|
Plant Physiol, August 2001, Vol. 126, pp. 1579-1587
Harpin Induces Activation of the Arabidopsis Mitogen-Activated
Protein Kinases AtMPK4 and AtMPK6
Radhika
Desikan,
John T.
Hancock,
Kazuya
Ichimura,
Kazuo
Shinozaki, and
Steven J.
Neill*
Centre for Research in Plant Science, Faculty of Applied Sciences,
University of the West of England, Coldharbour Lane, Bristol BS16 1QY,
United Kingdom (R.D., J.T.H., S.J.N.); and Laboratory of Plant
Molecular Biology, RIKEN Tsukuba Institute, 3-1-1 Koyadai, Tsukuba,
Ibaraki 305-0074, Japan (K.I., K.S.)
 |
ABSTRACT |
Mitogen-activated protein kinases (MAPKs) are key enzymes that
mediate adaptive responses to various abiotic and biotic stresses, including pathogen challenge. The proteinaceous bacterial elicitor harpin (secreted by Pseudomonas syringae pv
syringae) activates two MAPKs in suspension cultures of
Arabidopsis var. Landsberg erecta. In this study, we
show that harpin and exogenous hydrogen peroxide
(H2O2) activate myelin basic protein kinases in
Arabidopsis leaves. Using anti-AtMPK4 and anti-AtMPK6 antibodies, we
identify the harpin-activated MAPKs in both leaves and suspension
cultures as AtMPK4 and AtMPK6, and show that
H2O2, generated by Arabidopsis cells in
response to challenge with harpin, activates only AtMPK6. However,
treatments with catalase, which removes H2O2,
or diphenylene iodonium, which inhibits superoxide and
H2O2 production, do not inhibit harpin-induced
activation of AtMPK4 or AtMPK6. In addition, activation of AtMPK4 but
not AtMPK6 is inhibited by the MAPK kinase inhibitor PD98059. Neither
harpin nor H2O2 has any effect on
AtMPK4 or AtMPK6 gene expression. In
addition, the expression of AtMEKK1, AtMEK1, or AtMKK2, previously shown to be
potential functional partners of AtMPK4, were not affected by either
harpin or H2O2 treatments. These data suggest
that harpin activates several signaling pathways, one leading to
stimulation of the oxidative burst and others leading to the activation
of AtMPK4 or AtMPK6.
 |
INTRODUCTION |
Plants mount a range of ameliorative
responses during biotic and abiotic stresses that are dependent on
signal perception and activation of both overlapping and distinct
signaling pathways. In response to potentially pathogenic
microorganisms, several early defense reactions are initiated in plant
cells, including rapid changes in ion fluxes, generation of reactive
oxygen species (ROS), and reversible protein phosphorylation (Yang et
al., 1997 ). In turn, these signaling pathways culminate in the
expression of defense-related genes, formation of phytoalexins, and
localized host cell death, constituting the hypersensitive response
(HR; Heath, 1999 ).
Reversible protein phosphorylation is a key process regulating many
aspects of cellular function in eukaryotes, including elicitor-induced
defense responses. For example, several pharmacological studies have
shown that both protein kinase and phosphatase activities are involved
in regulation of the oxidative burst, in which hydrogen peroxide
(H2O2) is generated (Levine
et al., 1994 ; Chandra and Low, 1995 ; Kauss and Jeblick, 1995 ; Desikan
et al., 1996 ).
Considerable interest is currently focussed on mitogen-activated
protein kinase (MAPK) signaling in plants. MAPKs are Ser/Thr kinases
with both cytoplasmic and nuclear substrates, and are themselves
activated via dual phosphorylation on Thr and Tyr residues by an MAPK
kinase (MAPKK or MEK). In turn, this kinase is activated by an MAPKK
kinase (MAPKKK). A large number of MAPK signaling components have now
been cloned from plants, with considerable evidence accumulating for
their roles in mediating adaptive responses to environmental stresses
such as drought, cold, and osmotic stress (Hirt, 1997 ; Mizoguchi et
al., 1997 ; Hirt and Asard, 2000 ), as well as pathogen challenge
(Somssich, 1997 ). There are now several examples in the literature
where MAPKs have been implicated during defense responses in a wide
variety of plant-elicitor interactions (Adam et al., 1997 ; Ligterink et
al., 1997 ; Lebrun-Garcia et al., 1998 ; Zhang and Klessig, 1998 ; Desikan
et al., 1999a ; Romeis et al., 1999 ; Suzuki et al., 1999 ; Yang et al.,
2001 ).
Harpins are heat-stable Gly-rich proteins that are encoded by
hrp genes present in several phytopathogenic bacteria (He,
1996 ). Harpin is one of the first bacterial elicitors characterized as inducing HR in several non-host species (Lindgren, 1997 ). In addition to eliciting several active defense responses in plants leading to the
HR, which include rapid ion fluxes, membrane depolarization, and
generation of ROS (Baker et al., 1993 ; He et al., 1994 ), harpin has
also been shown to contribute to disease resistance in plants by
reducing bacterial growth (Dong et al., 1999 ). In previous work, we
have shown that harpin from Pseudomonas syringae pv
syringae induces a number of defense responses in
Arabidopsis cell suspension cultures, including generation of
H2O2 (Desikan et al.,
1996 ), activation of defense gene expression, and programmed cell death (PCD; Desikan et al., 1998 ). We have demonstrated recently that harpin
induces the activation of two MAPK-like enzymes in Arabidopsis cells
(Desikan et al., 1999a ), whereas exogenous
H2O2 activates a single
MAPK-like enzyme (Desikan et al., 1999b ). Several MAPK homologs have
been identified in Arabidopsis (Mizoguchi et al., 1997 ), but as yet
there is only limited information available on the role of specific
MAPKs in defense responses (Nuhse et al., 2000 ; Yang et al.,
2001 ).
In this study, we identify the two MAPK-like enzymes activated by
harpin as AtMPK4 and AtMPK6. Harpin-induced activation of AtMPK4 and
AtMPK6 is independent of the presence of
H2O2, although H2O2 activates AtMPK6 but
not AtMPK4. We show that harpin and H2O2 also induce a similar
activation profile of AtMPK4 and AtMPK6 in Arabidopsis leaves.
Treatment with the MAPKK inhibitor PD98059 reduces the harpin-induced
activation of AtMPK4 in suspension cultures, but has no effect on
the activation of AtMPK6. Together, these data suggest that
harpin activates several signaling pathways, one leading to the
oxidative burst and others leading to the activation of AtMPK4 or
AtMPK6. Neither harpin nor
H2O2 altered the expression of the genes encoding AtMPK4 and AtMPK6, nor did they have any effect
on the expression of genes encoding AtMEK1, ATMEKK1, or ATMKK2, likely
upstream components in a functional cascade activating AtMPK4 (Ichimura
et al., 1998 ; Mizoguchi et al., 1998 ).
 |
RESULTS |
Harpin and H2O2 Activate Myelin Basic
Protein (MBP) Kinases in Arabidopsis Leaves
In previous work, we have shown that harpin and
H2O2 activate MAPK-like
enzymes in Arabidopsis cell suspension cultures (Desikan et al., 1999a ,
1999b ). To determine if similar responses would be reproduced in
leaves, harpin (5 µg mL 1) or
H2O2 (20 mM) was vacuum infiltrated into leaves for various times.
Subsequent in-gel kinase assays of extracts from these leaves
demonstrated that harpin induced the activation of two MBP kinases of
43 and 47 kD within 15 min, and that after 30 min the activation of
these kinases diminished (Fig. 1A).
