|
Plant Physiol, September 2001, Vol. 127, pp. 150-158
The Properties of the Chlorophyll a/b-Binding
Proteins Lhca2 and Lhca3 Studied in Vivo Using Antisense
Inhibition1
Ulrika
Ganeteg,*
Åsa
Strand,
Petter
Gustafsson, and
Stefan
Jansson
Umeå Plant Science Center, Department of Plant Physiology, Umeå
University, S-901 87 Umeå, Sweden
 |
ABSTRACT |
The specific functions of the light-harvesting proteins Lhca2 and
Lhca3 were studied in Arabidopsis ecotype Colombia antisense plants in
which the proteins were individually repressed. The antisense effect
was specific in each plant, but levels of Lhca proteins other than the
targeted products were also affected. The contents of Lhca1 and Lhca4
were unaffected, but Lhca3 (in Lhca2-repressed plants) was almost
completely depleted, and Lhca2 decreased to about 30% of wild-type
levels in Lhca3-repressed plants. This suggests that the Lhca2 and
Lhca3 proteins are in physical contact with each other and that they
require each other for stability. Photosystem I fluorescence at 730 nm
is thought to emanate from pigments bound to Lhca1 and Lhca4. However,
fluorescence emission and excitation spectra suggest that Lhca2 and
Lhca3, which fluoresce in vitro at 680 nm, also could contribute to
far-red fluorescence in vivo. Spectral forms with absorption maxima at 695 and 715 nm, apparently with emission maxima at 702 and 735 nm,
respectively, might be associated with Lhca2 and Lhca3.
 |
INTRODUCTION |
During photosynthesis, light
energy is captured by pigments in the light-harvesting complex (LHC)
proteins and transferred to the reaction centers of the thylakoid
membrane in green plants. There are 10 different classes of
nuclear-encoded Lhc genes, which encode 10 abundant LHC
proteins in higher plants (Jansson, 1994 ). Of these 10 proteins, Lhca1
through Lhca4 form the LHC I complex, exclusively associated with
photosystem I (PS I). Lhcb3 through Lhcb6 are exclusively associated
with photosystem II (PS II) and Lhcb1 and Lhcb2 form mixed trimers (LHC
II) that can be associated with either photosystem. The gene family
also includes some related proteins such as the early light-induced
proteins, PsbS, and a few recently identified,
small-Mr proteins (Jansson, 1999 ).
LHC proteins bind chlorophyll (chl) a, chl b, and
carotenoids with weak, non-covalent bonds. The ancestor of the LHC
proteins was probably a form of the cyanobacterial high-light-inducible protein from which the LHC proteins seem to have evolved as the green
algae and plants appeared. The gross architecture of the higher plant
light-harvesting antenna appears to have been present more than 350 million years ago because the same LHC proteins are present in all
higher plants (Jansson, 1994 ). This also implies that all 10 LHC
proteins must have specific functions, otherwise some of the genes
would have been lost through genetic drift during evolution. Much
remains, however, to be learned about these specific functions. Besides
light harvesting, they also take part in the dissipation of excess
light. In light, violaxanthin is photoconverted to zeaxanthin through
antheraxanthin. This is believed to facilitate the dissipation of
excess light as heat, and the crucial importance of PsbS in this
process has recently been demonstrated (Li et al., 2000 ).
In Arabidopsis, the genes that encode the LHC I proteins
(Lhca1-4) are all present as single-copy genes (Jansson,
1999 ) that, like all other LHC genes, are located in the nuclear
genome. The Lhca proteins vary in size from 20 to 24 kD, and are
believed to exist as dimers, each independently binding to PS I. A
tentative model for the arrangement of the LHC I dimers around PS I has also been published (Jansson et al., 1996 ). Isolation of native Lhca
proteins is a difficult task, but preparation of LHC I on Suc gradients
gives two major subfractions which differ in protein composition and
protein content (Lam et al., 1984 ). One fraction has high density and
consists of Lhca1 and Lhca4, which have been shown to form a
heterodimer (Jansson et al., 1996 ; Schmid et al., 1997 ). This fraction
has a strong 77-K fluorescence emission with a maximum at 730 nm and
consequently has been named LHCI-730 (Lam et al., 1984 ; Knoetzel et
al., 1992 ). The other fraction has lower density, is composed of Lhca2
and Lhca3, fluoresces maximally at 680 nm in vitro (Lam et al., 1984 ;
LHCI-680) and can sometimes be separated into two fractions, one
containing Lhca2, and the other Lhca3 (Knoetzel et al., 1992 ). The
oligomeric state of LHCI-680 preparations has not been established.
Although Lhca2 and Lhca3 seem to exist as dimers in the native state
(Jansson et al., 1996 ), the separation of LHCI-680 on Suc gradients
indicates that under these in vitro conditions they are in a monomeric
state and thus do not represent true functional units. Other
biochemical data have also suggested that Lhca2 is not tightly
associated with Lhca3 (Jansson et al., 1996 ).
The 730-nm fluorescence emission of LHCI-730 is
remarkable. chl molecules in solution, or bound to most sites in the
pigment-binding protein complexes of PS I and PS II (bulk
chlorophylls), fluoresce at 670 to 690 nm, but a few fluoresce at
longer wavelengths. Because these far-red fluorescing chlorophylls
obviously have a lower energy than the PS I reaction center, P700, it
has been questioned whether they really could function as antenna
pigments or, rather, if they are really sinks for excess excitation
energy. Data recently have suggested that the far-red fluorescing chls
really are true antenna pigments that at physiological temperatures
could transmit their energy to the P700 (Pålsson et al., 1998 ;
Rivadossi et al., 1999 ), but the direct role of the far-red fluorescing
chls in the plant needs to be directly demonstrated. Regardless of
these considerations, there seem to be five to 10 far-red fluorescing chlorophylls present in each PS I complex, one or two of which are
believed to be associated with the PS I core (Croce et al., 1998 ).
