|
Plant Physiol, August 2001, Vol. 126, pp. 1630-1636
Sequence Architecture Downstream of the Initiator Codon Enhances
Gene Expression and Protein Stability in Plants1
Samir V.
Sawant,
Kanti
Kiran,
Pradhyumna K.
Singh, and
Rakesh
Tuli*
National Botanical Research Institute, Rana Pratap Marg,
Lucknow-226001, India
 |
ABSTRACT |
Nucleotide positions conserved on the 3' side of the initiator
codon ATG and the corresponding N-terminal amino acid residues in a
number of highly abundant plant proteins were identified by
computational analysis of a dataset of highly expressed plant genes.
The reporter genes uidA and gfp were
modified to introduce these features. Insertion of GCT TCC TCC after
the initiator codon ATG augmented expression for both the reporter
genes. The insertion of each successive codon improved the expression
of -glucuronidase (GUS) in an incremental fashion in transient
transformation of tobacco (Nicotiana tabacum) leaves.
The insertion of alanine-serine (Ser)-Ser resulted in about a 2-fold
increase in the stability of GUS. However, this did not account for the
30- to 40-fold increase in GUS activity between the constructs coding
for methionine-alanine-Ser-Ser-GUS and the native enzyme. Substitution
of the codon for Ser at the third amino acid residue with synonymous
codons reduced GUS expression. The results suggest a role for the
conserved nucleotides in the +4 to +11 region in augmenting
posttranscriptional events in the expression of genes in plants.
 |
INTRODUCTION |
Sequences flanking the translation
initiator codon ATG have been surveyed in vertebrate (Cavener, 1987 ;
Kozak, 1987 ) and plant (Joshi et al., 1997 ; Sawant et al., 1999 ) gene
databases to predict context requirements for translational initiation.
Some of the predictions made by computational analysis have been
substantiated experimentally by using in vitro translation systems. The
current model (Kozak, 1989 ) for the initiation of eukaryotic
translation broadly postulates that the first ATG codon is recognized
by scanning of the mRNA sequence from the 5' end by the 40S ribosomal
initiation complex. The 3 and +4 positions (where the A of ATG is +1)
are considered as the most important in determining a favorable context of initiator ATG (Sullivan and Green, 1993 ). The nucleotides upstream of the ATG are believed to comprise the context required for efficient initiation of translation. The modulation of gene expression by nucleotides upstream of the ATG has been studied in plant cells (Taylor
et al., 1987 ; McElroy et al., 1991 ; Dinesh-Kumar and Miller, 1993 ;
Johnston and Rochon, 1996 ; Marcin et al., 2000 ), though the functional
roles of the preferred nucleotides at the 1, 2, and 3 positions
are not known. Specific, "most preferred" nucleotides at these
positions were reported to give a two-fold variation in gene
expression, depending upon the plant species and the cell type (Marcin
et al., 2000 ). Using in vitro translation, Lütcke et al. (1987)
reported differences in the nucleotide requirement at the 3 position
between mammalian (rabbit reticulocyte) and plant (wheat germ) systems.
The role of the sequence context downstream of the ATG, especially
beyond the +5 position, has not been examined in plants. The G at +4
and A at +5 positions were suggested to determine the efficient
utilization of ATG initiation sites in in vitro translation experiments
using the rabbit reticulocyte system (Grunert and Jackson, 1994 ).
However, in disagreement with this study and that of Boeck and
Kolakofsky (1994) , Kozak (1997) reported a role of only up to the +4
position in correct recognition of the initiator codon. The extent of
conserved positions further downstream of +4 and their function in in
vivo gene expression have not been studied in detail. In none of the
earlier studies was the context analysis done after classifying the
gene database with respect to their level of expression.
The nucleotides following the initiator ATG also determine the type of
amino acid residues at the N terminus of encoded proteins. This can
additionally influence gene expression indirectly by altering the
stability of proteins. A variety of mechanisms that affect the
intracellular stability of proteins in yeast (Saccharomyces cerevisiae; Bachmair et al., 1986 ) and mammalian cells
(Lèvy et al., 1999 ) have been reported to operate by recognizing
the type of amino acids at the N-terminal end. We examined a dataset of
highly expressed plant genes to see if they had features conserved downstream of the ATG initiator codon and if such features were in
contrast to the genes expressed at low levels. The functional validity
of the features noticed in computational analysis was established by
determining their role on the level of in vivo gene expression. Keeping
the ATG upstream context constant, this study reports the influence of
nucleotide sequences conserved on the 3' side of the initiator ATG on
in vivo expression of uidA and gfp genes, using a
transient assay involving biolistic transformation of tobacco
(Nicotiana tabacum) leaves.
