorium intybus var. foliosum cv
Flash) was sown in a local field with sandy, loamy soil on May 18, 1998. Since the induction of 1-FEH activity in field-grown chicory
roots coincides with low temperatures around mid-October (Van den Ende
and Van Laere, 1996 ; Van den Ende et al., 1996b ), field-grown chicory roots were collected weekly between September 10 and November 5. Afterward, on November 8, plants were uprooted, defoliated, and stored
for 3 weeks at 1°C. Throughout storage, root samples were taken on
November 10, 16, 23, and 30. Roots were subsequently forced (start
December 1), as described in Van den Ende et al. (1996b) . After 3 weeks, samples were taken from Belgian endive leaves, as well as from
the forced roots on which they were grown. Similar material was used
for enzyme purification purposes.
Plants were also grown in a controlled growth chamber as described in
De Roover et al. (2000) . Seven weeks after sowing, a number of young
plants were defoliated and root samples were taken at 0, 1, 2, 3, 5, 10, 15, and 21 d after defoliation. Intact chicory seedlings were
used as control.
Purification of 1-FEH IIa and IIb and N-Terminal
Sequencing
1-FEH IIa and IIb were purified from Belgian endive leaves and
also from forced roots as described (De Roover et al., 1999a ) except
that an additional Uno S step at pH 5.2 was performed to fully separate
the two different isoforms. 1-FEH IIa (Uno S fraction 36) and IIb (Uno
S fraction 32) were subjected to SDS-PAGE, blotted on a polyvinylidene
difluoride membrane, and their N-termini were sequenced by automated
Edman degradation. FEH activities were measured as described in Van den
Ende et al. (1999) .
Q-TOF Analyses on FEH II Tryptic Fragments
The two different SDS-PAGE protein bands of 1-FEH IIa (Uno S
fraction 36) and IIb (Uno S fraction 32) exhibiting 1-FEH activity were
also subjected to MS identification. The Coomassie Brilliant Blue-stained proteins were excised from the gel, thoroughly washed in
water and 50% (v/v) acetonitrile, respectively, and dried by vacuum
centrifugation. The gel pieces were subsequently reswollen and
incubated for 16 h at 37°C in 30 µL of 25 mM
NH4HCO3 (pH 8.0) containing 10% (v/v)
acetonitrile and 0.1 µg of trypsin (sequencing grade-modified porcine
trypsin, Promega, Madison, WI). The resulting tryptic fragments were
extracted twice with 50 µL of 7.5% (v/v) acetonitrile/0.1% (v/v)
trifluoracetic acid (TFA) and were desalted using ZipTip C18 pipette
tips (Millipore, Bedford, MA). The ZipTips were subsequently washed in
100% (v/v) acetonitrile (HPLC grade, Riedel-De Haën, Seelze,
Germany) and 50% (v/v) acetonitrile with 0.1% (v/v) TFA in water. The
tips were then equilibrated in 0.1% (v/v) TFA. The peptide extract was
bound to the C18 silica by repeated pipetting. Repeated washing and
desalting of the peptides was done in 0.1% (v/v) TFA followed by 0.1%
(v/v) formic acid in water. The peptides were eluted in 3 µL of 60%
(v/v) acetonitrile-1% (v/v) formic acid in water. This solution was
deposited into a gold-coated borosilicate nanoflow needle (Protana,
Odense, Denmark) that was fitted in the nano-electrospray source of a
hybrid quadrupole-TOF electron spray ionization instrument
(Q-TOF by Micromass, Wythenshawe, UK). An MS survey spectrum was
acquired, after which individual peptides were selected in the
instrument's quadrupole and subjected to CID, yielding MS/MS spectra
of the fragmented peptides. Sequence information was derived from the
MS/MS spectra with the aid of the MaxEnt 3 software (deconvoluting and
de-isotoping of data) as well as the PepSeq component of the Biolynx
software package (Micromass).