There is heterogeneity among the far-red fluorescing chls. Some emit at
715 to 720 nm, and these are clearly located in the reaction center
complex because they also are present in cyanobacteria (which lack LHC
I), and the barley (Hordeum vulgare) mutant
vir-k23, which is devoid of LHC I (Knoetzel et al., 1998 ).
The other far-red fluorescing chls, emitting at 730 to 740 nm, have
been suggested, unsurprisingly, to be associated with LHCI-730 (Croce
et al., 1998 ).
Studies on biochemical preparations give valuable
information, but it is known that the in vivo energy transfers and
subsequent fluorescence emissions are altered when the complexes are
bound to each other and to the reaction center (Bossman et al., 1997 ; Schmid et al., 1997 ). Therefore, the best way of resolving the functions of the LHC proteins and the energy transfers in the complex
is to analyze mutants lacking individual proteins. Studies have been
made on several such mutants, for instance chl b-deficient barley mutants, but the results have been inconclusive because the
plants lack many LHC proteins bound both to PS I and PS II (Bossman et
al., 1997 ). In plants where homologous recombination is a rare event,
the construction of plants lacking specific proteins is most
efficiently performed using antisense inhibition of gene expression. We
have previously reported successful antisense inhibition of Lhca4
(Zhang et al., 1997 ), Lhcb4, and Lhcb5 (Andersson et al., 2001 ) and
here we present the results of an investigation involving the
construction and analysis of Lhca2 and Lhca3 antisense Arabidopsis plants.
 |
RESULTS |
Highly Efficient Antisense Inhibition
The seeds from the transformed plants were collected and placed on
kanamycin agar plates. Of the kanamycin-resistant T1 plants (20 from
each transformation), over 80% showed more than 95% depletion of the
corresponding protein, demonstrating highly efficient antisense inhibition, and none of the remaining transformants had protein levels
higher than 10% of the wild type (Fig.
1). Three Lhca2 and Lhca3 antisense lines
with no visible amounts of the Lhca2 or Lhca3 proteins, respectively,
were self-pollinated to give the T2 progeny and were analyzed by
Southern blots using probes for the antisense genes. The differences in
the restriction patterns confirmed that they originated from individual
transformation events (data not shown). To ensure that the protein
corresponding to the inhibited gene was depleted in all the plants
discussed in this paper (i.e. that the antisense effect was stable),
all plants were screened by immunoblotting and 77-K fluorescence
emission spectroscopy (see below) prior to all subsequent measurements. The results from the three independent lines were always consistent; consequently, in the following presentation, for clarity, we only show the results from one line per transformation.

View larger version (61K):
[in this window]
[in a new window]
|
Figure 1.
Screening for plants deficient in Lhca2 or Lhca3
by immunoanalysis of total leaf membrane preparations from individual
antisense lines (44, 47, etc.). Protein corresponding to 3 µg of chl
from wild type (WT) and five antisense plants from each transformation
was loaded in each lane and separated by SDS-PAGE. The Lhca2 and Lhca3
proteins were detected with monospecific antibodies.
|
|
The transgenic plants showed no obvious visible phenotypic deviation
from wild type under the growth conditions used in terms of
pigmentation or morphology. Even in long-term growth experiments, the
growth rates of the antisense plants were similar to wild-type rates
(data not shown).
The Antisense Inhibition Is Specific
The different Lhca genes show quite a high degree of
homology to each other. To elucidate whether the antisense inhibition was specific, transcription of the four Lhca genes was
studied using northern-blot analysis (Fig.
2). In both cases (Lhca2 and Lhca3), the
transcripts corresponding to the respective inserted antisense gene
were depleted below the level of detection by this method (more than
99%), whereas the transcript levels for the other Lhca
genes were not changed. Hybridization with a 25S rDNA probe confirmed
that equal amounts of RNA were loaded in each lane (not shown). This
shows that the antisense inhibition was not only efficient but also
specific in the sense that only the mRNA level of the corresponding
antisense construct was depleted, leaving the other genes
unaffected.

View larger version (122K):
[in this window]
[in a new window]
|
Figure 2.
Verification of specific antisense inhibition by
analyzing transcript levels of Lhca genes. Total RNA
preparations (2 µg) from wild-type (WT) and Lhca2 (-a2) or Lhca3
(-a3) antisense plants were separated on agarose gels. The
corresponding transcripts were detected with homologous probes. A 25S
rDNA fragment was used as a control for equal loading (not
shown).
|
|
Decreased Stability of the Other Lhca Proteins
These data prompted us to analyze the quantity of the other Lhca
proteins in the antisense lines, to determine if removal of Lhca2 or
Lhca3 affected the other LHC proteins of the PS I antenna. The relative
levels of the LHC proteins were analyzed by immunoblotting (Fig.
3). In the Lhca2 antisense line, the
amounts of Lhca1 and Lhca4 were the same as in the wild type, whereas Lhca3 decreased to less than 10% of the wild-type level. The Lhca3 plants also showed wild-type amounts of Lhca1 and Lhca4, but the Lhca2
levels decreased to about 30%. None of the Lhcb1-Lhcb6 proteins were
affected (Fig. 3). Because the Lhca3 mRNA level in the Lhca2 antisense
line was the same as in the wild-type plants, our conclusion is that
the Lhca3 protein is significantly less stable in the absence of Lhca2.