Exogenous H2O2 also induced
the activation of an MBP kinase at about 47 kD after 15 min (Fig. 1B).
Mock infiltration of leaves with water did not induce the activation of
any MBP kinase (Con, Fig. 1, A and B). The activation kinetics seen
with leaves were similar to those of suspension cultures (Desikan et
al., 1999a , 1999b ).

View larger version (36K):
[in this window]
[in a new window]
|
Figure 1.
Harpin- and
H2O2-induced activation of
MBP kinases in Arabidopsis leaves. A, Protein extracts from control-
(Con) or harpin- (hrp, 5 µg mL 1) treated
leaves for various times (indicated in minutes) were subjected to
in-gel protein kinase assay using MBP as substrate. The molecular
masses of the 43- and 47-kD kinases are indicated. B, Protein
extracts from control- (Con) or
H2O2- (20 mM)
treated leaves for various times (in minutes) were subjected to in-gel
protein kinase assay using MBP as substrate. The molecular mass of the
47-kD protein is indicated.
|
|
AtMPK4 and AtMPK6 Proteins Are Present in Arabidopsis Cell
Cultures
AtMPK4 and AtMPK6 proteins have been shown to be present in
Arabidopsis leaves (Ichimura et al., 2000 ). To determine whether these
MAPKs are similarly present in Arabidopsis suspension cultures, immunoblot analysis was performed on protein extracts from control-, harpin-, or H2O2-treated
cells using antibodies specifically raised against the C and N terminus
of AtMPK4 and AtMPK6, respectively (Ichimura et al., 2000 ). Figure
2A shows that the anti-AtMPK4 antibody
reacted strongly with a protein of molecular mass of about
43 kD in cell extracts, and also, but to a lesser extent, with a larger
protein. In leaf extracts, the anti-AtMPK4 antibody reacts with AtMPK4
at an apparent molecular mass of 43 kD (Ichimura et al., 2000 ); some
cross-reactivity with a higher molecular mass non-MAPK protein was also
apparent, as observed here. The anti-AtMPK6 antibody recognized a
single protein of molecular mass of about 47 kD (Fig. 2B), as reported
for Arabidopsis leaves (Ichimura et al., 2000 ). The estimated molecular
mass of the proteins detected by anti-AtMPK4 and -AtMPK6 antibodies is
dependent on the migration behavior of the
Mr markers used during SDS-PAGE. In this
study, Bio-Rad (Hertfordshire, UK) markers were used, whereas
NEB (Hertfordshire, UK) markers were used in a previous report from our
laboratory (Desikan et al., 1999a , 1999b ). We reported previously that
harpin activated two MAPK-like enzymes of molecular mass of about 39 kD
and 44 kD (Desikan et al., 1999a ) and
H2O2 activated a single MAPK-like enzyme of about 44 kD (Desikan et al., 1999b ) in Arabidopsis cells. However, in this report, the apparent molecular masses of AtMPK4
and AtMPK6 in suspension cultures were calculated as 43 and 47 kD,
respectively, based on Bio-Rad markers, which is in agreement with
other work (Ichimura et al., 2000 ). This apparent discrepancy in the
sizes of MAPKs has been reported by other workers (Romeis et al., 1999 ;
Nuhse et al., 2000 ). Figure 2 also shows that both harpin (1 µg
mL 1) or
H2O2 (20 mM) had little effect on the relative abundance of AtMPK4 and AtMPK6 proteins in Arabidopsis cell extracts over the
time course of this experiment.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 2.
Immunodetection of AtMPK4 and AtMPK6 in
Arabidopsis cells. A, Protein extracts from control- (Con), harpin-
(Hrp, 1 µg mL 1) or
H2O2- (20 mM)
treated cells (for 15 min) were fractionated by SDS-PAGE, and western
blotting performed using anti-AtMPK4 antibody. B, Western blotting was
performed on extracts as above using anti-AtMPK6 antibody. The
molecular masses of the 43- and 47-kD proteins are indicated.
|
|
Harpin Induces the Activation of AtMPK4 and AtMPK6
To determine if the harpin or
H2O2-activated MAPK-like
enzymes in suspension cultures (Desikan et al., 1999a , 1999b ) and
leaves (Fig. 1) are AtMPK4 and AtMPK6, immunoprecipitation was
performed on harpin- and
H2O2-treated extracts using
anti-AtMPK4 and -AtMPK6 antibodies. The precipitated proteins were
fractionated on MBP-embedded gels and in-gel kinase assays performed.
As can be seen in Figure 3, the
anti-AtMPK4 antibody immunoprecipitated only a 43-kD kinase. Furthermore, this kinase was only seen in extracts from harpin-treated cells; little or no immunoprecipitable kinase activity was seen in
extracts from control- or
H2O2-treated cells. Using
anti-AtMPK6 antibody to determine if harpin or
H2O2 activates AtMPK6,
similar experiments revealed that immunoprecipitable kinase activity
was seen in extracts from both harpin- and
H2O2-treated cells;
however, only the 47-kD kinase was precipitated (Fig. 3,
AtMPK6).

View larger version (41K):
[in this window]
[in a new window]
|
Figure 3.
Activation of AtMPK4 and AtMPK6 in Arabidopsis
suspension cultures. Protein extracts from control- (Con), harpin-
(Hrp, 2 µg mL 1 for 15 min), or
H2O2- (20 mM
for 15 min) treated cells were immunoprecipitated with anti-AtMPK4
antibody (AtMPK4, using 500 µg protein extract) or anti-AtMPK6
antibody (AtMPK6, using 100 µg protein extract) and in-gel kinase
assay performed. Extracts that were not immunoprecipitated ( IP, using
40 µg protein extract) were also subjected to in-gel kinase assay.
The molecular masses of the 43- and 47-kD MAPKs are indicated.
|
|
The activity of kinases was also determined in extracts from control
and treated cells that were not immunoprecipitated. These experiments
revealed that a 43-kD kinase activated only after harpin treatment
(Fig. 3; IP lanes) aligned with that precipitated by anti-AtMPK4
antibody. A 47-kD kinase that did possess MBP kinase activity and was
clearly activated by harpin and
H2O2 as described earlier
(Desikan et al., 1999a , 1999b ), was also seen (Fig. 3; IP lanes),
although it was not precipitated by anti-AtMPK4 antibody. However, the
47-kD kinase was immunoprecipitated by anti-AtMPK6 antibody, although
the 43-kD kinase was not (Fig. 3).
The identity of the MAPKs activated by harpin and
H2O2 in Arabidopsis leaves
was also determined using immunoprecipitation and in-gel assays.
Extracts from harpin-treated leaves immunoprecipitated with anti-AtMPK6
and -AtMPK4 antibodies possessed kinase activities at 47 and 43 kD,
respectively (Fig. 4, lanes 2 and 5).
H2O2-treated leaves showed
AtMPK6-immunoprecipitable kinase activity, but only very weak
AtMPK4-immunoprecipitable kinase activity (Fig. 4, lanes 3 and 6),
compared with extracts from harpin-treated leaves (Fig. 4, lane
5).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 4.