RNA Isolation, RT-PCR, and Subcloning
Total RNA was isolated from forced roots and from Belgian
endive leaves by using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). Based on the N-terminal amino acid sequence of the purified 1-FEH
IIa (QQIEQPYRTGYHFQP) and 1-FEH IIb (QQIQQPYRTGYHFQP),
we constructed three degenerated sense primers: P1
(5'-CARCARATHGARCARCC-3'), P2 (5'- CARCARATHCARCARCC-3'), and
P3 (5'-GGNTAYCAYTTYCARCC-3'). The conserved amino acid sequence MWECVD
in vacuolar invertases and fructosyl transferases was used to make the
antisense primer, P4 (5'-GTANARRTCNACRCAYTCCCACAT-3'). The
conserved amino acid sequence ECPDF in cell wall invertases was used to
create the antisense primer, P5 (5'- GGGWAMARRTCNGGRCAYTCC-3').
One-step RT-PCR was performed (Access RT-PCR System, Promega) by using the combinations P1-P4, P1-P5, P2-P4, and P2-P5. It was surprising that
only weak bands of about 600 bp were produced for the P1-P5 and P2-P5
combinations. "Partial touchdown RT-PCR" on total RNA was used
under the following conditions: 94°C for 3 min followed by 10 cycles
at 94°C for 40 s and 52°C for 40 s (with temperature decrease of 0.5°C each cycle), and 72°C for 1 min, and then 25 more
cycles at 94°C for 40 s, 47°C for 40 s (constant), and
72°C for 1 min. Final extension was at 72°C for 10 min (PCR Access kit, Promega). Semi-nested PCR was subsequently performed on these PCR
products with primers P3 and P5. PCR conditions were identical. The
resulting PCR fragments were ligated in the Topo-TA vector and
transformed to Escherichia coli (Topo-TA cloning
kit, Invitrogen, Groningen, The Netherlands). Plasmid was extracted
using Wizard Plus SV Minipreps (Promega). Partial sequencing yielded
two types of clones (named pFEH IIa and pFEH IIb).
5'- and 3'-RACE
The 3' parts of both cDNAs were found by first performing
one-step RT-PCR (see above) with P6 (5'- ACCAATACAATCCGTATGCAG -3') and
an oligo dT-based antisense primer (5'-CTCGCTCGCCCAT27-3'). Two
specific primers were subsequently chosen for each clone: P7 (5'-
ACAATCCGTATGCAGCAACG -3') for FEH IIa and P8
(5'-ACAATCCGTATGCAGCAACC-3') for FEH IIb. Semi-nested PCR was then
performed (P7-oligo dT; P8-oligo dT), resulting in PCR products of
about 1,800 bp that were subcloned and from which the 3' parts were
sequenced. A P5-derived 5'-phosphorylated antisense primer was then
constructed (5'-P-GGGTAAAARTCCGGGCACTCC-3'). Total RNA was
reverse-transcribed with this primer and was ligated to obtain
single-stranded circular cDNA (5'-Full RACE Core Set, TaKaRa, Otsu,
Shiga, Japan). This mixture was used in a PCR reaction (LA PCR
TaKaRa) with the primers P6 and P9 (5'-GTCCATTGGGATCGTTCATC-3'). A
second semi-nested PCR with P7-P9 (1-FEH IIa) or P8-P9 (1-FEH IIb)
resulted in a few bands. The largest ones were excised from the gel and
PCR products were recovered as described in the Wizard PCR preps
protocol (Promega). After subcloning and sequencing, the 5' part of
1-FEH IIa and IIb cDNAs were determined.
Generation of Full-Length cDNA
Based on the sequences of 5'- and 3'-RACE products, full-length
cDNAs were obtained by choosing specific primers at the extreme 5' and
3' parts. For 1-FEH IIa, P10 (5'-CACACACTCATCATGAAGAAATCA-3') and P11
(5'-TTTTTTTGCTCA-AATATTGTAGTTGTA-3') were chosen. For 1-FEH IIb, P12
(5'-CACACACTCATC-ATGAAGAAATCT-3') and P13
(5'-TTTAATGAAACAATAATTTGTTACAATG-3') were chosen. First, total RNA
was reverse-transcribed with AMV Reverse Transcriptase XL
(TaKaRa) using P12 and P13, respectively, at 50°C for 1 h. A
number of independent PCRs were then performed with P10-P11 and
P12-P13, respectively. Proofreading Pfu DNA polymerase was used
(Promega). PCR conditions included 35 cycles at 94°C for 30 s;
59°C for 40 s, and 72°C for 5 min. After A-tailing with dATP,
fragments were ligated in TOPO-XL vector (Invitrogen). The sequences
were deposited in the EMBL sequence library (accession no. AJ295033 for
1-FEH IIa and AJ295034 for 1-FEH IIb).