In a converse manner, the low amount of Lhca2 in the Lhca3 antisense
plants most probably indicates that Lhca2 is much less stable in the
absence of Lhca3. The protein levels simply were not reciprocal to each
other because Lhca3 amounts declined more than Lhca2 in the absence of
the other protein. This difference was found in three batches of plants
grown on three different occasions. These data suggest that the Lhca2
and Lhca3 proteins are in direct contact with each other in PS I, otherwise the interdependence of the protein levels is difficult to
explain.

View larger version (71K):
[in this window]
[in a new window]
|
Figure 3.
Analysis of the LHC protein content in total leaf
membrane preparations from Lhca2 and Lhca3 antisense plants by
immunoblotting. Membrane preparations from wild type (WT) and Lhca2
(-a2) or Lhca3 (-a3) antisense plants were subjected to SDS-PAGE.
Protein corresponding to 3 µg of chl was loaded in each lane. The
proteins were detected with a collection of antibodies specific for the
10 different LHC proteins.
|
|
Both Antisense Lines Have Decreased Long Wavelength
Fluorescence
According to previous suggestions, the far-red fluorescing
chls in LHC I should be associated with the Lhca1/Lhca4 heterodimer, and not with Lhca2 and Lhca3 (which fluoresce at 680 nm in vitro). Therefore, it was interesting to see that the in vivo 77-K chl fluorescence emission from leaves of the transgenic lines excited at
440 nm (chl a) showed significant differences in the red
region of the spectrum as compared with the wild type (Fig.
4A). In both the Lhca2 and Lhca3
transgenic plants, the 732-nm peak is shifted 6 to 726 nm, and the
amplitude is dramatically decreased. The difference was not a
consequence of different chl content; the antisense lines did not
differ significantly from the wild type in this respect. The effect on
the fluorescence emission spectrum upon removal of Lhca2 and Lhca3
resembled the effect seen in Lhca4 antisense plants, in which the
LHCI-730 complex (Lhca1/Lhca4) is missing (U. Ganeteg and S. Jansson, unpublished data). The Lhca4 antisense gene has been
introduced into another genetic background (strain C24), which has a
slightly different 77-K fluorescence emission spectrum. Therefore, to
compare the fluorescence emission characteristics of the different
antisense lines more carefully, difference spectra (wild type-antisense
plant) were calculated for the three different antisense lines (Fig.
4B). Gaussian deconvolution of the difference spectra gave identical
results with three peaks, one negative at 715 nm, one strongly positive
at 733 nm, and a minor (very wide) band at 759 nm (Fig. 4C), which were
sufficient to explain the difference spectrum. This shows that removal
of Lhca2/Lhca3 or Lhca1/Lhca4 had the same consequences
spectroscopically: Fluorescence emission at 733 nm is greatly reduced,
but molecules emitting at 715 nm, assumed to be located in the PS I
core, fluoresce more strongly in the antisense plants.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 4.
Analysis of 77-K fluorescence emission spectra of
wild-type (WT), Lhca2 (-a2), Lhca3 (-a3), and Lhca4 (-a4) antisense
plants. A, Seventy-seven-Kelvin fluorescence emission spectra for
excitation at 440 nm. The spectra were normalized to the 680-nm peak.
B, Difference spectra of corresponding wild-type and antisense plants
for Lhca2, Lhca3, and Lhca4. C, Gaussian deconvolution of the Lhca2
difference spectrum shown in Figure 4B and by the thickest solid line.
The deconvolution of the Lhca3 and Lhca4 spectra was virtually
identical to that of the Lhca2.
|
|
We also analyzed the fluorescence excitation spectra of the antisense
lines, monitoring emission at different wavelengths in the far-red
region (705-740 nm) and found several interesting features. First of
all, we could record differences between the excitation spectra from
individual leaves of the same plant (wild type or antisense). We
believe this is due to minor differences in environmental conditions
experienced by the individual leaves especially, most probably, shading
by other leaves. To eliminate such leaf-to-leaf variation, we sampled
four non-shaded leaves from different plants, measured their excitation
spectra, averaged the data for each line and used the resulting
averages for the calculations presented. The spectra were normalized to
the 439-nm chl a peak and a difference spectrum was
calculated by subtracting the spectra from the Lhca2 or Lhca3
transgenic plants from the wild-type spectra (Fig.
5).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 5.
Difference excitation spectra of Lhca-deficient
antisense plants. The fluorescence excitation spectra at 77 K were
measured at different emission wavelengths on four non-shaded leaves
per antisense line. The spectra were normalized to the 439-nm chl
a peak, the four spectra were averaged and the difference
spectra were calculated (wild type minus antisense) for Lhca2 and Lhca3
antisense plants.
|
|
A decrease in fluorescence in the transgenic plant results in a
positive peak and an increase yields a negative peak in the difference
spectra. The most prominent differences found were positive peaks in
both antisense lines at 695 and 715 nm, when fluorescence was monitored
at 720 to 740 nm. Pigments absorbing at 695 and 715 nm were probably
missing in the antisense lines. Alternatively, the 695- and 715-nm
pigments may not efficiently deliver their excitation energy to another
pigment, emitting between 720 and 740 nm. At the same emission
wavelengths, positive peaks were found at 510 nm, and negative peaks at
645 nm. A510 and A645 nm
is mainly attributed to xanthophylls and chl b,
respectively, indicating that xanthophylls were less efficient, and chl
b more efficient, in exciting the far-red fluorescing chls
in the antisense lines, as compared with the wild type.
No Changes in the Xanthophyll Cycle Pigment
When measuring the chl a/b ratio in the wild
type and transgenic plants, no significant differences could be seen.