Activation of AtMPK4 and AtMPK6 in Arabidopsis
leaves. Protein extracts from control- (lanes 1 and 4), harpin- (lanes
2 and 5; 5 µg mL 1, 15 min), or
H2O2- (lanes 3 and 6; 20 mM, 30 min) treated leaves were subjected to in-gel kinase
assay after immunoprecipitation with anti-AtMPK6 (lanes 1-3) or
anti-AtMPK4 (lanes 4-6) antibodies. The molecular masses of the 43- and 47-kD MAPKs are indicated.
|
|
Harpin-Induced Activation of AtMPK4 and AtMPK6 Occurs Independent
of the Oxidative Burst via Different Pathways
Previous work in our laboratory has shown that harpin induces the
generation of ROS such as
H2O2 (Desikan et al.,
1996 ), and that both harpin and
H2O2 induce differential
defense responses in Arabidopsis suspension cultures (Desikan et al.,
1998 ). To investigate whether the effects of harpin on the activation
of AtMPK4 and AtMPK6 were dependent on
H2O2 generation, cells were challenged with harpin in the presence of catalase, which scavenges H2O2 and ameliorates its
effects (Desikan et al., 1998 ), and in-gel kinase assays subsequently
performed. Catalase pretreatment did not diminish harpin-induced
activation of the 43- and 47-kD kinases (Fig.
5A). However, catalase pretreatment did
cause a slight increase in kinase activity this was a nonspecific
effect of catalase (Fig. 5A) because even boiled catalase caused this
effect (data not shown). To determine whether harpin-induced AtMPK4 and
AtMPK6 activation occurred independently of the oxidative burst, cells were pretreated with DPI, an inhibitor of ROS generation via NADPH oxidase (Desikan et al., 1996 ). DPI pretreatment did not inhibit activation of the two kinases by harpin (Fig. 5B), demonstrating that
such activation is independent of the oxidative burst.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 5.
Harpin-induced activation of AtMPK4 and AtMPK6
occurs independently of the oxidative burst. A, Protein extracts from
control- (Con), catalase- (Cat, 0.5 mg mL 1),
harpin- (Hrp, 2 µg mL 1, 15 min) or harpin
plus catalase- (Hrp + cat, 0.5 mg mL 1) treated
cells were subjected to in-gel kinase assay. The molecular masses of
the 43- and 47-kD MAPKs are indicated. B, Protein extracts from
control- (Con), harpin- (Hrp, 2 µg mL 1), or
harpin plus diphenylene iodonium- (DPI; Hrp + DPI, 10 µM)
treated cells were subjected to in-gel kinase assay. The molecular
masses of the 43- and 47-kD MAPKs are indicated.
|
|
MAPKs are typically activated via phosphorylation by an upstream MAPK
kinase (MEK). To address the possibility of such a requirement for
activation of AtMPK4 and AtMPK6, we adopted a pharmacological approach.
In a previous report, we described the inhibitory effects of an
inhibitor of MAPKK activation, PD98059, on harpin-induced activation of
the 43-kD kinase, with little or no effects on the activation of the
47-kD kinase (Desikan et al., 1999a ). To determine the effects of
PD98059 on the activation of AtMPK4 and AtMPK6, extracts from cells
treated with harpin in the absence or presence of PD98059 were
immunoprecipitated with anti-AtMPK4 and -AtMPK6 antibodies and analyzed
by in-gel kinase assay (Fig. 6, A and B).
PD98059 treatment substantially reduced the activation of AtMPK4 by
harpin. However, using the same extracts in immunoprecipitation experiments with anti-AtMPK6 antibody, it was observed that
harpin-induced activation of AtMPK6 was not inhibited by
PD98059, in accordance with our previous report (Fig. 6B; Desikan et
al., 1999a ).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 6.
Harpin-induced AtMPK4 but not AtMPK6 activation is
inhibited by PD98059, an MAPKK inhibitor. A, Cells were either treated
with dimethyl sulfoxide (DMSO; Con), harpin + DMSO (Hrp, 2 µg
mL 1, 15 min), or harpin in the presence of
PD98059 (PD; 1 × 10 4 M) and
protein extracts subjected to in-gel kinase assay after
immunoprecipitation with anti-AtMPK4 antibody. B, Cells were either
treated with DMSO (Con), harpin + DMSO (Hrp, 2 µg
mL 1, 15 min), or harpin in the presence of
PD98059 (PD, 1 × 10 4 M) and protein
extracts subjected to in-gel kinase assay after immunoprecipitation
with anti-AtMPK6 antibody.
|
|
Effect of Harpin and H2O2 on
AtMPK4, AtMPK6, AtMEK1,
AtMKK2, and AtMEKK1 mRNA
Various abiotic stresses have been shown to induce the
expression of genes encoding MAPKs, MAPKKs, and MAPKKKs in Arabidopsis (Mizoguchi et al., 1996 ; Morris et al., 1997 ; Ichimura et al., 1998 ).
Furthermore, yeast two-hybrid analysis has demonstrated that
AtMPK4, AtMEK1/AtMKK2, and AtMEKK1 represent a potential cognate MAPK-MAPKK-MAPKKK cascade in Arabidopsis (Ichimura et al.,
1998 ; Mizoguchi et al., 1998 ). To determine if harpin and H2O2 had any effect on the
transcription of genes encoding AtMPK4 and AtMPK6, northern analysis
was performed using RNA from cells treated for 2 h with harpin or
H2O2 (Fig.
7). As a positive control, blots were
hybridized with a PAL1 clone both harpin and
H2O2 induced an increase in
PAL1 mRNA, as described previously (Desikan et al., 1998 ).
It is clear that neither harpin nor
H2O2, at the concentrations used, had any effect on the expression of AtMPK4 or
AtMPK6 mRNA (Fig. 7). The effects of harpin and
H2O2 on the transcription of AtMEKK1, AtMEK1, and AtMKK2 were
also determined. Neither treatment appeared to have any effect on the
expression of these genes (Fig. 7).

View larger version (34K):
[in this window]
[in a new window]
|
Figure 7.
Effects of
H2O2 and harpin on the
expression of AtMEKK1, AtMEK1, AtMKK2, AtMPK4, and AtMPK6 mRNA.
Arabidopsis cells were treated with either
H2O2 (10 mM) or
harpin (Hrp, 1 µg mL 1) for 2 h and RNA
isolated from the harvested cells subjected to northern analysis using
32P-labeled AtMEKK1,
AtMEK1, AtMKK2, AtMPK4, and
AtMPK6 cDNAs as probes. As a control, the blot was stripped
and probed with a PAL1 genomic clone (Desikan et al.,
1998 ).
|
|
 |
DISCUSSION |
Suspension cultures of Arabidopsis are a good model system with
which to elucidate signaling processes required for defensive responses
induced by pathogens or elicitor challenge. In recent work, we have
shown that Arabidopsis cells challenged with phytopathogenic bacteria
(Clarke et al., 2000 ), or the bacterial elicitor harpin, initiate a
series of responses that includes the generation of H2O2 and PCD (Desikan et
al., 1996 , 1998 ). PCD is a characteristic of the HR, a complex suite of
cellular responses that requires the interplay of numerous signal
transduction pathways and culminates in host cell death and retardation
of pathogen growth (Heath, 1999 ).
Harpin is a nonspecific bacterial elicitor, one of the few bacterial
elicitors characterized to date. It induces a number of HR-related
events, such as changes in ion fluxes, reversible protein
phosphorylation, and the oxidative burst (Baker et al., 1993 ; He et
al., 1994 ; Desikan et al., 1996 ). Harpin has been shown to activate an
MAPK-like enzyme in tobacco (Nicotiana tobacum L. var.
Samsun NN) leaves (Adam et al., 1997 ), and two MAPK-like enzymes
in Arabidopsis cell suspension cultures (Desikan et al., 1999a ).