 |
RESULTS |
Features Conserved on the 3' Side of the Initiator ATG in
Highly Expressed Plant Genes
The underlying assumption of this study was that the features
characteristic of the 3' side of the initiator ATG codon found in a
number of genes expressed at high levels in plants may reveal specialized architecture that facilitates the high level of their expression in vivo. Two features were noticed. First, there was a
significant bias for specific nucleotides at positions +4, +5, +6, +8,
+9, +10, and +11 in the dataset of highly expressed genes (Table
I). This results in a second feature that
characterizes the abundantly expressed plant proteins. The predominance
of GCT at the +4 to +6 positions gives an Ala next to N-terminal Met in
95% of such proteins. Other conserved nucleotides in the second and
third codon positions similarly result in the predominance of Ser as
the third and the fourth residues in the highly expressed plant
proteins (Table I). Features of the canonical ATG downstream sequence
identified as conserved in the dataset of highly expressed plant genes
remained the same, irrespective of whether, in the case of gene
families, multiple members or orthologous representatives were
considered in the analyses. When all members of the gene families
were considered, the dataset comprised 236 entries. This dataset
resulted in the nucleotide sequence on 3' of the initiator ATG and the
corresponding N-terminal amino acid sequence shown in Table I.
Reconstruction of the database to include only one representative
sequence per gene family gave a dataset comprising of 74 entries. This
smaller dataset resulted in a similar conserved ATG 3' nucleotide
sequence, that is to say A100
T100 G100
G98 C92
T75 T40
C60 C40
(T37/A35)
C41, and corresponding N-terminal amino acid
sequence Met100 Ala92
Ser36 Ser30. Results from
the complete dataset shown in Table I were used for detailed
analyses.
View this table:
[in this window]
[in a new window]
|
Table I.
Modification of initiator ATG-downstream sequence in
reporter genes
Conserved ATG downstream features in highly expressed plant
genes: (a) nucleotides to 3' of initiator ATG,
A100T100G100G98C94T75 NC62C40(T37/A35)C48,
and (b) N-terminal amino acids,
Met100 Ala95Ser32Ser31.
uidA Constructs with modified ATG downstream sequence:
upstream primers,
5'-AATTACATCTAGATAAACAATG*TTACGTCCTGTAGAAACCCCAA-3'.
gfp Constructs with modified ATG downstream sequence:
upstream primers,
5'-ATGCATTCTAGATCAACAATG*GGTAAAGGAGAAGAACTTTTCACTGGAGTT3'.
|
|
Conservation of Codons Following Initiator ATG in Highly Expressed
Plant Genes
A high frequency of G at +4 and C at +5 noticed in our dataset of
highly expressed plant genes has been documented earlier in vertebrate
genes (Grunert and Jackson, 1994 ). It was also correlated with a high
frequency of Ala as the corresponding amino acid at the second position
in vertebrate (Grunert and Jackson, 1994 ) and plant (Luehrsen and
Walbot, 1994 ) proteins. However, the advantage, if any, of an Ala next
to the initiator Met has not been reported. The preferred occurrence of
T at +6, which is the wobble position in the codon for Ala, is
characteristic of the penultimate N-terminal codon in the dataset
developed by us. In an earlier study (Murray et al., 1989 ), the
frequency of GCT employed for Ala in plant gene database was calculated
at 37%. Quite comparably, the dataset of highly expressed nuclear
genes analyzed by us also showed GCT for Ala at 39% positions in the
reading frame. However, the frequency of GCT usage at +4 to +6 position
in the same dataset was 78%. This points to a possible role of U at +6
position over and above a possible advantage in having an Ala as the
second amino acid in abundantly expressed proteins. Likewise, a
preferred deployment of CC at the second and third codon positions,
with Ser as the third amino acid residue, could be indicative of an
architecture at +8 and +9 that facilitates a high level of gene
expression. The UCC is used in only 20% of the cases for Ser elsewhere
in the dataset of highly expressed nuclear genes in plants. However, Ser at the third amino acid position in the highly expressed genes is
coded by UCC in 46% of the cases. The +10 and +11 positions show a
preference for T/A and C, respectively, and a preference for Ser as the
fourth N-end residue. Of the highly expressed proteins, 46% had
Met-Ala, 18% had Met-Ala-Ser, 17% had Met-Ala-X-Ser, and 14% had
Met-Ala-Ser-Ser as the N-terminal amino acids. The last class comprised
members of the RuBP carboxylase small subunit family from different
plants and forms part of the most abundant proteins in plants.