Also, there were no differences in the carotenoid composition of
(dark-adapted) wild-type and transgenic plants (data not shown). We
also studied the kinetics of the xanthophyll cycle and the maximum
level of de-epoxidation by subjecting plants to high light for either 5 min or 1 h. None of the transgenic lines showed any
significant differences in the epoxidation state as compared with the
wild type (Table I), after either short-
or long-term exposure.
View this table:
[in this window]
[in a new window]
|
Table I.
Analysis of the epoxidation state in Lhca-deficient
antisense plants
Dark-adapted wild-type (WT) and Lhca2 (-a2) and Lhca3 (-a3) antisense
plants were illuminated with a PPFD of 700 µmol m 2
s 1. Leaves were taken from four plants, pooled, and
frozen in liquid nitrogen 0, 5, and 60 min after high-light treatment.
The pigment content was analyzed by HPLC and epoxidation state was
calculated as (V + A/2)/(V + A + Z), where A, V, and Z
denote concentrations of antheraxanthin, violaxanthin, and zeaxanthin,
respectively.
|
|
 |
DISCUSSION |
Photosynthesis is an extremely complex process in which hundreds
(if not thousands) of proteins are involved. PS I of higher plants
consists of at least 17 polypeptides, with additional proteins interacting with the complex. To define the functions of all these photosynthetic proteins is an important, but complex, task. However, the standard genetic procedure, of identifying mutants by phenotypic screening, isolating the corresponding gene, and investigating the
phenotype by physiological and biochemical methods is not readily
applicable due to problems in designing relevant screenings or
selections. Moreover, photosynthesis is essential for higher plants, so
null mutations in many photosynthetic genes are lethal. Instead, much
effort has been spent on biochemical characterization of photosynthetic
protein preparations and a large amount of data has been gathered on
the components of the photosynthetic machinery. In this situation,
reverse genetics is a powerful tool for dissecting the functions of the
different proteins. Antisense plants or knockout mutants can
potentially provide plant material lacking specific components of
multiprotein complexes. In this report, we show two examples of
successful reverse genetics where we have specifically repressed the
expression of two different LHC I proteins and used the transgenic
lines to obtain data related to their structure and function. We show
that the antisense effect not only effectively removes the proteins of
choice, but it is also specific in the sense that the mRNA levels
encoding related proteins are not affected. Under normal controlled
growth conditions, no effect of the transformations on growth could be
detected, and the absence of Lhca2 or Lhca3 did not affect the
xanthophyll cycle.
Structure of LHC I
Electron microscopy of negatively stained PSI-200 particles and
pigment stoichiometries have indicated that eight Lhca subunits are
associated with each PS I (Boekema et al., 1990 ). We have, however,
recently found that the Lhca protein composition of LHC I is flexible
and varies with both the intensity (Bailey et al., 2001 ) and spectral
properties (S. Benson, U. Ganeteg, P. Horton, and S. Jansson,
unpublished data) of the light during growth. Under standard laboratory
conditions, the mRNA levels of Arabidopsis Lhca1, Lhca2, Lhca3, and
Lhca4 are about the same (Jansson, 1999 ), so we believe that the LHC I
in "normal" light could consist of equimolar amounts of the four
polypeptides but that this is certainly not true for all light
conditions. Lhca1 and Lhca4 appear to exist mainly as heterodimers.
This has been corroborated by studies involving cross-linking,
reconstitution of the LHCI-730 complex, and subsequent fluorescence
measurements (Schmid et al., 1997 ). Our studies of antisense plants
(Zhang et al., 1997 ; S. Benson, U. Ganeteg, P. Horton, and S. Jansson, unpublished data), barley mutants (Bossman et al.,
1997 ), and Arabidopsis grown in different light intensities (Bailey et
al., 2001 ) have shown that Lhca1/Lhca4 stoichiometries may vary
considerably in vivo. This means that under some conditions these
proteins can appear without each other, perhaps as homodimers or monomers.
We found that the contents of the Lhca2 and Lhca3 proteins were
interdependent. In our opinion, this indicates that they are in
physical contact with each other in the PS I holocomplex. This could
suggest that Lhca2 and Lhca3 form a heterodimer, but cross-linking and
other data (Jansson et al., 1996 ) indicate that Lhca2 and Lhca3 form
homodimers instead. We believe that the interdependence implies that
Lhca2 and Lhca3 dimers are in contact with each other, as also
indicated by cross-linking data. Because both Lhca2 and Lhca3 could be
affected by removal of Lhca1/Lhca4 (U. Ganeteg and S. Jansson,
unpublished data), all Lhca dimers (two Lhca1/4, one Lhca2, and
one Lhca3) should be located adjacent to each other in PS I.
The Far-Red Fluorescing chls
It is known that Lhca2 and Lhca3 preparations have an in vitro
fluorescence at 680 nm (Knoetzel et al., 1992 ). We have shown that
Lhca2 and Lhca3 antisense plants have drastically reduced fluorescence
at long wavelengths, although the LHCI-730 dimer, which is thought to
be responsible for this fluorescence, is present in wild-type amounts.