Molecular characterization of MAPKs activated by various stresses is
clearly imperative, so that the biochemical and biological roles of
such enzymes can be subsequently elucidated. The activation profile of
AtMPK4 (Ichimura et al., 2000 ) suggested that AtMPK4 may be one of the
two MAPKs activated by harpin in Arabidopsis suspension cultures. The
immunological data presented here demonstrate that harpin does activate
AtMPK4. The demonstrations elsewhere that AtMPK6 is activated by
H2O2 (Kovtun et al., 2000 ),
or bacterial flagellins (Nuhse et al., 2000 ), in Arabidopsis
protoplasts and cells, respectively, suggested that the other MAPK (at
47 kD) activated by harpin and
H2O2 (Desikan et al.,
1999a , 1999b ) is probably AtMPK6. In the present study, we confirm that
H2O2 does activate AtMPK6
in suspension cultures, and show that AtMPK6 can also be activated
independently by harpin. We also demonstrate that harpin and
H2O2 activate AtMPK4/6 and
AtMPK6, respectively, in leaves in a similar manner to that seen with
suspension cultures. This finding lends experimental support to the
concept of suspension cultures as model systems with which to elucidate
some of the signaling mechanisms observed in planta.
It is clear that activation of AtMPK4 and AtMPK6 by harpin can occur
independently of the oxidative burst, as both catalase and DPI, which
remove H2O2 and inhibit ROS
generation, respectively (Desikan et al., 1996 ), did not inhibit
harpin-induced AtMPK4 and AtMPK6 activation. This is similar to the
activation of MAPKs in other systems that have been reported to be
upstream or independent of the oxidative burst (Ligterink et al., 1997 ;
Romeis et al., 1999 ; Yang et al., 2001 ). Thus, harpin must activate
several signaling pathways, one leading to the activation of the
oxidative burst, and others leading to activation of AtMPK4 or AtMPK6.
The effects of the MEK inhibitor PD98059 suggest that the
activation of AtMPK4 and AtMPK6 by harpin is also
differentially regulated. PD98059 was originally reported to be an
inhibitor of MAPKKs in mammalian systems (Cohen, 1997 ), and has been
shown recently to inhibit the activation of several plant MAPK systems
(Desikan et al., 1999a ; Romeis et al., 1999 ; Burnett et al., 2000 ;
Samuel et al., 2000 ). Here, the activation of AtMPK4 is inhibited, as
previously suggested (Desikan et al., 1999a ). This implies that the
MAPKK responsible for activating AtMPK4 (potentially AtMEK1, see below) is sensitive to PD98059, whereas the activating enzyme for AtMPK6, probably ANP1 (Kovtun et al., 2000 ), is not. It is, perhaps, also significant that the inhibition of AtMPK4 activation by PD98059 correlates with inhibition by PD98059 of harpin-induced PCD (Desikan et
al., 1999a ), suggesting a role for AtMPK4 in the signaling pathway
leading to cell death during harpin-induced HR in Arabidopsis. Recent
data indicate that AtMPK4 negatively regulates pathogen-induced systemic acquired resistance in Arabidopsis (Petersen et al., 2000 ); it
is likely that there is considerable cross talk involving MAPK
signaling during HR and systemic acquired resistance that still
requires clarification.
Phylogenetic analysis of plant MAPKs indicates several distinct groups
(Zhang and Klessig, 1997 ; Jonak et al., 1999 ), with kinases within the
same group having potentially similar functions. AtMPK4 falls within a
third subgroup of a major group of MAPKs, and is related to MMK2 of
alfalfa, an enzyme that can complement a mutant yeast MAPK required for
high temperature tolerance (Jonak et al., 1995 ). Two other subgroups of
this major group of MAPKs include the tobacco wound-induced protein
kinase (WIPK) and salicylic acid-induced protein kinase (SIPK),
as well as the Arabidopsis AtMPK3 and AtMPK6. WIPK and SIPK were
originally shown to be wound- (Seo et al., 1995 ) and salicylic
acid-induced (Zhang and Klessig, 1997 ), respectively. SIPK is also
activated by fungal elicitors (Zhang et al., 1998 ) and abiotic stress
(Samuel et al., 2000 ), and both SIPK and WIPK have been shown to be
activated in a fungal race-specific interaction in tobacco (Romeis et
al., 1999 ). Importantly, a functional role for both SIPK and WIPK in HR
has recently been demonstrated in tobacco, where defense responses such
as cell death and defense gene activation have been shown to be
directly regulated by these MAPKs (Yang et al., 2001 ).
It is now apparent that components of MAPK cascades in plants can be
regulated not only at the posttranslational level, but also at the
level of transcription (Hirt, 1999 ). For example, members of the WIPK
subgroup of MAPKs are induced at the mRNA level by wounding, elicitor
challenge, drought, and fungal pathogens (Seo et al., 1995 ; Mizoguchi
et al., 1996 ; Ligterink et al., 1997 ; Romeis et al., 1999 ). However,
those of the SIPK subgroup are not induced at the mRNA level by
elicitors, salicylic acid, or fungal pathogens (Zhang et al., 1998 ;
Romeis et al., 1999 ). In this study, neither AtMPK4 nor AtMPK6 mRNA
were induced by either harpin or
H2O2. Other work has
demonstrated that AtMPK4 and AtMPK6 transcripts are not induced by low
temperature, low humidity, touch, or wounding (Ichimura et al.,
2000 ).
It is also possible that upstream components of the MAPK signaling
cascade are transcriptionally regulated. AtMEKK1 has been shown to
interact physically with AtMEK1/AtMKK2 and AtMPK4, suggesting that this
collection of enzymes may represent a functional complex (Mizoguchi et
al., 1998 ). AtMEK1 phosphorylates AtMPK4 in vivo only on Thr residues
(Huang et al., 2000 ), with auto-phosphorylation being an important
regulatory event in activation of AtMPK4. AtMEKK1 and AtMEK1
transcripts accumulated following various stresses or wounding
(Mizoguchi et al., 1996 ; Morris et al., 1997 ), but in the present
study, neither harpin nor
H2O2 appeared to have any
effect on the levels of the transcripts encoding these proteins. These
data suggest that different stimuli have different effects on MAPK
cascades, at both the enzyme activation and transcription levels.
A novel dual-specificity protein phosphatase has recently been
identified in Arabidopsis and shown to dephosphorylate and inactivate
AtMPK4 (Gupta et al., 1998 ). Whether this enzyme is constitutively
active or inducible during biotic interactions remains to be
demonstrated. Scaffold proteins that mediate physical associations
between MAPK components have been identified in yeast and mammals. Such
interactions represent obvious regulatory junctures in MAPK signaling
(Whitmarsh and Davis, 1998 ). It is probable that such a level of
regulation also exists in Arabidopsis, as has been suggested for
AtMEKK1 (Ichimura et al., 1998 ).
In conclusion, we have shown that two of the MAPKs activated by the
bacterial elicitor harpin in Arabidopsis cells and leaves are
AtMPK4 and AtMPK6, and that
H2O2 does not have any
effect on the activation of AtMPK4. Furthermore, harpin-induced AtMPK6 activation occurs independently of the oxidative burst, implying divergent signaling pathways. AtMPK4 and its potential upstream interacting partners are not regulated at the level of transcription by either harpin or
H2O2 treatment. The
interactions of AtMPK4 and AtMPK6 with other Arabidopsis MAPK signaling
pathways and their roles in specific plant-pathogen interactions await elucidation.
 |
MATERIALS AND METHODS |
Treatment of Arabidopsis Suspension Cultures
Cell suspension cultures of Arabidopsis var. Landsberg
erecta were maintained as described in Desikan et al.