Effect of Conserved Features on Expression of the Reporter
Genes
The functional validity of the conserved features was established
by comparing the suitably mutated uidA genes in transient expression, following their bombardment on tobacco leaves. The uidA gene modified (Table I) to resemble the ATG downstream
architecture of the highly expressed plant genes up to +11 position,
i.e. MAS1S- -glucuronidase (GUS), showed a 30- to 40-fold
increase in GUS expression in tobacco leaves. The activity increased
progressively (Fig. 1) as the nucleotide context in Met-Leu-Leu-Pro-GUS (M-GUS) was progressively extended to
include the conserved motif up to +11 in MAS1S-GUS. In order to
establish that the increase in GUS activity was the result of the
specific ATG downstream nucleotide sequence and/or the corresponding
amino acid residues and not merely the consequence of providing a 5'
extension to the mRNA, the expression of GUS was examined from
constructs carrying point mutations of MAS1S-GUS. As shown in Table
II, the substitution of C at +5
with A (MDS1S-GUS, results in
Ala2 -Asp) and C at +8 with G
(MACS-GUS, results in Ser3 -Cys)
resulted in a significant decline in GUS activity. The decline was most
severe in the case of the +5 mutation (MDS1S-GUS) and that corresponds
with this position being conserved in 94% of the highly expressed
genes (Table I). The importance of a specific nucleotide per se at a
given position was further examined by making synonymous substitutions
in TCC, the third N-terminal codon. The C G mutation at +9
(MAS2S-GUS) gave a 5.5-fold reduction in expression (Table II),
although both MAS1S- and MAS2S-GUS have Ser as the third N-terminal
residue. A double mutation in the third codon, i.e. T A and C G at
positions +7 and +8, respectively, in MAS3S, resulted in a six-fold
reduction in expression level. When the TCC was replaced by the
synonymous codon AGT (MAS4S), thereby mutating all three positions
without altering the amino acid, the expression was reduced by
seven-fold.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 1.
Effect of ATG downstream modifications on in vivo
GUS activity in cell-free extracts prepared at different time points
after bombardment of tobacco leaves with gene constructs expressing
M-GUS ( ), MA-GUS ( ), MAS1-GUS ( ), and MAS1S-GUS
( ).
|
|
Validation of the results on the augmentation of GUS activity by the
ATG 3' motif in MAS1S-GUS was further substantiated by inserting the
same motif after the ATG of a second reporter gene, in this case
gfp. Insertion of the canonical +4 to +11 motif enhanced the
expression of MAS1S-green fluorescent protein (GFP) also by 21-fold (Table II) as compared with the wild-type M-GFP.
Given the fact that the gene architecture upstream of the initiator
codon is exactly similar in all the constructs, the increase in
expression in the MAS1S-fusion constructs is likely to be due to the
enhancement of one or more posttranscriptional events. It could be due
to improved transcript stability, higher translational efficiency, an
increase in activity of the proteins due to altered N-terminal
conformation, decrease in their rate of intracellular degradation, or a
combination of one or more of these aspects. The different GUS
constructs were examined in detail to resolve these possibilities.
Substrate saturation curves (Fig. 2)
showed that all four forms of GUS, that is to say M-GUS, MA-GUS,
MAS1-GUS, and MAS1S-GUS, exhibited exactly similar reaction kinetics.
Similar K0.5 values and saturation curves of the
four forms suggested that the N-terminal modifications made in this
study did not enhance the enzyme activity by imparting a catalytically
favorable functional conformation to GUS. Similarly, the decline in GUS
activities in MDS1S-GUS and MACS-GUS was not due to an effect on the
catalytic site of the enzyme.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 2.
Substrate saturation curves of GUS in cell-free
extracts prepared from tobacco leaves, 36 h after bombardment with
different ATG constructs. Using 4-methylumbelliferyl
-D-glucuronide as the variable substrate, the raw data
on GUS-specific activities were plotted (shown in inset, with
y axis as in Fig. 1) and then normalized to allow visual
comparison of the shape of the curves. MDS1S-GUS ( ) and MACS-GUS
( ) are also included, besides the constructs given in Figure
1.
|
|
Figure 3 shows the results of reverse
transcriptase (RT)-PCR, to compare relative steady state levels of GUS
transcripts formed after bombardment with the constructs coding for
M-GUS and MAS1S-GUS. From the 26th to 30th cycle, the amplification
products showed a linear increase. The level of amplification achieved
in different cases was comparable, suggesting that the different
constructs transcribed uidA at similar levels. This excluded
any substantial contribution of transcription and transcript stability
on the 30- to 40-fold higher level of GUS expression from MAS1S-GUS as compared to M-GUS.