Interpretations of fluorescence data are complicated because changes in
fluorescence do not necessarily mean that emitting chl molecules are
absent; for example, changes in reabsorption, excitation transfer, and
fluorescence quenching could also affect fluorescence yield, especially
in a mutant where rearrangements of the system could occur. Taken
together, we believe that the most probable explanation of our data
nevertheless is that Lhca2 and/or Lhca3 also bind far-red fluorescing
chls, with emission peaks at 733 nm. However, other explanations, for
example that chls bound to Lhca2 and/or Lhca3 are crucial for energy
transfer to LHCI-730, cannot be ruled out. A few far-red fluorescing
chl molecules have been shown to be present in each PS I complex, and
these are characterized by unusually large Stokes shifts (the difference between the excitation and fluorescence emission
wavelengths). For normal chl molecules, Stokes shifts are normally
around 3 to 4 nm, but the far-red fluorescing chls have been suggested to have 10 to 25 nm (Wittmershaus, 1987 ; Gobets et al., 1994 ), 6-11 nm
(Croce et al., 1998 ), and, most recently, 22-nm shifts (Ihalainen et
al., 2000 ). When our Lhca4 antisense lines are grown under conditions
in which they completely lack Lhca1 and Lhca4, 733-nm chls are
obviously missing, but long wavelength fluorescence is reduced by about
50% rather than being completely removed. The same holds true for the
Lhca2 and Lhca3 antisense lines. A preliminary analysis of the 77-K
fluorescence excitation spectra of the Lhca4 antisense plants also gave
results very similar to those of the Lhca2 and Lhca3 antisense plants,
i.e. strong positive peaks at 695 and 715 nm are found in the
difference spectra. This could easily be explained by assuming that
chls absorbing at 715 nm and emitting at 733 nm have been removed in
all three types of antisense plants, but less readily by assuming that
energy transfer to these pigments has been reduced by removal of Lhca2 and/or Lhca3. Thus, our data indicate that chls absorbing at 715 nm and
emitting at 733 nm with extremely large (18 nm) Stokes shifts, probably
due to an unusually strong coupling, are physically associated with
both Lhca1/4 and Lhca2/Lhca3. Ihalainen et al. (2000) also identified
chls associated with Lhca2 and Lhca3 that emit at 702 nm in isolated
LHC I preparations, although this fluorescence emission is not
detectable in PS I preparations. They conclude that these pigments in
the native PS I complex efficiently transfer their energy to the
chlorophylls emitting at 720 nm, 730 nm, and perhaps even to P700
itself. The pigments absorbing at 695 nm and giving rise to
fluorescence at long wavelengths that are missing in our Lhca2/Lhca3
deficient plants might be identical to these 702-nm chl. The fact that
we see no reduction in fluorescence emission at 702 nm in our plants
corroborate the suggestion by Ihalainen et al. (2000) that this
fluorescence is efficiently quenched in vivo.
If we accept the view that Lhca2 and/or Lhca3, in addition to
Lhca1/Lhca4, bind far-red fluorescing chl, the similar effect on
fluorescence upon removal of Lhca1/4 or Lhca2 (or Lhca3) suggests that
there are similar amounts of far-red fluorescing chls associated with
all Lhca dimers, perhaps one per dimer. This is also consistent with
the blue shift of Arabidopsis PsaK antisense plants, which have
slightly decreased amounts of Lhca2 and Lhca3 but wild-type levels of
Lhca1 and Lhca4 (Jensen et al., 2000 ), and the 77-K emission spectrum
of barley chlorina mutants (Bossman et al., 1997 ; Knoetzel
et al., 1998 ). This also implies that Lhca2 and Lhca3 preparations
differ from the native complexes, and that the 680-nm fluorescence
(used to designate the complex) is an artifact, probably due to the
monomerization of dimeric complexes during preparation.
We also observed a reduction in the relative efficiency of the
xanthophylls, but increased efficiency of chl b in exciting the 735-nm emitting forms in the antisense lines. Our interpretation of
this is that more LHC II is associated with PS I in the antisense lines, compensating for the loss of LHC I. LHC II binds more chl b than LHC I and, as a consequence, less chl a
and xanthophylls on a total pigment basis (Jansson, 1994 ). The
antisense plants should also show an increased reduction of their
plastoquinone pools if the PS I antenna size is decreased. Therefore,
LHC II phosphorylation will increase and the plant will be driven
toward state II, with a higher proportion of the mobile LHC II
associating with PS I. Again, other interpretations cannot be excluded.
In conclusion, we have found that Lhca2 and Lhca3, the polypeptides
previously collectively named LHCI-680, contribute to the long
wavelength fluorescence and thus we think that this name is
inappropriate and that Lhca2 and Lhca3 should be used to designate the
polypeptides instead. Our study also demonstrates the power of reverse
genetics because the different polypeptides can be studied in vivo,
where sometimes features such as fluorescence properties can be
strikingly different from those recorded in vitro. We finally want to
point out that the functions of the far-red fluorescing chl forms are
still unclear, but studies on these aspects are under way using the
different Lhca antisense lines.
 |
MATERIALS AND METHODS |
Plant Growth Conditions
Wild-type Arabidopsis ecotype Colombia and the transgenic plants
were germinated and grown on soil/perlite with a day/night temperature
regime of 23°C/18°C, a photoperiod of 8 h with a PPFD of 150 µmol m 2 s 1 (fluorescent lamps), and 75%
humidity. For screening seeds for positive transformants, plants were
germinated on plates with 1× Murashige and Skoog nutrients (Sigma, St.
Louis) and 50 µg mL 1 kanamycin, with a photoperiod of
16-h light.