(1996) . Harpin from Pseusomonas syringae pv
syringae, isolated as described previously (Desikan et
al., 1998 ), and H2O2 were added to the cells at
the indicated concentrations and times. Controls were represented by
mock treatment of cells with appropriate volumes of sterile distilled
water. For inhibitor experiments, cells were treated 20 min prior to
the addition of harpin with the MAPKK inhibitor PD98059 (Calbiochem,
Nottingham, UK) at the indicated concentration. Controls for these
experiments involved treating the cells with equivalent amounts of
dimethylsulfoxide. Following treatments, Arabidopsis cells were
harvested by vacuum filtration and frozen in liquid nitrogen.
Growth and Treatment of Arabidopsis Plants
Arabidopsis var. Landsberg erecta plants were
grown in Levington's F2 compost in a controlled plant
growth cabinet (60% [v/v] humidity, 8-h light period, 600 µE m 2 s 1 at 16°C, and 16-h dark period
at 12°C). The seedlings were grown for 5 weeks, after which the
shoots were harvested. For treatments, leaves were chopped and
incubated in water overnight with gentle shaking, to allow completion
of any wound-induced responses. Following this, leaves were vacuum
infiltrated for 30 s with either harpin or
H2O2 at the indicated concentrations, and left
incubating in the appropriate solution with gentle shaking. Leaves were
then frozen in liquid nitrogen at the appropriate times after infiltration.
Extraction and Immunoblotting of Proteins
Frozen cells or plant leaves (about 0.5 g) were ground with
a mortar and pestle using liquid nitrogen, followed by homogenisation at 4°C with 2 volumes of protein extraction buffer {100
mM HEPES [4-(2-hydroxyethyl)-1-piperazineethanesulfonic
acid], pH 7.5, 5 mM EDTA, 5 mM EGTA, 10 mM dithiothreitol [DTT], 10 mM
Na3VO4, 10 mM NaF, 50 mM -glycerophosphate, 1 mM
phenylmethylsulfonyl fluoride, 5 µg mL 1 aprotinin, and
5 µg mL 1 leupeptin}. The ground slurry was
centrifuged at 12,000g for 20 min at 4°C in a
microcentrifuge. Supernatants were aliquotted into clean tubes, snap
frozen in liquid nitrogen, and stored at 80°C for later use.
Protein concentrations were estimated using the method described by
Bradford (1976) .
Immunoblotting and detection were performed as described in Desikan et
al. (1996) using an enhanced chemiluminescence western blotting
detection kit (Amersham, Little Chalfont, UK) with a 1:5,000 or 1:1,000
dilution of the primary antibodies (anti-AtMPK4 and anti-AtMPK6,
respectively) and a 1:3,000 dilution of the secondary antibody
(peroxidase-conjugated anti-rabbit IgG; Amersham). Generation and
characterization of the anti-AtMPK4 (AtMPK4CT, raised against the
C-terminal 16 amino acids of AtMPK4) and anti-AtMPK6 (Ab6NT1, raised
against the N terminus of AtMPK6) antibodies are described elsewhere
(Ichimura et al., 2000 )
In-Gel Protein Kinase Assays
Forty micrograms of Arabidopsis protein from cell or leaf
extracts were electrophoresed on 10% (w/v) SDS-polyacrylamide
gels embedded with 0.5 mg mL 1 MBP from bovine
brain (Sigma, Poole, UK) in the resolving gel as substrate for
the kinase. Prestained Mr markers (Bio-Rad)
were used as standards. After electrophoresing at 100 V for 2 h,
SDS was removed from the gel by washing the gel with 100 mL of washing buffer (25 mM Tris-HCl, pH 7.5, 0.5 mM DTT, 0.1 mM Na3VO4, 5 mM NaF,
0.5 mg mL 1 bovine serum albumin, and 0.1% [v/v] Triton
X-100) three times for 30 min each at room temperature with gentle
shaking. The proteins were then denatured by incubating the gel in 100 mL of denaturation buffer (6 M guanidine-HCl, 50 mM Tris-HCl, pH 8, and 5 mM 2-mercaptoethanol) for 1 h at room temperature. The proteins were subsequently
renatured overnight at 4°C in 200 mL of renaturation buffer (25 mM Tris-HCl, pH 8, 1 mM DTT, 0.1 mM
Na3VO4, and 5 mM NaF) with at least
three changes of the buffer. The gel was then incubated at room
temperature in 30 mL of reaction buffer (25 mM Tris-HCl, pH
8, 2 mM EGTA, 12 mM MgCl2, 1 mM DTT, and 0.1 mM
Na3VO4) for 30 min. Phosphorylation was
performed for 1 h at room temperature in 15 mL of the same reaction buffer supplemented with 50 µM ATP (Sigma) and
50 µCi [ -32P] ATP (specific activity 3,000 Ci
mmol 1; Amersham). Unincorporated radioactivity
subsequently was removed by washing the gel for 5 to 6 h at room
temperature with several changes of 5% (w/v) trichloroacetic acid and
1% (w/v) sodium pyrophosphate. The gel was dried onto paper (3 MM,
Whatman, BDH-Merck, Poole, UK) and subjected to autoradiography.
Immunoprecipitation and In-Gel Kinase Assay
Five hundred (for AtMPK4) or 100 (for AtMPK6) µg of protein
from harpin- or H2O2-treated cells or 100 µg
protein from leaf extracts were incubated by shaking for 2 h at
4°C with 8 µg of anti-AtMPK4 or -AtMPK6 antibody in
immunoprecipitation buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM Na3VO4, 1 mM NaF, 10 mM -glycerophosphate, 5 µg mL 1
aprotinin, 5 µg mL 1 leupeptin, 1 mM
phenylmethylsulfonyl fluoride, and 0.5% [v/v] Triton X-100).
Approximately 30 µL packed volume of protein G sepharose (Sigma) was
added and incubated for a further 2 h. The sepharose bead-protein
complexes were pelleted by gentle centrifugation (1,000g) and subsequently washed twice in wash buffer
(20 mM Tris, pH 7.5, 5 mM EDTA, 100 mM NaCl, and 1% [v/v] Triton X-100) and once in kinase
assay buffer (25 mM Tris, pH 7.5, 5 mM
MgCl2, 1 mM EGTA, 1 mM DTT, and 0.1 mM Na3VO4). Following washing, the immunoprecipitated proteins were released from the immunocomplex by
boiling the samples with SDS sample loading buffer. In-gel kinase assay
was then performed on the samples using MBP as the substrate, as
described above.
RNA Isolation and Northern Analysis
For RNA isolation, Arabidopsis cells were treated with harpin (1 µg mL 1) or H2O2 (10 mM) for 2 h, harvested, and frozen in liquid nitrogen. RNA isolation and northern analysis were performed as described by
Desikan et al. (1998) with the following modifications. RNA blotted
onto nylon membrane was prehybridized and hybridized at 42°C
overnight in a formamide buffer containing 5× SSPE (20× SSPE solution contains 3.6 M NaCl, 0.2 M
NaH2PO4, and 0.02 M
Na2EDTA, pH 7.4), 5× Denhardt's solution (50×
Denhardt's solution contains 1% [w/v] polyvinylpyrrolidone, 1%
[w/v] bovine serum albumin Fraction V, and 1% [w/v] Ficoll 400),
1% (w/v) SDS, 50 mM NaH2PO4, pH
6.8, 10% (w/v) dextran sulfate, 100 µg mL 1 denatured
salmon sperm DNA, and 50% (v/v) formamide. cDNA products were obtained
as described below. AtMEK1 cDNA (Morris et al., 1997 ) or
a PAL1 genomic clone (Desikan et al., 1998 ) were used as
hybridization probes. Post-hybridization washes were carried out as
described by Desikan et al. (1998) . The blot was stripped after each
hybridization using boiling 0.1% (w/v) SDS, and subsequently used for
the next round of hybridization. Equivalent RNA loadings were confirmed
by ethidium bromide staining of the gel.