View larger version (106K):
[in this window]
[in a new window]
|
Figure 3.
Quantification of GUS transcripts by RT-PCR. One
microgram of total RNA prepared from tobacco leaves bombarded with
different constructs was subjected to RT-PCR. The amplification
products in aliquots drawn at different stages were compared after
electrophoresis. The agarose gel shows HaeIII ØX174
molecular weight standards (lane 1), PCR of standard GUS plasmid (lane
2), RT-PCR of control (non-bombarded; lane 3), and that of M-GUS (lanes
4, 6, 8, and 10) and MAS1S-GUS (lanes 5, 7, 9, and 11) on samples drawn
after 26, 28, 30, and 40 cycles of amplification. Another control,
comprising total RNA from MAS1S-GUS leaf but without adding the RT
during the RT-PCR, showed no fragment after 40 cycles of amplification
(lane not included).
|
|
Effect of Conserved N-Terminal Amino Acids on Protein
Stability
The cycloheximide treatment arrested the increase in GUS activity
(Fig. 4). The half-life of GUS was
calculated by using model y = +  x
as the best fit. The activity of M-GUS declined with an average half-life of 4.26 h. Insertion of an Ala after the initiator Met gave a distinct advantage in reducing turnover of MA-GUS by 1.5-fold. The half life of GUS increased progressively in the constructs MA-GUS,
MAS1-GUS, and MAS1S-GUS to 6.8, 7.6, and 9.3 h. However, the gain
in intracellular stability was not sufficient to account for the nearly
four-, eight-, and 30-fold higher in vivo activity seen, respectively
(Fig. 1), in the case of MA-GUS, MAS1-GUS, and MAS1S-GUS, as compared
with M-GUS.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 4.
Relative activity of GUS in cell-free extracts
prepared at different time points after transfer of leaves to medium
containing cycloheximide. One set of leaf discs in each case was
transferred to medium containing cycloheximide, 60 h after the
bombardment. Each data point gives the average of six independent
bombardment events. The symbols are the same as in Figure 1.
|
|
 |
DISCUSSION |
Our study shows that computational analysis of highly expressed
plant genes can be used to identify features in gene architecture that
possibly contribute toward determining their high level of expression.
Though context sequences around the initiator ATG have been recognized
earlier, such analyses have not been done after classifying the genes
with respect to their level of expression or function. Following
classification of genes into a dataset of highly expressed plant genes,
novel features were identified downstream of the initiator ATG in this
study. The validity of their function in augmenting the level of
expression was supported by introducing such features in two reporter
genes, uidA and gfp.
The results on the steady state of GUS transcripts in various
constructs suggest that insertion of the conserved nucleotide sequence
GCTNCC(T/A) CN following the initiator ATG does not enhance stability
of the transcripts. A two-fold increase in intracellular stability of
GUS protein suggests a modest role of the N-terminal amino acids in
determining the half-life of proteins. However, a majority of the 30- to 40-fold increase in the expression of GUS following insertion of the
ATG downstream conserved motif seems to be due to posttranscriptional
events, although we can rule out protein and transcript stability.
Though detailed steps in translational initiation and elongation are
not understood, it is possible that nucleotides downstream of the ATG
from +4 to +11 influence these events. Translation initiation factors (Raught et al., 2000 ) and ATG upstream nucleotides (Lütcke et al., 1987 ) specific to plants have been reported and may have distinct
roles in determining translational efficiency. It is possible that
efficient ribosomal recruitment at the initiator ATG involves an
interaction between the +4 to +11 positions and the 48S pre-initiation
complex in plants. The experiments with synonymous substitutions
suggest that the TC at +7 to +8 and the C at +9 possibly influence
translational efficiency favorably. Similarly, a C at +5 appears to be
critical. In vitro studies on mRNAs with several substitutions in the
ATG downstream region are required to understand the mechanism of such
activation. The role of ATG downstream features in translational
control is not known, though enhancer elements downstream of the ATG
initiation codon have also been postulated in certain bacterial genes
(O'Connor et al., 1999 ).
The results reported here show that the intracellular stability of GUS
expressed in tobacco leaves was influenced by the specific nucleotide
sequence and the corresponding amino acids at the N-terminal end. The
stabilizing effect increased when the Met exposed at the N terminal of
GUS was followed by Ala-Ser-Ser as the next three residues, with the
maximum effect being observed when all three were present.