Vector Construction
The binary vector pPCV702 (Koncz and Schell, 1986 ) was first
converted to a more versatile plant expression vector. pPCV702 DNA was
digested with EcoRI, the protruding ends were repaired using Klenow enzyme, and the vector was religated. After digestion with
BamHI, oligonucleotides (sequence: 5'
GAGCTCGAATTCGTCGACCCGGGAGATCCCC 3') were added and ligated into the
BamHI site. Thus, the new cloning vector, designated
pSJ10, had the single BamHI cloning site of pPCV702
(flanked by the cauliflower mosaic virus 35S promoter and the
polyadenylation signal) replaced with a
SacI/EcoRI/SalI/SmaI cloning cassette. The whole cDNA clone of Lhca2, amplified by PCR from
the full-length Arabidopsis expressed sequence tag (EST) clone 32F4T7
using the primers T7 (Life Technologies, Grand Island, NY) and
FWE (with the sequence 5' TCGCGAATTCGCGTACGTAAGCTTGGATCC 3'), was
EcoRI digested and cloned into the pSJ10 vector digested with EcoRI. The Lhca3 fragment was digested from the
full-length Lhca3 EST clone 40G8T7 with SalI and
NotI. The protruding ends were repaired and the fragment
was subcloned into pUC19 digested with SmaI. The
subclone was digested with SacI and SalI,
and the fragment was directionally cloned into
SacI/SalI digested pSJ10. The antisense
orientation of the Lhca2 and Lhca3 inserts was verified by DNA sequencing.
Arabidopsis Transformation
Adult Arabidopsis plants were transformed by in planta vacuum
infiltration with a solution containing Agrobacterium
tumefaciens, as follows. Arabidopsis seeds were sprinkled over
soil-filled pots covered with a piece of fly screen. The seedlings grew
through the fly screen and the plants were grown under
controlled-environment conditions with a photoperiod of 8 h. After
about 6 weeks, plants were shifted to a photoperiod of 16 h to
induce flowering. When the plants had developed a short inflorescence,
the pots with Arabidopsis plants were submerged in a solution
containing the A. tumefaciens (resuspended in 1×
Murashige and Skoog salts, 1% [w/v] Suc, and 0.044 µM benzylamino purine), a vacuum was applied and held for
5 min, before being rapidly released. After the transformation the
plants were placed in the growth chamber and seeds were collected. The
seeds were screened on Murashige and Skoog plates containing 50 µg mL 1 kanamycin. Kanamycin-resistant plants were
retained, screened by immunoblotting to verify the efficiency of the
antisense inhibition, allowed to self-pollinate, and the T2 (or T3)
generation was used for the following experiments. Seeds from the
antisense lines have (stock nos. CS3889, CS3890, CS3891, CS3892,
CS3893, and CS3894) have been deposited at the Arabidopsis Biological
Resource Stock Center (Ohio State University, Columbus).
Thylakoid Protein Preparation and Immunoblotting
Arabidopsis thylakoid proteins were prepared as described
previously (Zhang et al., 1997 ) from leaves of 6- to 8-week-old plants
taken 3 h into the photoperiod. The proteins were separated according to Jansson et al. (1997) , except that the preparations were
solubilized at 95°C. After electrophoresis the proteins were transferred to 0.2-µm nitrocellulose membranes (Micron Separations Inc., Westborough, MA) using a minitrans blot system (Bio-Rad, Hercules, CA) as recommended by the vendor. The antibody collection used to detect the different LHC proteins was essentially identical to
the one described before (Jansson et al., 1997 ), although new batches
of Lhca1 and Lhca4 antibodies were prepared using the same antigens as
described earlier (Król et al., 1995 ).
RNA Preparation and Northern-Blot Analysis
Leaf samples for RNA preparation were taken 3 h into the
photoperiod, frozen in liquid nitrogen, and stored at 80°C. RNA was
prepared from 100 mg of leaf tissue from five plants using TRIZOL
Reagent (Molecular Research, Inc., Cincinnati) as recommended by
the vendor. The purity and concentration of the preparations were
determined spectrophotometrically (GeneQuant, Pharmacia, Uppsala).
Northern-blot analyses were performed on 2-µg RNA samples as
described earlier (Strand et al., 1997 ). Homologous Arabidopsis EST
clones (Jansson, 1999 ) were used as probes for transcripts of the
different Lhca genes. A 25S rDNA probe was used as a
control to check that loading was equal.
Fluorescence Spectrum Measurements
The chl emission and excitation spectra at 77 K were measured,
using a fluorescence spectrophotometer (Fluoro-Max-2, ISA Inc., Edison,
NJ), in dark-adapted intact leaves directly exposed to the
growth light of 6- to 8-week-old plants. Fluorescence emission spectra
were measured using an excitation light with a wavelength of 440 nm,
and the spectra were normalized to the 680-nm peak. The fluorescence
excitation spectra were measured at different emission wavelengths with
an integration time of 0.5 s, with a 3-nm slit width, and the
spectra were normalized to the 439-nm chl a peak.
Pigment Preparation and Analysis
For pigment measurements, four plants from each line were dark
adapted for 16 h and subsequently illuminated with a PPFD of 700 µmol m 2 s 1. Leaves from the four plants
were taken, pooled, and frozen in liquid nitrogen after 0, 5, and 60 min. The pigments were extracted in 80% (v/v) acetone, and
after centrifugation the pellet was re-extracted with 100% (v/v)
acetone. The two extracts were pooled and the pigment
composition was analyzed by HPLC as described previously (Król et
al., 1995 ). The epoxidation states of the xanthophyll pigments were
calculated according to the formula: [(V + A/2)/(V + A + Z)], where
V, A, and Z are the concentrations of violaxanthin, antheraxanthin, and
zeaxanthin, respectively.
 |
ACKNOWLEDGMENTS |
We are grateful to the Ohio Stock Center for EST clones, Olof
Olsson for providing pPCV702 and sequence data, Peter Horton for useful
comments, Igor Rojdestvenski for help with Gaussian deconvolution, and
Jan Dekker for sharing unpublished data.
 |
FOOTNOTES |
Received March 19, 2001; returned for revision March 29, 2001; accepted June 6, 2001.
1
This work was supported by grants from the
Swedish Forestry and Agricultural Research Council.