Reverse Transcription-PCR
PCR primers were designed against known DNA sequences of AtMEKK1
(accession no. D50468), AtMKK2 (accession no. AB015313), AtMPK4
(accession no. D21840), and AtMPK6 (accession no.D21842). Primer
sequences were: AtMEKK1 (forward), 5'
TCGCTCTTTGGAGTTTCCGG-3'; AtMEKK1 (reverse), 5'
ATCTGCAAGTTTGACGGCGC- 3'; AtMKK2 (forward), 5' TGATCAGCTGAGCTTGTCGG
3'; AtMKK2 (reverse), 5' ATGGTGATATTATGTCTCCC 3'; AtMPK4 (forward), 5'
GCTACAAACTCAGAGACTGG 3'; AtMPK4 (reverse), 5' TTTCACGGTATATAAGCTCC 3';
AtMPK6 (forward), 5' AAACATCTTCGAGGTCACCG 3'; and AtMPK6 (reverse), 5'
AAGCTCTGGTGCACGGTACC 3'.
mRNA was isolated from total RNA using Dynabeads
Oligo(dT)25 (Dynal, Wirral, UK), as described by the
manufacturers. mRNA was reverse transcribed to single-stranded cDNA
using SuperscriptII RNase H reverse transcriptase
(Gibco-BRL, Paisley, UK) and random hexanucleotides (Pharmacia, Little
Chalfont, UK) using the following conditions: 94°C, 5 min; 42°C, 40 min; and 94°C, 5 min. The cDNA thus synthesized was used in a
PCR reaction using the designed primers under the following conditions:
denaturation at 94°C for 5 min, followed by 35 cycles of 94°C
(denaturation) for 45 s; 56°C (annealing), 1 min; 72°C,
(extension) 1 min, and an additional extension step of 72°C for 5 min. PCR products of the expected sizes were obtained (922, 543, and
933 bp and 1 kb for AtMPK4, AtMPK6, AtMKK2, and AtMEKK1, respectively),
and subsequently were cloned and sequenced to confirm identities. PCR
products were gel purified using a Qiaex kit (Qiagen, Crawley, UK) to
be used as probes for northern analysis.
 |
ACKNOWLEDGMENT |
We are grateful to Dr. Peter Morris (Heriot-W University,
Edinburgh) for providing us with the AtMEK1 cDNA clone.
 |
FOOTNOTES |
Received December 18, 2000; returned for revision February 22, 2001; accepted April 19, 2001.
*
Corresponding author; e-mail Steven.Neill{at}uwe.ac.uk; fax
44-117-3442904.
 |
LITERATURE CITED |
-
Adam AL, Pike S, Hoyos ME, Stone JM, Walker JC, Novacky A
(1997)
Rapid and transient activation of a myelin basic protein kinase in tobacco leaves treated with harpin from Erwinia amylovora.
Plant Physiol
115: 853-861[Abstract]
-
Baker CJ, Orlandi EW, Mock NM
(1993)
Harpin, an elicitor of the hypersensitive response in tobacco caused by Erwinia amylovora, elicits active oxygen production in suspension cells.
Plant Physiol
102: 1341-1344[Abstract]
-
Bradford MM
(1976)
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72: 248-254[CrossRef][Web of Science][Medline]
-
Burnett EC, Desikan R, Moser RC, Neill SJ
(2000)
ABA activation of an MBP kinase in Pisum sativum epidermal peels correlates with stomatal responses to ABA.
J Exp Bot
51: 197-205[Abstract/Free Full Text]
-
Chandra S, Low PS
(1995)
Role of phosphorylation in elicitation of the oxidative burst in cultured soybean cells.
Proc Natl Acad Sci USA.
92: 4120-4123[Abstract/Free Full Text]
-
Clarke A, Desikan R, Hurst R, Hancock JT, Neill SJ
(2000)
NO way back: nitric oxide and programmed cell death in Arabidopsis thaliana suspension cultures.
Plant J
24: 667-678[CrossRef][Web of Science][Medline]
-
Cohen P
(1997)
The search for physiological substrates of MAP and SAP kinases in mammalian cells.
Trends Cell Biol
7: 353-361
-
Desikan R, Clarke A, Atherfold P, Hancock JT, Neill SJ
(1999a)
Harpin induces mitogen-activated protein kinase activity during defense responses in Arabidopsis suspension cultures.
Planta
210: 97-103[CrossRef][Medline]
-
Desikan R, Clarke A, Hancock JT, Neill SJ
(1999b)
H2O2 activates a MAP kinase-like enzyme in Arabidopsis thaliana suspension cultures.
J Exp Bot
50: 1863-1866[Abstract/Free Full Text]
-
Desikan R, Hancock JT, Coffey MJ, Neill SJ
(1996)
Generation of active oxygen in elicited cells of Arabidopsis thaliana is mediated by a NADPH oxidase-like enzyme.
FEBS Lett
382: 213-217[CrossRef][Web of Science][Medline]
-
Desikan R, Reynolds A, Hancock JT, Neill SJ
(1998)
Harpin and hydrogen peroxide both initiate programmed cell death but have differential effects on defense gene expression in Arabidopsis suspension cultures.
Biochem J
330: 115-120
-
Dong H, Delaney TP, Bauer DW, Beer SV
(1999)
Harpin induces disease resistance in Arabidopsis through the systemic acquired resistance pathway mediated by salicylic acid and the NIM1 gene.
Plant J
20: 207-215[CrossRef][Web of Science][Medline]
-
Gupta R, Huang Y, Kieber J, Luan S
(1998)
Identification of a dual-specificity protein phosphatase that inactivates a MAP kinase from Arabidopsis.
Plant J
16: 581-589[CrossRef][Web of Science][Medline]
-
He SY
(1996)
Elicitation of the plant hypersensitive response by bacteria.
Plant Physiol
112: 865-869[Web of Science][Medline]
-
He SY, Bauer DW, Collmer A, Beer SV
(1994)
Hypersensitive response elicited by Erwinia amylovora harpin requires active plant metabolism.
Mol Plant-Microbe Interact
7: 289-292[Web of Science]
-
Heath MC
(1999)
The enigmatic hypersensitive response: induction, execution, and role.
Physiol Mol Plant Pathol
55: 1-3
-
Hirt H
(1997)
Multiple roles of MAP kinases in plant signal transduction.
Trends Plant Sci
2: 11-15[CrossRef][Web of Science]
-
Hirt H
(1999)
Transcriptional upregulation of signaling pathways: more complex than anticipated?
Trends Plant Sci
4: 7-8[CrossRef][Web of Science][Medline]
-
Hirt H, Asard H
(2000)
An international conference with a high ambition: meeting report.
Trends Plant Sci
5: 3-4[Medline]
-
Huang Y, Li H, Gupta R, Morris PC, Luan S, Kieber JJ
(2000)
AtMPK4, an Arabidopsis homolog of mitogen-activated protein kinase, is activated in vitro by AtMEK1 through threonine phosphorylation.
Plant Physiol
122: 1301-1310[Abstract/Free Full Text]
-
Ichimura K, Mizoguchi T, Irie K, Morris P, Giraudat J, Matsumoto K, Shinozaki K
(1998)
Isolation of ATMEKK1 (a MAP kinase kinase kinase)-interacting proteins and analysis of a MAP kinase cascade in Arabidopsis.