Applicability of the result to GFP, used as a second reporter protein,
further supports the validity of a purely computational analysis done
by classifying genes by their level of expression. The results suggest
that the specific nucleotide sequence and the corresponding amino acids
at the N-terminal end of highly expressed proteins may have been
evolutionarily selected to obtain high level of expression of these
proteins. Interestingly, in Escherichia coli the presence of
amino acids with smaller side chain lengths, i.e. Ala or Ser at the
second position, was reported as particularly unfavorable to N-terminal
stability of -galactosidase (Hirel et al., 1989 ). The excision of
N-terminal Met by Met aminopeptidase was reported to decrease in
E. coli when amino acids with a longer side chain were
inserted at the penultimate position of -galactosidase. Thus, the
length parameter rule for E. coli proteins beginning with
Met does not apply to GUS and GFP stability in tobacco leaves.
In the case of processed proteins, different sets of amino acids at the
non-Met N terminal impart stability in plants (Hondred et al., 1999 ),
yeast, and rabbit reticulocytes (Tobias et al., 1991 ). Intracellular
stability in such cases is determined by the ubiquitin-dependent N-end
rule pathway. For instance, Met, Pro, Val, or Gly at the amino terminus
stabilizes proteins in reticulocytes (Tobias et al., 1991 ). In addition
to these, Thr, Ser, Ala, or Cys stabilizes proteins in yeast. In
E. coli, any of the above with the exception of Pro and, in
addition, Gln, Asn, Glu, Asp, Ile, or His, stabilize proteins. The
principles of intracellular stability of ubiquitinylated proteins have
recently been employed to enhance the accumulation of heterologous
proteins in transgenic tobacco (Hondred et al., 1999 ). Our results
suggest that Met-Ala-Ser-Ser, using the appropriate codons, may be a
useful N-terminal tag for designing vectors for enhancing the stability of proteins in plants, provided their catalytic function is not affected by such modification.
 |
MATERIALS AND METHODS |
Computational Analysis
The EMBL gene database was screened manually to create a subset
of angiosperm genes, potentially expressed at high level in plants,
irrespective of their tissue or environmental specificities. The genes
were classified as highly expressed, based on published information
(Ruan et al., 1998 ; several other references cited in Sawant et al.,
1999 ), on their expression level, various expressed sequence tags, and
microarray analyses.
The selected dataset comprised highly expressed plant genes, several of
which occur as gene families, that is to say chlorophyll a/b binding
proteins, late embryogenesis abundant proteins, RuBP carboxylase small
subunit, seed storage proteins (2S albumins, 7S albumins, 12S
globulins, prolamins, napins, oleosins, 19-kD globulins, phaseolins,
kafirins, zeins, and citrins), lectins, histones, photosystem related
proteins (photosystem I proteins, photosystem II proteins, and
cytochromes), nucleus coded mitochondrial proteins (RP15, citrate
synthases, ATPases, and cytochromes), ribosomal proteins (L36, S10,
S28, CL15, CL9, CS1, and CS70) Phe ammonia lyases, acyl carrier
proteins, calmodulins, peroxidases, catalases, Pro- and Gly-rich
proteins, extensins, polygalacturonases, cyclins (delta, 2A, 2B, 3A,
and 3B), nodulins, translational elongation factors (TS, TU, and
1 ), -amylases, -amylases, and amylase inhibitors. Other
entries represented unique genes, that is to say actinidin protease
from Actinidia delicosa, cinnamyl alchohol dehydrogenase, calcium binding protein, flavone isomerase, ferrodoxin, RNA binding protein from Arabidopsis, microspore specific protein from
Brassica napus, fructokinase, phosphoglycerate kinase,
ascorbate oxidase, nitrilase from tobacco (Nicotiana
tabacum), allergen protein, glutathione reductase, lipoamide
dehydrogenase from Pisum sativum, latex protein
from Papaver somniferum, arabinogalactan, lipid transfer
protein, Suc transfer protein from Pinus taeda, etc.
The sequences were manually aligned with respect to translational
initiator ATG, as identified by the authors against individual entry in
the database. Information about the ATG region of the 236 entries was
employed in this analysis. A complete list of genes classified broadly
with respect to their level of expression and used in this study
is available on the Internet at
www.geocities.com/rakeshtuli/PLNATG.htm, along with respective
database references. The dataset of 236 entries was translated into
nascent protein sequences to survey amino acid residues at the first 10 positions from the N-terminal region. The conserved nucleotide and the
amino acid positions as determined by statistical tests of significance
are given in Table I. A detailed analysis showing that several
nucleotide sequence features in the highly expressed plant genes are in
contrast to the features in genes expressed ubiquitously at low level
has been published (Sawant et al., 1999 ). Differences in the levels of
expression within gene families were ignored while creating the dataset
since the objective was to identify features conserved in a majority of
the members. As explained in "Results," the conclusions did not
change significantly if only one ortholog sequence representing a given
gene family was included in the dataset instead of all the members
reported from multiple plant species.