*
Corresponding author; e-mail ulrika.ganeteg{at}plantphys.umu.se;
fax 46-90-7866676.
 |
LITERATURE CITED |
-
Andersson J, Walters R, Horton P, Jansson S
(2001)
Antisense inhibition of the photosynthetic antenna proteins CP29 and CP26: implications for the mechanism of protective energy dissipation.
Plant Cell
13: 1193-1204[Abstract/Free Full Text]
-
Bailey S, Walters R, Jansson S, Horton P (2001) Acclimation of
Arabidopsis thaliana to the light environment:
the existence of separate low light and high light responses. Planta
(in press)
-
Boekema E, Wynn R, Malkin R
(1990)
The structure of spinach photosystem I studied by electron microscopy.
Biochim Biophys Acta
1017: 49-56[CrossRef]
-
Bossman B, Knoetzel J, Jansson S
(1997)
Screening of chlorina mutants of barley (Hordeum vulgare L.) with antibodies against light-harvesting proteins of PS I and PS II: absence of specific antenna proteins.
Photosynth Res
52: 127-136[CrossRef]
-
Croce R, Zucchelli G, Garlaschi FM, Jennings RC
(1998)
A thermal broadening study of the antenna chlorophylls in PSI-200, LHCI, and PSI core.
Biochemistry
37: 17355-17360[CrossRef][Medline]
-
Gobets B, van Amerongen H, Monshouwer R, Kruip J, Rogner M, van Grondelle R, Dekker J
(1994)
Polarized site-selected fluorescence spectroscopy of isolated photosystem I particles.
Biochim Biophys Acta
1188: 75-85[CrossRef]
-
Ihalainen JA, Gobets B, Sznee K, Brazzoli M, Croce R, Bassi R, van Grondelle R, Korppi-Tommola JEI, Dekker JP
(2000)
Evidence for two spectroscopically different dimers of light-harvesting complex I from green plants.
Biochemistry
39: 8625-8631[CrossRef][Medline]
-
Jansson S
(1994)
The light-harvesting chlorophyll a/b binding-proteins.
Biochim Biophys Acta
1184: 1-19[Medline]
-
Jansson S
(1999)
A guide to the Lhc genes and their relatives in Arabidopsis.
Trends Plant Sci
4: 236-240[CrossRef][Web of Science][Medline]
-
Jansson S, Andersen B, Scheller HV
(1996)
Nearest-neighbor analysis of higher-plant photosystem I holocomplex.
Plant Physiol
112: 409-420[Abstract]
-
Jansson S, Stefánsson H, Nyström U, Gustafsson P, Albertsson P-Å
(1997)
Antenna protein composition of PS I and PS II in thylakoid sub-domains.
Biochim Biophys Acta
1320: 297-309[CrossRef]
-
Jensen PE, Gilpin M, Knoetzel J, Scheller HV
(2000)
The PSI-K subunit of photosystem I is involved in the interaction between light-harvesting complex I and the photosystem I reaction center core.
J Biol Chem
275: 24701-24708[Abstract/Free Full Text]
-
Knoetzel J, Bossmann B, Grimme LH
(1998)
Chlorina and viridis mutants of barley (Hordeum vulgare L.) allow assignment of long-wavelength chlorophyll forms to individual Lhca proteins of photosystem I in vivo.
FEBS Lett
436: 339-342[CrossRef][Medline]
-
Knoetzel J, Svendsen I, Simpson DJ
(1992)
Identification of the Photosystem I antenna polypeptides in barley: isolation of three pigment-binding antenna complexes.
Eur J Biochem
206: 209-215[Web of Science][Medline]
-
Koncz C, Schell J
(1986)
The promoter of the TL-DNA gene 5 controls the tissue specific expression of chimeric genes carried by a novel type of Agrobacterium binary vector.
Mol Gen Genet
204: 383-396[CrossRef][Web of Science]
-
Król M, Spangfort MD, Huner NP, Öquist G, Gustafsson P, Jansson S
(1995)
Chlorophyll a/b-binding proteins, pigment conversions, and early light-induced proteins in a chlorophyll b-less barley mutant.
Plant Physiol
107: 873-883[Abstract]
-
Lam E, Ortiz W, Malkin R
(1984)
Chlorophyll a/b proteins of photosystem I.
FEBS Lett
168: 10-14[CrossRef]
-
Li X-P, Björkman O, Shih C, Grossman AR, Rosenquist M, Jansson S, Niyogi KK
(2000)
A pigment-binding protein essential for regulation of photosynthetic light harvesting.
Nature
403: 391-395[CrossRef][Medline]
-
Pålsson LO, Flemming C, Gobets B, van Groendelle R, Dekker JP, Schlodder E
(1998)
Energy transfer and charge separation in photosystem I: P700 oxidation upon selective excitation of the long-wavelength antenna chlorophylls of Synechococcus elongatus.
Biophys J
74: 2611-2622[Medline]
-
Rivadossi A, Zucchelli G, Garlaschi FM, Jennings RC
(1999)
The importance of PS I chlorophyll red forms in light-harvesting by leaves.
Photosynth Res
60: 209-215[CrossRef]
-
Schmid VH, Cammarata KV, Bruns BU, Schmidt GW
(1997)
In vitro reconstitution of the photosystem I light-harvesting complex LHCI-730: heterodimerization is required for antenna pigment organization.
Proc Natl Acad Sci USA
94: 7667-7672[Abstract/Free Full Text]
-
Strand Å, Hurry V, Gustafsson P, Gardeström P
(1997)
Development of Arabidopsis thaliana leaves at low temperatures releases the suppression of photosynthesis and photosynthetic gene expression despite the accumulation of soluble carbohydrates.