Sequencing and Computer Analysis
From a number of clones, the full-length 1-FEH IIa and 1-FEH IIb
fragments were fully sequenced on both DNA strands by Eurogentec (Seraing, Belgium) using the BigDye Terminator technology (Applied Biosystems, Foster City, CA). General DNA and protein sequence analyses
were carried out with the DNASIS 1.2 software (Hitachi, Alameda,
CA ). For the construction of a phylogenetic tree and multiple
alignments, sequences were extracted from EMBL, PIR, and SWISSPROT
databases and were sent to CLUSTAL W from which the results were
exported to the TREEVIEW program for construction of a phylogenetic tree.
Probe Preparation and Northern Analysis
PCR with primer combinations P14 (5'-GGTGTACGGCGGCAGTG-3')
and P15 (5'-TTTTGAGTCCCATTATTGAACA-3') for 1-FEH IIa or P14 and P16 (5'-TTTTGAGTCCCGTTATTGAACG-3') for 1-FEH IIb was performed for
probe preparation. The 850-bp PCR products were further purified on a
PCR-Wizard column (Promega) and were then labeled by a random-primed method using the DNA-labeling T7 QuickPrime Kit (Pharmacia Biotech, Piscataway, NJ) and [ -32P] dCTP, as described in Feinberg and Vogelstein (1984) . 18S ribosomal probe was prepared as described (De
Roover et al., 2000 ).
RNA from 1 g of frozen plant material was extracted using an RNA
extraction kit (TR-118, Euromedex, France). Total RNA (10 µg) was
pretreated, blotted, and hybridized as earlier described (Van den Ende
et al., 2000b ). To check whether equal amounts of RNA were loaded in
each well, the membrane was also hybridized with the radiolabeled
chicory 18S rRNA probe.
 |
ACKNOWLEDGMENT |
The authors want to thank E. Nackaerts for his technical assistance.
 |
FOOTNOTES |
Received February 16, 2001; accepted February 22, 2001.
1
This work was supported by the Fund for
Scientific Research, Flanders (grant to W.V.d.E., S.P.C., and
J.D.R.).
*
Corresponding author; e-mail
wim.vandenende{at}bio.kuleuven.ac.be; fax 32-16-321967.
 |
LITERATURE CITED |
-
Bieleski RL
(1993)
Fructan hydrolysis drives petal expansion in the ephemeral daylily flower.
Plant Physiol
103: 213-219[Abstract]
-
Boller T, Métraux JP
(1988)
Extracellular localization of chitinase in cucumber.
Physiol Mol Plant Pathol
33: 11-16
-
Burne RA, Wen ZT, Chen YY, Penders JE
(1999)
Regulation of expression of the fructan hydrolase gene of streptococcus mutans GS-5 by induction and carbon catabolite repression.
J Bacteriol
181: 2863-2871[Abstract/Free Full Text]
-
Claessens G, Van Laere A, De Proft M
(1990)
Purification and properties of an inulinase from chicory roots (Cichorium intybus L.).
J Plant Physiol
136: 35-39[Web of Science]
-
De Roover J, De Winter M, Van Laere A, Timmermans JW, Van den Ende W
(1999a)
Purification and properties of a second fructan exohydrolase from the roots of Cichorium intybus L.
Physiol Plant
106: 28-34[CrossRef]
-
De Roover J, Van den Branden K, Van Laere A, Van den Ende W
(2000)
Drought induces fructan synthesis and 1-SST (sucrose:sucrose 1-fructosyl transferase) in roots and leaves of chicory seedlings (Cichorium intybus L).