Construction of the Reporter Genes with Modified ATG 3'
Contexts
The uidA gene was amplified from pBI101.1, using
nine different upstream primers designed to obtain the desired variants
of the wild-type GUS mRNA. As given in Table I, the standard upstream primer (Primer 1) was used to amplify the wild-type uidA
gene that comprises the native open reading frame that codes for M-GUS. The primers 2, 3, 4, 5, and 6 amplified GUS with Ala, Ala-Ser, Ala-Ser-Ser, Asp-Ser-Ser, and Ala-Cys-Ser, respectively, inserted between the first Met and the second Leu in the wild-type protein. The
primers 7, 8, and 9 amplified variants of the Ala-Ser-Ser-coding mRNA
in which the codon for the former Ser was substituted by synonymous
codons. The nine constructs are referred to as M-, MA-, MAS1-, MAS1S-,
MDS1S-, MACS-, MAS2S-, MAS3S-, and MAS4S-GUS, respectively. These were
cloned into pUC19 by PCR-based ligation, in front of a highly expressed
plant promoter (Sawant et al., 2001 ). The PCR was conducted using
VentR DNA polymerase, which is known for a low error rate
(5.7 × 10 5, which is very close to
4 × 10 5 for Klenow). The cloned fragments were
sequenced in the ATG context region and found to be free of any errors.
The different constructs, therefore, had exactly the same ATG-5'
translational context, untranslated leader, and promoter-regulatory
region. They differed only with respect to the presence of additional
codons inserted after the initiator Met as per the architecture
identified in highly expressed plant genes. The primers 10 and 11 (Table I) were used (as upstream primers) to clone gfp
(Reichel et al., 1996 ) to validate the effect of the conserved features
on the expression of a second gene.
Analysis of Transient Expression of the Reporter Genes in
Tobacco Leaves
The transient expression studies were carried out by
microprojectile-mediated delivery of DNA in tobacco leaf discs using an
improved method (Sawant et al., 2000 ). The modified protocol gives
highly reproducible shot-to-shot results. Stability of the GUS in the
bombarded leaf was measured by blocking de novo protein synthesis by
placing the leaf discs on medium containing 300 µg mL 1
cycloheximide. Following bombardment with DNA, the leaf was cut into
approximately 1-cm2 pieces and incubated on Murashige and
Skoog-agar medium (in light). After 60 h of incubation, the leaf
pieces were removed to determine GUS activity fluorometrically
(Jefferson and Wilson, 1991 ). Endogenous GUS-like activity was
suppressed by incorporating 20% (v/v) methanol in the reaction
and treating the samples at 55°C for 10 min. At least six independent
bombardments were done in each case to estimate GUS activity at each
time point.
The single-point GUS and GFP activities were measured after incubating
six replicates of the tissue on agar-Murashige and Skoog medium (in
light) for 72 h after bombardment. The cell-free extracts for GFP
measurements were prepared in 50 mM sodium phosphate buffer, pH 7. Emission was measured at 510 nm, following excitation at
475 nm (Reichel et al., 1996 ).
Analysis of GUS Transcript by RT-PCR
The relative amounts of GUS transcripts present in tobacco leaf
discs were estimated in terms of the product formed in RT-PCR after
bombardment of the discs with different gene constructs. One microgram
of total RNA extracted in TRIZOL LS Reagent (Gibco-BRL, Cleveland) was
treated with RNase-free DNase (1 unit of enzyme per microgram RNA;
Amersham-Pharmacia, Uppsala), reverse transcribed by Superscript
II (Gibco-BRL), and subjected to 40 cycles of PCR using primers that
amplified a 175-bp fragment internal to the uidA gene.
The phase of linear increase in PCR products was determined by drawing
aliquots at different stages. The amount of amplified DNA was estimated
both with Hoechst dye (H 33258, Sigma, St. Louis) and by scanning with
the Flour-S (Bio-Rad Laboratories, Hercules, CA) documentation system
after agarose gel electrophoresis.
 |
ACKNOWLEDGMENTS |
We thank Dr. S.K. Mandal of Central Drug Research Institute
(Lucknow, India) for advice on statistical analysis of the data and Dr.