Biochem Biophys Res Commun
253: 532-543[CrossRef][Web of Science][Medline]
-
Ichimura K, Mizoguchi T, Yoshida R, Yuasa T, Shinozaki K
(2000)
Various abiotic stresses rapidly activate Arabidopsis MAP kinases AtMPK4 and AtMPK6.
Plant J
24: 655-666[CrossRef][Web of Science][Medline]
-
Jonak C, Kiegerl S, Lloyd C, Chan J, Hirt H
(1995)
MMK2, a novel alfalfa MAP kinase, specifically complements the yeast MPK1 function.
Mol Gen Genet
248: 686-694[CrossRef][Web of Science][Medline]
-
Jonak C, Ligterink W, Hirt H
(1999)
MAP kinases in signal transduction.
Cell Mol Life Sci
55: 204-213[CrossRef][Web of Science][Medline]
-
Kauss H, Jeblick W
(1995)
Pretreatment of parsley suspension cultures with salicylic acid enhances spontaneous and elicited production of H2O2.
Plant Mol Biol
30: 647-653
-
Kovtun Y, Chiu W-L, Tena G, Sheen J
(2000)
Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants.
Proc Natl Acad Sci USA
97: 2490-2495
-
Lebrun-Garcia A, Ouaked F, Chiltz A, Pugin A
(1998)
Activation of MAPK homologues by elicitors in tobacco cells.
Plant J
15: 773-781[CrossRef][Web of Science][Medline]
-
Levine A, Tenhaken R, Dixon R, Lamb C
(1994)
H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response.
Cell
79: 583-593[CrossRef][Web of Science][Medline]
-
Ligterink W, Kroj T, zur Nieden U, Hirt H, Scheel D
(1997)
Receptor-mediated activation of a MAP kinase in pathogen defense of plants.
Science
275: 2054-2057
-
Lindgren PB
(1997)
The role of hrp genes during plant-bacterial interactions.
Annu Rev Phytopathol
35: 129-152[CrossRef][Web of Science][Medline]
-
Mizoguchi T, Ichimura K, Irie K, Morris P, Giraudat J, Matsumoto K, Shinozaki K
(1998)
Identification of a possible MAP kinase cascade in Arabidopsis thaliana based on pairwise yeast two-hybrid analysis and functional complementation tests of yeast mutants.
FEBS Lett
437: 56-60[CrossRef][Web of Science][Medline]
-
Mizoguchi T, Ichimura K, Shinozaki K
(1997)
Environmental stress response in plants: the role of mitogen-activated protein kinases.
Trends Biotechnol
15: 15-19[CrossRef][Web of Science][Medline]
-
Mizoguchi T, Irie K, Hirayama T, Hayashida N, Yamaguchi-Shinozaki K, Matsumoto K, Shinozaki K
(1996)
A gene encoding a mitogen-activated protein kinase kinase kinase is induced simultaneously with genes for a mitogen-activaed protein kinase and an S6 ribosomal protein kinase by touch, cold, and water stress in Arabidopsis thaliana.
Proc Natl Acad Sci USA
93: 765-769[Abstract/Free Full Text]
-
Morris PC, Guerrier D, Leung J, Giraudat J
(1997)
Cloning and characterization of MEK1, an Arabidopsis gene encoding a homologue of a MAP kinase kinase.
Plant Mol Biol
35: 1057-1064[CrossRef][Web of Science][Medline]
-
Nuhse TS, Peck SC, Hirt H, Boller T
(2000)
Microbial elicitors induce activation and dual phosphorylation of the Arabidopsis thaliana MAPK6.
J Biol Chem
275: 7521-7526[Abstract/Free Full Text]
-
Petersen M, Brodersen P, Naested H, Andreasson E, Lindhart U, Johansen B, Nielsen HB, Lacy M, Austin MJ, Parker JE
(2000)
Arabidopsis MAP kinase 4 negatively regulates systemic acquired resistance.
Cell
103: 1111-1120[CrossRef][Web of Science][Medline]
-
Romeis T, Piedras P, Zhang S, Klessig DF, Hirt H, Jones JDG
(1999)
Rapid Avr9- and Cf-9-dependent activation of MAP kinases in tobacco cell cultures and leaves: convergence of resistance gene, elicitor, wound, and salicylate responses.
Plant Cell
11: 273-287[Abstract/Free Full Text]
-
Samuel MA, Miles GP, Ellis BE
(2000)
Ozone treatment rapidly activates MAP kinase signaling in plants.
Plant J
22: 367-376[CrossRef][Web of Science][Medline]
-
Seo S, Okamoto M, Seto H, Ishizuka K, Sano H, Ohashi Y
(1995)
Tobacco MAP kinase: a possible mediator in wound signal transduction pathways.
Science
270: 1988-1992[Abstract/Free Full Text]
-
Somssich IE
(1997)
MAP kinases and plant defense.
Trends Plant Sci
2: 406-408[CrossRef]
-
Suzuki K, Yano A, Shinshi H
(1999)
Slow and prolonged activation of the p47 protein kinase during hypersensitive cell death in a culture of tobacco cells.
Plant Physiol
119: 1465-1472[Abstract/Free Full Text]
-
Whitmarsh AJ, Davis RJ
(1998)
Structural organization of MAP-kinase signaling modules by scaffold proteins in yeast and mammals.
Trends Biochem Sci
23: 481-485[CrossRef][Web of Science][Medline]
-
Yang K-Y, Liu Y, Zhang S
(2001)
Activation of a mitogen-acivated protein kinase pathway is involved in disease resistance in tobacco.
Proc Natl Acad Sci USA
98: 741-746[Abstract/Free Full Text]
-
Yang Y, Shah J, Klessig DF
(1997)
Signal perception and transduction in plant defense responses.
Genes Dev
11: 1621-1639[Free Full Text]
-
Zhang S, Du H, Klessig DF
(1998)
Activation of the tobacco SIP kinase by both a cell wall-derived carbohydrate elicitor and purified proteinaceous elicitors from Phytophthora spp.
Plant Cell
10: 435-449[Abstract/Free Full Text]
-
Zhang S, Klessig DF
(1997)
Salicylic acid activates a 48-kD MAP kinase in tobacco.
Plant Cell
9: 809-824[Abstract]
-
Zhang S, Klessig DF
(1998)
The tobacco wounding-activated mitogen-activated protein kinase is encoded by SIPK.
Proc Natl Acad Sci USA
95: 7225-7230[Abstract/Free Full Text]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
A. Hahn and K. Harter
Mitogen-Activated Protein Kinase Cascades and Ethylene: Signaling, Biosynthesis, or Both?
Plant Physiology,
March 1, 2009;
149(3):
1207 - 1210.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Pitzschke and H. Hirt
Disentangling the Complexity of Mitogen-Activated Protein Kinases and Reactive Oxygen Species Signaling
Plant Physiology,
February 1, 2009;
149(2):
606 - 615.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-L. Qiu, L. Zhou, B.-W. Yun, H. B. Nielsen, B. K. Fiil, K. Petersen, J. MacKinlay, G. J. Loake, J. Mundy, and P. C. Morris
Arabidopsis Mitogen-Activated Protein Kinase Kinases MKK1 and MKK2 Have Overlapping Functions in Defense Signaling Mediated by MEKK1, MPK4, and MKS1
Plant Physiology,
September 1, 2008;
148(1):
212 - 222.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Doczi, G. Brader, A. Pettko-Szandtner, I. Rajh, A. Djamei, A. Pitzschke, M. Teige, and H. Hirt
The Arabidopsis Mitogen-Activated Protein Kinase Kinase MKK3 Is Upstream of Group C Mitogen-Activated Protein Kinases and Participates in Pathogen Signaling
PLANT CELL,
October 1, 2007;
19(10):
3266 - 3279.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Xing, W. Jia, and J. Zhang
AtMEK1 mediates stress-induced gene expression of CAT1 catalase by triggering H2O2 production in Arabidopsis
J. Exp. Bot.,
August 28, 2007;
(2007)
erm144v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Lee and B. E. Ellis
Arabidopsis MAPK Phosphatase 2 (MKP2) Positively Regulates Oxidative Stress Tolerance and Inactivates the MPK3 and MPK6 MAPKs
J. Biol. Chem.,
August 24, 2007;
282(34):
25020 - 25029.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhu, X. Fu, Y. D. Koo, J.-K. Zhu, F. E. Jenney Jr., M. W. W. Adams, Y. Zhu, H. Shi, D.-J. Yun, P. M. Hasegawa, et al.