Planta
210: 808-814[CrossRef][Web of Science][Medline]
-
De Roover J, Van Laere A, Van den Ende W
(1999b)
Effect of defoliation on fructan pattern and fructan metabolizing enzymes in chicory roots (Cichorium intybus).
Physiol Plant
106: 158-163[CrossRef]
-
Edelman J, Jefford TG
(1968)
The mechanism of fructosan metabolism in higher plants as exemplified in Helianthus tuberosus.
New Phytol
67: 517-531[CrossRef]
-
Feinberg AP, Vogelstein B
(1984)
Addendum: a technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal Biochem
137: 266[CrossRef][Web of Science][Medline]
-
Frehner M, Keller F, Wiemken A
(1984)
Localization of fructan metabolism in the vacuoles isolated from protoplasts of Jerusalem artichoke.
J Plant Physiol
116: 197-208[Web of Science]
-
Fuchs A
(1991)
Current and potential food and non-food applications of fructans.
Biochem Soc Trans
19: 555-560[Medline]
-
Godt DE, Roitsch T
(1997)
Regulation and tissue-specific distribution of mRNAs for three extracellular invertase isoenzymes of tomato suggests an important function in establishing and maintaining sink metabolism.
Plant Physiol
115: 273-282[Abstract]
-
Goetz M, Roitsch T
(1999)
The different pH optima and substrate specificities of extracellular and vacuolar invertases from plants are determined by a single amino acid substitution.
Plant J
20: 707-711[CrossRef][Web of Science][Medline]
-
Hendry G
(1993)
Evolutionary origins and natural functions of fructans: a climatological, biogeographic and mechanistic appraisal.
New Phytol
123: 3-14
-
Henson CA, Livingston DP
(1996)
Purification and characterization of an oat fructan exohydrolase that preferentially hydrolyzes
-2,6 fructans.
Plant Physiol
110: 639-644[Abstract] -
Henson CA, Livingston DP
(1998)
Characterization of a fructan exohydrolase purified from barley stems that hydrolyzes multiple fructofuranosidic linkages.
Plant Physiol Biochem Paris
36: 715-720[CrossRef]
-
Heyer AG, Lloyd JR, Kossmann J
(1999)
Production of modified polymeric carbohydrates.
Curr Opin Biotechnol
10: 169-174[CrossRef][Web of Science][Medline]
-
Hincha DK, Hellwege EM, Heyer AG, Crowe JH
(2000)
Plant fructans stabilize phosphatidylcholine liposomes during freeze-drying.
Eur J Biochem
267: 535-540[Web of Science][Medline]
-
Isla MI, Vattuone MA, Ordóñez RM, Sampietro AR
(1999)
Invertase activity associated with the walls of Solanum tuberosum tubers.
Phytochemistry
50: 525-534[Medline]
-
Kang SI, Kim SI
(1999)
Molecular cloning and sequence analysis of an endo-inulinase gene from Arthrobacter sp.
Biotechnol Lett
21: 569-574[CrossRef]
-
Kim J-Y, Mahé A, Guy S, Brangeon J, Roche O, Chourey PS, Prioul J-L
(2000)
Characterization of two members of the maize gene family, Incw3 and Incw4, encoding cell-wall invertases.
Gene
245: 89-102[CrossRef][Web of Science][Medline]
-
Livingston DP, Chatterton NJ, Harrison PA
(1993)
Structure and quantity of fructan oligomers in oat (Avena spp.).
New Phytol
123: 725-734
-
Livingston DP, Henson CA
(1998)
Apoplastic sugars, fructans, fructan exohydrolase, and invertase in winter oat: responses to second-phase cold hardening.
Plant Physiol
116: 403-408[Abstract/Free Full Text]
-
Mann M, Wilm M
(1994)
Error-tolerant identification of peptides in sequence databases by peptide sequence tags.
Anal Chem
66: 4390-4399[Medline]
-
Marx SP, Nösberger J, Frehner M
(1997a)
Seasonal variation of fructan-
-fructosidase (FEH) activity and characterization of a -(2, 1)-linkage specific FEH.