Jaideep Mathur for providing the gfp construct.
 |
FOOTNOTES |
Received January 18, 2001; returned for revision February 15, 2001; accepted April 18, 2001.
1
This work was supported by fellowships (to
S.V.S. and P.K.S.) and by a research grant from The Council of
Scientific and Industrial Research, Government of India.
*
Corresponding author; e-mail rakeshtuli{at}hotmail.com; fax
0522-205836.
 |
LITERATURE CITED |
-
Bachmair A, Finley D, Varshavsky A
(1986)
In vivo half-life of a protein is a function of its amino-termianl residue.
Science
234: 179-186[Abstract/Free Full Text]
-
Boeck R, Kolakofsky D
(1994)
D Positions +5 and +6 can be major determinants of the efficiency of non-AUG initiation for protein synthesis.
EMBO J
13: 3608-3617[Web of Science][Medline]
-
Cavener DR
(1987)
Comparison of the consensus sequence flanking translational start site in Drosophila and vertebrates.
Nucleic Acids Res
15: 1353-1361[Abstract/Free Full Text]
-
Dinesh-Kumar SP, Miller WA
(1993)
Control of start codon choice on a plant viral RNA encoding overlapping genes.
Plant Cell
5: 679-692[Abstract/Free Full Text]
-
Grunert S, Jackson RJ
(1994)
The immediate downstream codon strongly influences the efficiency of utilization of eukaryotic translation initiation codons.
EMBO J
13: 3618-3630[Web of Science][Medline]
-
Hirel Ph-H, Schmitter J-M, Dessen P, Fayat G, Blanquet S
(1989)
Extent of N-terminal methionine excision from Escherichia coli proteins is governed by the side- chain length of the penultimate amino acid.
Proc Natl Acad Sci USA
86: 8247-8251[Abstract/Free Full Text]
-
Hondred D, Walker JM, Mathews DE, Vierstra RD
(1999)
Use of ubiquitin fusions to augment protein expression in transgenic plants.
Plant Physiol
119: 713-723[Abstract/Free Full Text]
-
Jefferson RA, Wilson KJ
(1991)
The GUS gene fusion system.
In
S Gelvin, R Schilperoort, eds, Plant Molecular Biology Manual, Vol. B14. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 1-33
-
Johnston JC, Rochon DM
(1996)
Both codon context and leader length contribute to efficient expression of two overlapping open reading frames of a cucumber necrosis virus bifunctional subgenomic mRNA.
Virology
221: 232-239[CrossRef][Web of Science][Medline]
-
Joshi CP, Zhou H, Huang X, Chiang VL
(1997)
Context sequences of translation initiation codon in plants.
Plant Mol Biol
35: 993-1001[CrossRef][Web of Science][Medline]
-
Kozak M
(1987)
At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells.
J Mol Biol
196: 947-950[CrossRef][Web of Science][Medline]
-
Kozak M
(1989)
The scanning model for translation: an update.
J Cell Biol
108: 229-241[Abstract/Free Full Text]
-
Kozak M
(1997)
Recognition of AUG and alternative initiator codons is augmented by G in position +4 but is not generally affected by the nucleotides in positions +5 and +6.
EMBO J
16: 2482-2492[CrossRef][Web of Science][Medline]
-
Lèvy F, Johnston JA, Varshavsky A
(1999)
Analysis of a conditional degradation signal in yeast and mammalian cells.
Eur J Biochem
259: 244-252[Medline]
-
Luehrsen KR, Walbot V
(1994)
The impact of AUG start codon context on maize gene expression in vivo.
Plant Cell Rep
13: 454-458
-
Lütcke HA, Chow KC, Mickel FS, Moss KA, Kern HF, Scheele GA
(1987)
Selection of AUG codons differs in plants and animals.
EMBO J
6: 43-48[Web of Science][Medline]
-
Marcin L, Marc F, Bènèdicte J, Arnaud S, Marc B
(2000)
In vivo evaluation of the context sequence of the translation initiation codon in plants.
Plant Science
154: 89-98
-
McElroy D, Blowers AD, Jenes B, Wu R
(1991)
Construction of expression vectors based on the rice actin 1 (Act1) 5' region for use in monocot transformation.
Mol Gen Genet
231: 150-160[CrossRef][Web of Science][Medline]
-
Murray EE, Lotzer J, Eberle M
(1989)
Codon usage in plant genes.