Plant J
12: 605-614[CrossRef][Web of Science][Medline]
-
Wittmershaus B
(1987)
Measurements and kinetic modeling of picosecond time resolved fluorescence from photosystem I and chloroplasts.
In
J Biggins, ed, Progress in Photosynthesis Research 1. Martinus Nijhoff Publisher, Dordrecht, The Netherlands, pp 75-82
-
Zhang H, Goodman HM, Jansson S
(1997)
Antisense inhibition of the photosystem I antenna protein Lhca4 in Arabidopsis thaliana.
Plant Physiol
115: 1525-1531[Abstract]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
E. Wientjes, G. T. Oostergetel, S. Jansson, E. J. Boekema, and R. Croce
The Role of Lhca Complexes in the Supramolecular Organization of Higher Plant Photosystem I
J. Biol. Chem.,
March 20, 2009;
284(12):
7803 - 7810.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Kovacs, J. Damkjaer, S. Kereiche, C. Ilioaia, A. V. Ruban, E. J. Boekema, S. Jansson, and P. Horton
Lack of the Light-Harvesting Complex CP24 Affects the Structure and Function of the Grana Membranes of Higher Plant Chloroplasts
PLANT CELL,
November 1, 2006;
18(11):
3106 - 3120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. L.E. Sjogren, T. M. Stanne, B. Zheng, S. Sutinen, and A. K. Clarke
Structural and Functional Insights into the Chloroplast ATP-Dependent Clp Protease in Arabidopsis
PLANT CELL,
October 1, 2006;
18(10):
2635 - 2649.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Ruban, S. Solovieva, P. J. Lee, C. Ilioaia, M. Wentworth, U. Ganeteg, F. Klimmek, W. S. Chow, J. M. Anderson, S. Jansson, et al.
Plasticity in the Composition of the Light Harvesting Antenna of Higher Plants Preserves Structural Integrity and Biological Function
J. Biol. Chem.,
May 26, 2006;
281(21):
14981 - 14990.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Morosinotto, M. Ballottari, F. Klimmek, S. Jansson, and R. Bassi
The Association of the Antenna System to Photosystem I in Higher Plants: COOPERATIVE INTERACTIONS STABILIZE THE SUPRAMOLECULAR COMPLEX AND ENHANCE RED-SHIFTED SPECTRAL FORMS
J. Biol. Chem.,
September 2, 2005;
280(35):
31050 - 31058.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Naumann, E. J. Stauber, A. Busch, F. Sommer, and M. Hippler
N-terminal Processing of Lhca3 Is a Key Step in Remodeling of the Photosystem I-Light-harvesting Complex Under Iron Deficiency in Chlamydomonas reinhardtii
J. Biol. Chem.,
May 27, 2005;
280(21):
20431 - 20441.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Storf, S. Jansson, and V. H. R. Schmid
Pigment Binding, Fluorescence Properties, and Oligomerization Behavior of Lhca5, a Novel Light-harvesting Protein
J. Biol. Chem.,
February 18, 2005;
280(7):
5163 - 5168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. E. Jensen, A. Haldrup, S. Zhang, and H. V. Scheller
The PSI-O Subunit of Plant Photosystem I Is Involved in Balancing the Excitation Pressure between the Two Photosystems
J. Biol. Chem.,
June 4, 2004;
279(23):
24212 - 24217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Ganeteg, C. Kulheim, J. Andersson, and S. Jansson
Is Each Light-Harvesting Complex Protein Important for Plant Fitness?
Plant Physiology,
January 1, 2004;
134(1):
502 - 509.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. Desquilbet, J.-C. Duval, B. Robert, J. Houmard, and J. C. Thomas
In the Unicellular Red Alga Rhodella violacea Iron Deficiency Induces an Accumulation of Uncoupled LHC
Plant Cell Physiol.,
November 15, 2003;
44(11):
1141 - 1151.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. N. Melkozernov and R. E. Blankenship
Structural Modeling of the Lhca4 Subunit of LHCI-730 Peripheral Antenna in Photosystem I Based on Similarity with LHCII
J. Biol. Chem.,
November 7, 2003;
278(45):
44542 - 44551.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Wissel, F. Pettersson, A. Berglund, and S. Jansson
What Affects mRNA Levels in Leaves of Field-Grown Aspen? A Study of Developmental and Environmental Influences
Plant Physiology,
November 1, 2003;
133(3):
1190 - 1197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Zolla, S. Rinalducci, A. M. Timperio, and C. G. Huber
Proteomics of Light-Harvesting Proteins in Different Plant Species. Analysis and Comparison by Liquid Chromatography-Electrospray Ionization Mass Spectrometry. Photosystem I
Plant Physiology,
December 1, 2002;
130(4):
1938 - 1950.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. H. R. Schmid, S. Potthast, M. Wiener, V. Bergauer, H. Paulsen, and S. Storf
Pigment Binding of Photosystem I Light-harvesting Proteins
J. Biol. Chem.,
September 27, 2002;
277(40):
37307 - 37314.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Varotto, P. Pesaresi, P. Jahns, A. Lessnick, M. Tizzano, F. Schiavon, F. Salamini, and D. Leister
Single and Double Knockouts of the Genes for Photosystem I Subunits G, K, and H of Arabidopsis. Effects on Photosystem I Composition, Photosynthetic Electron Flow, and State Transitions
Plant Physiology,
June 1, 2002;
129(2):
616 - 624.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. E. Jensen, L. Rosgaard, J. Knoetzel, and H. Vibe Scheller
Photosystem I Activity Is Increased in the Absence of the PSI-G Subunit
J. Biol. Chem.,
January 18, 2002;
277(4):
2798 - 2803.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|