New Phytol
135: 267-277[CrossRef] -
Marx SP, Nösberger J, Frehner M
(1997b)
Hydrolysis of fructan in grasses: a
-(2, 6)-linkage specific fructan- -fructosidase from stubble of Lolium perenne.
New Phytol
135: 279-290[CrossRef] -
Mino Y, Shimada A, Yamatoto S
(1978)
Effect of cutting height on the carbohydrate metabolism in the haplocorm of timothy (Phleum pratense L.).
J Jap Grass Sci
24: 34-39
-
Pilon-Smits EAH, Ebskamp MJM, Jeuken MJW, Weisbeek PJ, Smeekens SCM
(1995)
Improved performance of transgenic fructan-accumulating tobacco under drought stress.
Plant Physiol
107: 125-130[Abstract]
-
Pons T, Olmea O, Chinea G, Beldarraín A, Márquez G, Acosta N, Rodríguez L, Valencia A
(1998)
Structural model for family 32 of glycosyl-hydrolase enzymes.
PROTEINS
33: 383-395[CrossRef][Web of Science][Medline]
-
Roberfroid MB, Van Loo JAE, Gibson GR
(1998)
The bifidogenic nature of chicory inulin and its hydrolysis products.
J Nutr
128: 11-19[Abstract/Free Full Text]
-
Shiomi N
(1989)
Properties of fructosyltransferases involved in the synthesis of fructan in Liliaceous plants.
J Plant Physiol
134: 151-155[Web of Science]
-
Sturm A
(1999)
Invertases: primary structures, functions, and roles in plant development and sucrose partitioning.
Plant Physiol
121: 1-7[Free Full Text]
-
Taper H, Lemort C, Roberfroid MB
(1999)
Inhibition of dietary inulin and oligofructose on the growth of transplantable mouse tumor.
Anticancer Res
18: 4123-4126
-
Tymowska-Lalanne Z, Kreis M
(1998)
Expression of the Arabidopsis thaliana invertase gene family.
Planta
207: 259-265[CrossRef][Web of Science][Medline]
-
Unger C, Hardegger M, Lienhardt S, Sturm A
(1994)
cDNA cloning of carrot (Daucus carota) soluble acid
-fructofuranosidases and comparison with the cell wall isoenzyme
Plant Physiol
104: 1351-1357[Abstract] -
Van den Ende W, De Roover J, Van Laere A
(1996a)
In vitro synthesis of fructofuranosyl-only oligosaccharides from inulin and fructose by purified chicory root fructan:fructan fructosyl transferase.
Physiol Plant
97: 346-352[CrossRef]
-
Van den Ende W, De Roover J, Van Laere A
(1999)
Effect of nitrogen concentration on fructan and fructan metabolizing enzymes in young chicory plants (Cichorium intybus).
Physiol Plant
105: 2-8[CrossRef]
-
Van den Ende W, Michiels A, De Roover J, Verhaert P, Van Laere A
(2000a)
Cloning and functional analysis of chicory root fructan 1-exohydrolase I (1-FEH I): a vacuolar enzyme derived from a cell-wall invertase ancestor? Mass fingerprint of the 1-FEH I enzyme.
Plant J
24: 447-456[CrossRef][Web of Science][Medline]
-
Van den Ende W, Michiels A, Van Wonterghem D, Vergauwen R, Van Laere A
(2000b)
Cloning, developmental and tissue-specific expression of 1-SST (sucrose:sucrose 1-fructosyl transferase) from Taraxacum officinale: fructan localization in roots.
Plant Physiol
123: 71-80[Abstract/Free Full Text]
-
Van den Ende W, Mintiens A, Speleers H, Onuoha A, Van Laere A
(1996b)
The metabolism of fructans in roots of Cichorium intybus L. during growth, storage and forcing.
New Phytol
132: 555-563
-
Van den Ende W, Van Laere A
(1996)
Fructan synthesizing and degrading activities in chicory roots (Cichorium intybus L.) during growth, storage and forcing.
J Plant Physiol
149: 43-50[Web of Science]
-
Vergauwen R, Van den Ende W, Van Laere A
(2000)
The role of fructans in flowering of Campanula rapunculoides.