Nucleic Acids Res
17: 477-498[Abstract/Free Full Text]
-
O'Connor M, Asai T, Squires CL, Dahlberg AE
(1999)
Enhancement of translation by the downstream box does not involve base pairing of mRNA with the penultimate stem sequence of 16S rRNA.
Proc Natl Acad Sci USA
96: 8973-8978[Abstract/Free Full Text]
-
Raught B, Gingras A-C, Sonenberg N
(2000)
Regulation of ribosomal recruitment in eukaryotes.
In
N Sonenberg, JWB Hershey, MB Mathews, eds, Translational Control of Gene Expression, C.S.H. Press, New York, pp 245-293
-
Reichel C, Mathur J, Eckes P, Langenkemper K, Koncz C, Schell J, Reiss B, Maas C
(1996)
Enhanced green fluorescence by the expression of an Aequoreu victoria green fluorescent protein mutant in mono- and dicotyledonous plant cells.
Proc Natl Acad Sci USA
93: 5888-5893[Abstract/Free Full Text]
-
Ruan Y, Gilmore J, Conner T
(1998)
Towards Arabidopsis genome analysis: monitoring expression profiles of 1400 genes using DNA microarays.
Plant J
15: 821-833[CrossRef][Web of Science][Medline]
-
Sawant SV, Singh PK, Gupta SK, Madanala R, Tuli R
(1999)
Conserved nucleotide sequence in highly expressed genes in plants.
J Genet
78: 1-8
-
Sawant SV, Singh PK, Madanala R, Tuli R
(2001)
Designing of an artificial expression cassette for high level expression of transgenes in plants.
Theor Appl Genet
102: 635-644[CrossRef]
-
Sawant SV, Singh PK, Tuli R
(2000)
Pretreatment of microprojecticles to improve the delivery of DNA in plant transformation.
BioTechniques
29: 246-248[Web of Science][Medline]
-
Sullivan ML, Green PJ
(1993)
Post transcriptional regulation of nuclear-encoded genes in higher plants: the roles of mRNA stability and translation.
Plant Mol Biol
23: 1091-1104[CrossRef][Medline]
-
Taylor JL, Jones JDG, Sandler S, Mueller GM, Bedbrook J, Dunsmuir P
(1987)
Optimizing the expression of chimeric genes in plant cells.
Mol Gen Genet
210: 572-577[CrossRef]
-
Tobias JW, Shrader TE, Rocap G, Varshavsky A
(1991)
The N-end rule in bacteria.
Science
254: 1374-1377[Abstract/Free Full Text]
-
Tuli R (2000) List of highly expressed genes used for ATG
region analysis. www.geocities.com/rakeshtuli/PLNATG.htm (December 28, 2000)
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
S. Nakagawa, Y. Niimura, T. Gojobori, H. Tanaka, and K.-i. Miura
Diversity of preferred nucleotide sequences around the translation initiation codon in eukaryote genomes
Nucleic Acids Res.,
February 11, 2008;
36(3):
861 - 871.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kiran, S. A. Ansari, R. Srivastava, N. Lodhi, C. P. Chaturvedi, S. V. Sawant, and R. Tuli
The TATA-Box Sequence in the Basal Promoter Contributes to Determining Light-Dependent Gene Expression in Plants
Plant Physiology,
September 1, 2006;
142(1):
364 - 376.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. V. Sawant, K. Kiran, R. Mehrotra, C. P. Chaturvedi, S. A. Ansari, P. Singh, N. Lodhi, and R. Tuli
A variety of synergistic and antagonistic interactions mediated by cis-acting DNA motifs regulate gene expression in plant cells and modulate stability of the transcription complex formed on a basal promoter
J. Exp. Bot.,
September 1, 2005;
56(419):
2345 - 2353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Kochetov
AUG codons at the beginning of protein coding sequences are frequent in eukaryotic mRNAs with a suboptimal start codon context
Bioinformatics,
April 1, 2005;
21(7):
837 - 840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Patel, A. C. Corey, L.-P. Yin, S. Ali, W. C. Taylor, and J. O. Berry
Untranslated Regions from C4 Amaranth AhRbcS1 mRNAs Confer Translational Enhancement and Preferential Bundle Sheath Cell Expression in Transgenic C4 Flaveria bidentis
Plant Physiology,
November 1, 2004;
136(3):
3550 - 3561.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. C. Meyers, A. Kozik, A. Griego, H. Kuang, and R. W. Michelmore
Genome-Wide Analysis of NBS-LRR-Encoding Genes in Arabidopsis
PLANT CELL,
April 1, 2003;
15(4):
809 - 834.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|