An Enhancer Mutant of Arabidopsis salt overly sensitive 3 Mediates both Ion Homeostasis and the Oxidative Stress Response
Mol. Cell. Biol.,
July 15, 2007;
27(14):
5214 - 5224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Wrzaczek, W. Rozhon, and C. Jonak
A Proteasome-regulated Glycogen Synthase Kinase-3 Modulates Disease Response in Plants
J. Biol. Chem.,
February 23, 2007;
282(8):
5249 - 5255.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I.-P. Ahn, S. Kim, Y.-H. Lee, and S.-C. Suh
Vitamin B1-Induced Priming Is Dependent on Hydrogen Peroxide and the NPR1 Gene in Arabidopsis
Plant Physiology,
February 1, 2007;
143(2):
838 - 848.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Nakagami, H. Soukupova, A. Schikora, V. Zarsky, and H. Hirt
A Mitogen-activated Protein Kinase Kinase Kinase Mediates Reactive Oxygen Species Homeostasis in Arabidopsis
J. Biol. Chem.,
December 15, 2006;
281(50):
38697 - 38704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fernandez-Pascual, M. M. Lucas, M. R. de Felipe, L. Bosca, H. Hirt, and M. P. Golvano
Involvement of mitogen-activated protein kinases in the symbiosis Bradyrhizobium-Lupinus
J. Exp. Bot.,
August 1, 2006;
57(11):
2735 - 2742.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Ren, K.-Y. Yang, G.-J. Li, Y. Liu, and S. Zhang
Activation of Ntf4, a Tobacco Mitogen-Activated Protein Kinase, during Plant Defense Response and Its Involvement in Hypersensitive Response-Like Cell Death
Plant Physiology,
August 1, 2006;
141(4):
1482 - 1493.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Pitzschke and H. Hirt
Mitogen-Activated Protein Kinases and Reactive Oxygen Species Signaling in Plants
Plant Physiology,
June 1, 2006;
141(2):
351 - 356.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Zhang, M. Jiang, J. Zhang, M. Tan, and X. Hu
Mitogen-Activated Protein Kinase Is Involved in Abscisic Acid-Induced Antioxidant Defense and Acts Downstream of Reactive Oxygen Species Production in Leaves of Maize Plants
Plant Physiology,
June 1, 2006;
141(2):
475 - 487.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Zago, S. Morsa, J. F. Dat, P. Alard, A. Ferrarini, D. Inze, M. Delledonne, and F. Van Breusegem
Nitric Oxide- and Hydrogen Peroxide-Responsive Gene Regulation during Cell Death Induction in Tobacco
Plant Physiology,
June 1, 2006;
141(2):
404 - 411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Pignocchi, G. Kiddle, I. Hernandez, S. J. Foster, A. Asensi, T. Taybi, J. Barnes, and C. H. Foyer
Ascorbate Oxidase-Dependent Changes in the Redox State of the Apoplast Modulate Gene Transcript Accumulation Leading to Modified Hormone Signaling and Orchestration of Defense Processes in Tobacco
Plant Physiology,
June 1, 2006;
141(2):
423 - 435.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Hancock, R. Desikan, J. Harrison, J. Bright, R. Hooley, and S. Neill
Doing the unexpected: proteins involved in hydrogen peroxide perception
J. Exp. Bot.,
May 1, 2006;
57(8):
1711 - 1718.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-P. Dong, J. Peng, Z. Bao, X. Meng, J. M. Bonasera, G. Chen, S. V. Beer, and H. Dong
Downstream Divergence of the Ethylene Signaling Pathway for Harpin-Stimulated Arabidopsis Growth and Insect Defense
Plant Physiology,
November 1, 2004;
136(3):
3628 - 3638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Jonak, H. Nakagami, and H. Hirt
Heavy Metal Stress. Activation of Distinct Mitogen-Activated Protein Kinase Pathways by Copper and Cadmium
Plant Physiology,
October 1, 2004;
136(2):
3276 - 3283.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yamaguchi, S. Tanabe, E. Minami, and N. Shibuya
Activation of Phospholipase D Induced by Hydrogen Peroxide in Suspension-cultured Rice Cells
Plant Cell Physiol.,
September 15, 2004;
45(9):
1261 - 1270.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Kobayashi, S. Yamamoto, H. Minami, Y. Kagaya, and T. Hattori
Differential Activation of the Rice Sucrose Nonfermenting1-Related Protein Kinase2 Family by Hyperosmotic Stress and Abscisic Acid
PLANT CELL,
May 1, 2004;
16(5):
1163 - 1177.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Gupta and S. Luan
Redox Control of Protein Tyrosine Phosphatases and Mitogen-Activated Protein Kinases in Plants
Plant Physiology,
July 1, 2003;
132(3):
1149 - 1152.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Jambunathan and T. W. McNellis
Regulation of Arabidopsis COPINE 1 Gene Expression in Response to Pathogens and Abiotic Stimuli
Plant Physiology,
July 1, 2003;
132(3):
1370 - 1381.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. E. Moshkov, G. V. Novikova, L. A.J. Mur, A. R. Smith, and M. A. Hall
Ethylene Rapidly Up-Regulates the Activities of Both Monomeric GTP-Binding Proteins and Protein Kinase(s) in Epicotyls of Pea
Plant Physiology,
April 1, 2003;
131(4):
1718 - 1726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Moon, B. Lee, G. Choi, D. Shin, D. T. Prasad, O. Lee, S.-S. Kwak, D. H. Kim, J. Nam, J. Bahk, et al.
NDP kinase 2 interacts with two oxidative stress-activated MAPKs to regulate cellular redox state and enhances multiple stress tolerance in transgenic plants
PNAS,
January 7, 2003;
100(1):
358 - 363.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Samuel and B. E. Ellis
Double Jeopardy: Both Overexpression and Suppression of a Redox-Activated Plant Mitogen-Activated Protein Kinase Render Tobacco Plants Ozone Sensitive
PLANT CELL,
September 1, 2002;
14(9):
2059 - 2069.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Vranova, D. Inze, and F. Van Breusegem
Signal transduction during oxidative stress
J. Exp. Bot.,
May 15, 2002;
53(372):
1227 - 1236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Neill, R. Desikan, A. Clarke, R. D. Hurst, and J. T. Hancock
Hydrogen peroxide and nitric oxide as signalling molecules in plants
J. Exp. Bot.,
May 15, 2002;
53(372):
1237 - 1247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Ren, H. Yang, and S. Zhang
Cell Death Mediated by MAPK Is Associated with Hydrogen Peroxide Production in Arabidopsis
J. Biol. Chem.,
January 4, 2002;
277(1):
559 - 565.
[Abstract]
[Full Text]
|
 |
|
|
|