J Exp Bot
51: 1261-1266[Abstract/Free Full Text]
-
Vijn I, Smeekens SCM
(1999)
Fructan: more than a reserve carbohydrate?
Plant Physiol
120: 351-359[Free Full Text]
-
Wiemken A, Frehner M, Keller F, Wagner W
(1986)
Fructan metabolism, enzymology and compartmentation.
Curr Topics Plant Biochem Physiol
5: 17-37
-
Wiemken A, Sprenger N, Boller T
(1995)
Fructans: an extension of sucrose by sucrose.
In
HG Pontis, GL Salerno, EJ Echeverria, eds, Current Topics in Plant Physiology, Vol. 14. American Society of Plant Physiologists, Rockville, MD, pp 179-189
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
B. Lasseur, L. Schroeven, W. Lammens, K. Le Roy, G. Spangenberg, H. Manduzio, R. Vergauwen, J. Lothier, M.-P. Prud'homme, and W. Van den Ende
Transforming a Fructan:Fructan 6G-Fructosyltransferase from Perennial Ryegrass into a Sucrose:Sucrose 1-Fructosyltransferase
Plant Physiology,
January 1, 2009;
149(1):
327 - 339.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. F. Asega, J. R. O. do Nascimento, L. Schroeven, W. Van den Ende, and M. A. M. Carvalho
Cloning, Characterization and Functional Analysis of a 1-FEH cDNA from Vernonia herbacea (Vell.) Rusby
Plant Cell Physiol.,
August 1, 2008;
49(8):
1185 - 1195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Le Roy, W. Lammens, M. Verhaest, B. De Coninck, A. Rabijns, A. Van Laere, and W. Van den Ende
Unraveling the Difference between Invertases and Fructan Exohydrolases: A Single Amino Acid (Asp-239) Substitution Transforms Arabidopsis Cell Wall Invertase1 into a Fructan 1-Exohydrolase
Plant Physiology,
November 1, 2007;
145(3):
616 - 625.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lothier, B. Lasseur, K. Le Roy, A. Van Laere, M.-P. Prud'homme, P. Barre, W. Van den Ende, and A. Morvan-Bertrand
Cloning, gene mapping, and functional analysis of a fructan 1-exohydrolase (1-FEH) from Lolium perenne implicated in fructan synthesis rather than in fructan mobilization
J. Exp. Bot.,
June 1, 2007;
58(8):
1969 - 1983.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Lasseur, J. Lothier, A. Djoumad, B. De Coninck, S. Smeekens, A. Van Laere, A. Morvan-Bertrand, W. Van den Ende, and M.-P. Prud'homme
Molecular and functional characterization of a cDNA encoding fructan:fructan 6G-fructosyltransferase (6G-FFT)/fructan:fructan 1-fructosyltransferase (1-FFT) from perennial ryegrass (Lolium perenne L.)
J. Exp. Bot.,
August 1, 2006;
57(11):
2719 - 2734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Van den Ende, S. Clerens, R. Vergauwen, D. Boogaerts, K. Le Roy, L. Arckens, and A. Van Laere
Cloning and functional analysis of a high DP fructan:fructan 1-fructosyl transferase from Echinops ritro (Asteraceae): comparison of the native and recombinant enzymes
J. Exp. Bot.,
March 1, 2006;
57(4):
775 - 789.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Michiels, A. Van Laere, W. Van den Ende, and M. Tucker
Expression analysis of a chicory fructan 1-exohydrolase gene reveals complex regulation by cold
J. Exp. Bot.,
June 1, 2004;
55(401):
1325 - 1333.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Van den Ende, S. Clerens, R. Vergauwen, L. Van Riet, A. Van Laere, M. Yoshida, and A. Kawakami
Fructan 1-Exohydrolases. beta -(2,1)-Trimmers during Graminan Biosynthesis in Stems of Wheat? Purification, Characterization, Mass Mapping, and Cloning of Two Fructan 1-Exohydrolase Isoforms
Plant Physiology,
February 1, 2003;
131(2):
621 - 631.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|